Application of material for knocking out ta jaz7 gene in improving resistance of crops to gibberella disease

Abstract

The present application relates to the application of a substance knocking out a TaJAZ7 gene in improving the resistance of crops to scab, and belongs to the technical field of plant genetic engineering; the present application first discovers the correlation between the TaJAZ7 gene and the resistance to scab, and uses the CRISPR / Cas9 gene editing technology to specifically knock out the TaJAZ7 gene in a receptor material, to obtain an edited plant CR-Tajaz7 with a changed TaJAZ7 sequence; the single flower dripping method is used to identify the resistance to scab of the T2 generation homozygous plants; compared with the receptor parent Fielder, the edited plant CR-Tajaz7 has a significantly improved resistance to scab, and can be used to create new germplasm resistant to scab; the gene and the application provide a new way for the prevention and treatment of crop scab, and have a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the application of a substance that knocks out the TaJAZ7 gene in improving the resistance of crops to Fusarium head blight. Background Technology

[0002] Fusarium head blight (FHB) is an important fungal disease caused by Fusarium graminearum. It occurs widely globally, and is particularly severe in warm, humid climates. FHB not only significantly reduces crop yields (such as wheat, barley, oats, and corn), but also produces toxic mycotoxins (such as deoxynivalenol, DON), contaminating food and feed and seriously threatening human and animal health. Discovering new FHB resistance genes can provide theoretical and practical basis for breeding resistant varieties, promoting the development and application of FHB-resistant varieties in production, and contributing to national food security and food safety.

[0003] Jasmonic acid (JA) is an important plant hormone widely involved in plant growth, development, disease resistance, and stress response. Activation of this pathway can enhance plant disease resistance, such as by strengthening cell walls and inducing the expression of antimicrobial proteins. JAZ proteins (Jasmonate ZIM-domain proteins) are key negative regulators of the jasmonic acid (JA) signaling pathway. They negatively regulate the JA signaling pathway by binding to the transcription factor MYC2 and inhibiting its transcriptional activity. Damaged or mutated JAZ proteins can relieve the inhibition of MYC2, activating the JA signaling pathway. Currently, the correlation between JAZ proteins and plant resistance to Fusarium head blight has not been reported. Summary of the Invention

[0004] To address the aforementioned issues, this application is the first to discover the correlation between wheat TaJAZ7 protein and plant resistance to Fusarium head blight. Furthermore, by using CRISPR / Cas9 gene editing technology, the wheat TaJAZ7 protein encoding gene was specifically knocked out, activating the jasmonic acid signaling pathway, thereby enhancing wheat resistance to Fusarium head blight and creating a new germplasm resistant to Fusarium head blight.

[0005] Specifically, this application is implemented through the following technical solution:

[0006] First, this application provides the application of substances that knock out the TaJAZ7 gene in improving crop resistance to Fusarium head blight. The aforementioned crops include at least one of wheat, barley, oats, and maize.

[0007] The wheat TaJAZ7 protein encoding gene (Genbank accession numbers: XM_044504103.1, XM_044515353.1 and XM_044522279.1) was screened in this application to obtain three homologous genes, TaJAZ7-A, TaJAZ7-B and TaJAZ7-D, whose nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, and whose encoded protein amino acid sequences are shown in SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, respectively.

[0008] Furthermore, the above application refers to introducing a vector containing the TaJAZ7 gene knockout material or an Agrobacterium strain containing said vector into the cells, tissues, or individual plants of a host plant to create gene-edited materials resistant to Fusarium head blight. The TaJAZ7 gene knockout material includes the gene-editing vector CR-TaJAZ7. The host plants include barley, wheat, oats, or maize. The vectors used are conventional vectors in the field, including but not limited to the vector pBUE411 (commercially available vector), such as the vector disclosed in the literature "Xing, Hui-Li, et al. ACRISPR / Cas9 toolkit for multiplex genome editing in plants." BMC plant biology 14(2014):1-12." In specific implementations, vectors such as pYLCRISPR / Cas9Pubi-H, pYLCRISPR / Cas9pUbi-N, pYLCRISPR / Cas9P35S-B, and pYLCRISPR / Cas9Pubi-B can also be used; the Agrobacterium used is also a conventional Agrobacterium, including but not limited to conventional commercially available Agrobacterium strains such as Agrobacterium EHA105.

[0009] The steps of this application include: knocking out the TaJAZ7 gene using the CRISPR / Cas9 system to alter the structure or function of the TaJAZ7 gene; the CRISPR / Cas9 system contains a target sequence sgRNA (SEQ ID NO.4) that simultaneously targets the TaJAZ7-A, TaJAZ7-B, and TaJAZ7-D genes.

[0010] Furthermore, the specific steps for the above application are as follows:

[0011] 1) Preparation of vectors containing the TaJAZ7 gene target sequence

[0012] The forward primer (SEQ ID NO.8) and the reverse primer (SEQ ID NO.9) were dissolved in TE to prepare a 100 μM stock solution. 1 μl of each primer was added to 98 μl of 0.5×TE and diluted to 1 μM. The mixture was annealed at 90℃ for 30 s and then cooled to room temperature to obtain the fusion product.

[0013] The fusion product was ligated to the CRISPR / Cas9 system vector according to the following regimen: 2 μl fusion product, 60-80 ng pBUE411 plasmid, 1.5 μl 10×CutSmart Buffer, 1.5 μl 10 mM ATP, 10 U Bsa I-HF restriction enzyme, 35 U T4 ligase, and ddH2O was added to a total volume of 15 μl. Enzyme digestion and ligation were performed using variable temperature cycling for approximately 10-15 cycles: 37℃ for 5 min; 10℃ for 5 min; 20℃ for 5 min; and finally 37℃ for 5 min, yielding the gene editing vector CR-TaJAZ7, which contains the TaJAZ7 gene target sequence sgRNA (SEQ ID NO. 4).

[0014] The CRISPR / Cas9 system vectors used in this application include, but are not limited to, the vector pBUE411, which is a conventional commercially available vector, as disclosed in the literature “Xing, Hui-Li, et al. A CRISPR / Cas9 toolkit for multiplexgenome editing in plants. BMC plant biology 14(2014):1-12.”

[0015] 2) Transform the editing vector CR-TaJAZ7 obtained in step 1) into E. coli, select positive clones and extract plasmids;

[0016] 3) The plasmid obtained in step 2) is transferred into Agrobacterium to obtain the transformant; the Agrobacterium used includes, but is not limited to, conventional commercially available Agrobacterium strains such as Agrobacterium EHA105.

[0017] 4) The transformant bacteria obtained in step 3) are introduced into the embryonic embryo of the host plant through genetic transformation to obtain gene-edited plants T0. The T0 generation is continuously self-crossed to obtain T2 generation edited plants. Gene detection is performed on the T2 generation edited plants, and homozygous edited plants are selected to obtain gene-edited plants with improved resistance to Fusarium head blight.

[0018] The aforementioned “genetic transformation” refers to the use of conventional plant transgenic technology in this field, such as the genetic transformation method disclosed in the literature “Hayta S, Smedley MA, Clarke M, et al. An Efficient Agrobacterium-Mediated Transformation Protocol for Hexaploid and Tetraploid Wheat[J]. Current Protocols, 2021, 1(3).”, to introduce a vector containing the TaJAZ7 gene target sequence or an Agrobacterium strain containing the vector into a plant to create gene-edited plants resistant to Fusarium head blight.

[0019] Preferably, the host plant mentioned above includes, but is not limited to, wheat, barley, and corn, to obtain gene-edited material containing the gene for production.

[0020] This invention utilizes CRISPR / Cas9 gene editing technology to edit the TaJAZ7 gene in recipient materials, obtaining the TaJAZ7-edited plant CR-Tajaz7. Using the single-flower drip method, the resistance to Fusarium head blight in the T2 generation homozygous plants was identified. Compared with the recipient parent Fielder, the edited plant CR-Tajaz7 showed significantly improved resistance to Fusarium head blight and can be used to create new wheat germplasm resistant to Fusarium head blight. This method provides a new approach for the control of wheat Fusarium head blight and has broad application prospects. Attached Figure Description

[0021] Figure 1 This is a diagram of the TaJAZ7 gene structure.

[0022] Figure 2 A schematic diagram of the target region DNA sequence for plants with the TaJAZ7 gene edited.

[0023] Figure 3 Fusarium head blight resistance phenotype of T2 generation homozygous edited plants with TaJAZ7 gene editing.

[0024] Figure 4 Statistical results of the number of spikelets infected with Fusarium head blight in T2 generation homozygous edited plants with TaJAZ7 gene. Detailed Implementation

[0025] Unless otherwise specified, all methods and reagents used in the examples are conventional in the art. The wheat variety Fielder involved is a common variety, as disclosed in the literature "He Y, Wu L, Liu X, et al. TaUGT6, a novel UDP-glycosyltransferase gene enhances the resistance to FHB and DON accumulation in wheat[J]. Frontiers in Plant Science, 2020:1549." The Fielder wheat in this example was preserved by the Wheat Genetics and Breeding Team of the Institute of Food Crops, Jiangsu Academy of Agricultural Sciences.

[0026] All reagents and carriers used in the examples are commercially available.

[0027] The pBUE411 vector (plasmid) was purchased from Addgene (Plasmid #62200).

[0028] BsaⅠ restriction endonuclease and T4 DNA ligase were purchased from BioLabs.

[0029] Escherichia coli DH5α and Agrobacterium tumefaciens EHA105 (catalog number: AC1012) were both purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0030] The plasmid extraction kit was purchased from Nanjing Novizan Biotechnology Co., Ltd.

[0031] Other chemical reagents, such as tryptone, agar powder, sodium chloride, and kanamycin (Kan, 50 μg / mL), were all domestically produced analytical grade reagents.

[0032] LB+Kan solid medium: 10g Tryptone, 5g Yeast Extract, 10g NaCl, add water to 1000mL, adjust pH to 7.2; then add agar powder to a final concentration of 1.8% and Kan to a final concentration of 50μg / ml.

[0033] Example 1: Creation of the CRISPR / Cas9 gene-edited wheat plant CR-Tajaz7

[0034] Based on previous research, this embodiment screened and obtained three homologous genes of the TaJAZ7 gene: TaJAZ7-A, TaJAZ7-B, and TaJAZ7-D. Their nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively, and the edited amino acid sequences are shown in SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7, respectively. The structure of the TaJAZ7 gene is as follows: Figure 1 As shown, Figure 1 In the diagram, the white boxes represent the 5'-UTR and 3'-UTR, the blue boxes represent the exon regions, the orange boxes represent the two conserved functional domains TIFY and Jas of TaJAZ7, and the black lines represent the gene editing target site sgRNA (SEQ ID NO.4).

[0035] The steps for creating the CRISPR / Cas9 gene-edited plant CR-Tajaz7 are as follows:

[0036] 1) Target site sequences that simultaneously target three homologous genes of TaJAZ7 were designed using the publicly available website http: / / crispr.hzau.edu.cn / CRISPR-Cereal / , and forward primers containing the target site sgRNA were designed: SEQ ID NO.8: CTTGGAGAAGCGCAAGGACCGCCTCGG and reverse primers: SEQ ID NO.9: AAACCCGAGGCGGTCCTTGCGCTTCTC.

[0037] The primers were synthesized at Sangon Biotech (Shanghai) Co., Ltd., and dissolved in TE to prepare a 100 μM stock solution. 1 μl of each primer was added to 98 μl of 0.5×TE and diluted to 1 μM. The mixed primers were heated to about 90℃ for 30s and then cooled to room temperature (25℃) to complete the annealing process, thus obtaining the fusion product.

[0038] 1) Ligate the fusion product with the pBUE411 vector according to the following system: 2 μl fusion product, 60 ng pBUE411 plasmid, 1.5 μl 10×CutSmart Buffer, 1.5 μl 10 mM ATP, 10 U Bsa I-HF restriction enzyme, 35 UT4 ligase, and add ddH2O to a total volume of 15 μl.

[0039] Enzyme digestion and ligation were performed using variable temperature cycling for 15 cycles: 37℃ for 5 min; 10℃ for 5 min; 20℃ for 5 min; and finally 37℃ for 5 min to obtain the ligation product.

[0040] 3) The ligation products were transformed into *E. coli* DH5α strain using the heat shock method. Positive clones were then screened on LB+Kan solid medium, and plasmids were extracted. Positive clones were identified by PCR and sequenced for verification. The sequencing primers were SEQ ID NO. 10: TTGACTAGCGTGCTGATAATTTGTG and SEQ ID NO. 11: GACAGGCGTCTTCTACTGGTGCTAC. The plasmid that correctly aligned (i.e., the target site sequence in the plasmid matched SEQ INNO. 4) was named the gene editing vector CR-TaJAZ7.

[0041] 4) The gene editing vector CR-TaJAZ7 was transformed into Agrobacterium EHA105. The general embryo-based genetic transformation method was used: the fertilized wheat variety Fielder embryos were removed in a sterile environment, placed in WLS-liq medium, centrifuged for 10 min, and Agrobacterium containing the target gene was added for 5 min. The embryos were placed in WLS-AS medium with the scutellum facing up and cultured in the dark. After 3 days, the hypocotyl was removed and transferred to WLS-Res medium and cultured in the dark for 5 days. Then, they were transferred to WLS-P5 medium and cultured for 2 weeks. After that, they were transferred to WLS-P10 medium and cultured in the dark for 3 weeks. Finally, they were transferred to LSZ-P5 medium and cultured under continuous light to differentiate into seedlings, thus obtaining transgenic T0 generation wheat plants.

[0042] The above transformation method is a conventional method in this field. This embodiment adopts the method disclosed in the literature "Ishida Y, Tsunashima M, Hiei Y, et al. Wheat (Triticum aestivum L.) transformation using immature embryos [M]. Agrobacterium protocols. Springer, New York, NY, 2015: 189-198.", and all the culture media involved are prepared according to the method disclosed in that literature. 5) T0 generation self-pollination and harvesting to produce T1 generation, T1 generation self-pollination and harvesting to produce T2 generation. For T2 generation wheat plants, the TaJAZ7-4A gene sequence was detected using the forward primer SEQ ID NO.12: CGAGACGAGACGAGAGAACA and the reverse primer SEQ ID NO.13: CAGACATGGAGGAAGCGTTG. The TaJAZ7-4B gene sequence was detected using the forward primer SEQ ID NO.14: GAGACGACAAGTGTT and the reverse primer SEQ ID NO.15: TGAACTCAATCTCTGGGCGA. The TaJAZ7-4D gene sequence was detected using the forward primer SEQ ID NO.16: CGTCTCCTTCACTCGCCTAA and the reverse primer SEQ ID NO.17: TCCTTCTGAGCGAACCATGA. Homozygous edited plants with simultaneous knockout of TaJAZ7 on chromosomes A, B, and D were obtained through screening and named CR-TaJAZ7-11 (hereinafter referred to as 11) and CR-TaJAZ7-15 (hereinafter referred to as 15), respectively. Their corresponding gene knockout sequences are as follows: Figure 2 As shown in the figure, black letters represent the target sequence, green letters represent the PAM sequence, and horizontal lines "-" indicate base deletions. It can be seen that, compared to the recipient material Fielder, the CR-Tajaz7-11 edited plant has one base deletion on chromosomes 4A, 4B, and 4D, while the CR-Tajaz7-15 edited plant has one base deletion on chromosomes 4A and 4D, and two base deletions on chromosome 4B.

[0043] Example 2: Application of TaJAZ7 knockout in improving Fusarium head blight resistance in wheat

[0044] The gene-edited wheat plants (11 and 15) obtained in Example 1 above were subjected to Fusarium head blight resistance identification. The inoculation method was in accordance with the method disclosed in NY / T2954-2016. The identification method is as follows: 10 μl of a fungus containing 1×10⁻⁶ bacteria was inoculated into one spikelet from the upper part of the spike at the beginning of flowering. 5Fusarium graminearum spore solution (Fg1312, preserved in the applicant's laboratory), bagged and moistened for 3 days, phenotypic photos of the gene-edited strain 15 days after infection with Fusarium graminearum are shown below. Figure 3 As shown, Figure 4 The statistical results of the number of diseased spikelets show that the resistance level of wheat plants with TaJAZ7 knockout was significantly improved.

[0045] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of TaJAZ7 gene knockout in improving wheat scab resistance; the TaJAZ7 gene has three homologous genes TaJAZ7-A, TaJAZ7-B, and TaJAZ7-D, whose nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.

2. The application according to claim 1, characterized in that, The application refers to introducing a vector containing the TaJAZ7 gene knockout or an Agrobacterium strain containing the vector into wheat cells, tissues, or individuals to improve wheat resistance to Fusarium head blight.

3. The application according to claim 2, characterized in that, The vector containing the TaJAZ7 gene knockout refers to a gene editing vector containing the TaJAZ7 gene target sequence, the nucleotide sequence of which is shown in SEQ ID NO.

4.

4. The application according to claim 2, characterized in that, The specific steps are as follows: 1) Prepare gene editing vectors containing the TaJAZ7 gene target sequence; The forward and reverse primers are connected to obtain the fusion product, and then the fusion product is connected to the CRISPR / Cas9 system vector to obtain the gene editing vector. The nucleotide sequences of the forward and reverse primers are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively. 2) Transform the gene editing vector obtained in step 1) into E. coli and extract the plasmid; 3) The plasmid obtained in step 2) is transferred into Agrobacterium to obtain the transformant; 4) The transformant bacteria obtained in step 3) are introduced into the young wheat embryo of the host through genetic transformation to obtain gene-edited plants T0. The T0 generation is continuously self-crossed to obtain T2 generation edited plants. Gene detection is performed on the T2 generation edited plants, and homozygous edited plants are selected, which have improved resistance to Fusarium head blight.

5. The application according to claim 4, characterized in that, Step 1) The CRISPR / Cas9 system carrier is carrier pBUE411.

6. The application according to claim 4, characterized in that, Step 3) The Agrobacterium used is Agrobacterium EHA105.

Images