PMP1, a male sterility gene in rice, and its application

By regulating male reproduction in rice through genetic engineering and using the PMP1 gene mutant to delay meiosis, the complexity of seed heterosis in three-line hybrid rice was solved, enabling the creation of male-sterile rice lines and improving breeding efficiency and the screening of superior combinations.

CN119709849BActive Publication Date: 2025-10-28YANGZHOU UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510085405.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-20
Publication Date
2025-10-28
Estimated Expiration
2045-01-20

AI Technical Summary

Technical Problem

Existing three-line hybrid rice seeds exhibit complex heterosis, making it difficult to screen for superior combinations and expand the cytoplasmic background, thus affecting the efficiency of hybridization breeding.

Method used

By using genetic engineering techniques, the PMP1 gene and its protein were used to regulate male reproduction in rice, and a male-sterile rice line was constructed. PMP1 gene mutants were prepared using the CRISPR-Cas9 site-directed editing method, which delayed the prophase I process of meiosis and achieved the male-sterile trait.

Benefits of technology

A new male-sterile rice line was obtained, which simplified the breeding process, improved the efficiency of hybridization breeding and the possibility of screening superior combinations, and has great breeding potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119709849B_ABST
    Figure CN119709849B_ABST
Patent Text Reader

Abstract

This invention discloses a rice male sterility gene. PMP1 Its applications involve using genetic engineering to control the male reproductive development of rice through mutations. PMP1 The gene-encoded protein or the inhibition of its expression produced a new male-sterile rice line. This male-sterile line produces no pollen at all during the reproductive growth stage, but the pistil can be pollinated normally and produce seeds, making this male-sterile rice line very important for agricultural production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of plant genetic engineering and rice breeding technology, specifically relating to a rice male sterility gene. PMP1 And its applications. Background Technology

[0002] Rice is one of the world's most important food crops, with about half the world's population relying on it as their staple food. China is the world's largest producer and consumer of rice, with over 60% of its population eating rice as their main food source. my country began research on hybrid rice in the 1960s, utilizing hybrid vigor to increase yields, and successfully implemented the three-line hybrid rice system in the 1970s. Since then, hybrid rice has been widely applied, making a significant contribution to increased grain production. Rice is a self-pollinating crop with numerous small florets, making artificial emasculation very difficult in hybridization breeding. Male-sterile lines, by avoiding the artificial emasculation process, offer more possibilities for hybridization breeding.

[0003] The three-line hybrid rice system includes sterile lines, maintainer lines, and restorer lines. Sterile lines are cytoplasmic male-sterile lines that cannot produce offspring through self-pollination. Maintainer lines do not carry male-sterile genes in their cytoplasm and can therefore maintain their reproduction through self-pollination. Restorer lines contain nuclear restorer genes in their nuclei; therefore, hybridization using the restorer line as the male parent and the sterile line as the female parent can produce F1 plants with hybrid vigor for commercial breeding. However, the expression of seed vigor in three-line hybrid rice is complex and limited by the relationship between restorer and maintainer lines, making the selection of superior combinations difficult. Therefore, scientists have been screening and breeding new sterile lines to expand the cytoplasmic background and lay the foundation for distant hybridization and the utilization of heterosis. Summary of the Invention

[0004] This invention addresses the technical problem by overcoming the shortcomings of existing technologies and provides a rice male sterility gene PMP1 and its applications. PMP1 ( Prolong Meiotic Prophase 1 The characteristics of the gene and its protein involved in regulating male reproduction in rice, and the use of genetic engineering to control the development of male reproduction in rice, by mutating the protein sequence or inhibiting the expression of the protein to produce new male-sterile rice lines, have very important applications in agricultural production.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] In a first aspect, the present invention provides PMP1 The application of genes in the breeding of male-sterile rice lines, the aforementioned PMP1 Genes are LOC_Os03g50780 Genes, the ones mentioned PMP1The nucleotide sequence of the gene is shown in SEQ ID No. 1, and the amino acid sequence it encodes is shown in SEQ ID No. 2.

[0007] Secondly, the present invention also provides a rice male sterility method. PMP1 A mutant of the gene, wherein the mutant is the LOC_Os03g50780 gene in which a base G is replaced by A in the third exon, its CDS is shown in SEQ ID No. 3, and its amino acid sequence is shown in SEQ ID No. 4.

[0008] Thirdly, the present invention provides a method for creating a male-sterile rice line, comprising the following steps: selecting a conventional rice variety, treating it, and cultivating it to obtain the male-sterile rice line; wherein the treatment is to use conventional genetic engineering methods to knock out or alter the coding sequence shown in SEQ ID No. 1, causing the amino acid sequence shown in SEQ ID No. 2 to be deleted or mutated, thereby reducing or eliminating the activity of the polypeptide corresponding to the amino acid sequence, and obtaining the male-sterile rice line.

[0009] Preferably, the method for creating the male-sterile rice line is as follows: Using conventional genetic engineering methods, the nucleotide sequence shown in SEQ ID No. 1 of a conventional rice variety is mutated to SEQ ID No. 3 to obtain a male-sterile rice line. pmp1 Mutant.

[0010] This invention constructs a rice male sterility gene. PMP1 Knockout or mutant vectors were transferred into wild-type rice to obtain male-sterile rice lines.

[0011] Preferably, the rice variety is Zhongxian 3037.

[0012] Fourthly, the present invention provides the aforementioned rice male sterility. PMP1 Application of gene mutants in the breeding of male-sterile rice lines.

[0013] Preferably, the application is a rice male sterility gene. PMP1 The mutant was transferred into wild-type rice to obtain male-sterile rice lines.

[0014] Fifthly, the present invention provides the use of the rice male-sterile line obtained by the aforementioned method in rice seed production, wherein the use is to use the rice male-sterile line as the female parent for hybridization breeding.

[0015] The beneficial effects of this invention are as follows: This invention controls the male sterility gene in rice. PMP1 By obtaining variants of rice male reproductive development and their encoded proteins, the reproductive process of rice can be controlled.

[0016] This invention is being carried out 60 A male-sterile mutation was screened from the wild-type Indica rice 3037 induced by Co~γ radiation. The gene controlling this male-sterile trait was obtained using map-based cloning. PMP1 ( Prolong Meiotic Prophase 1 Using the CRISPR-Cas9 point-to-point editing method, two more were prepared. PMP1 Two mutants of the gene. Using a combination of genetic and cell biological methods, they were discovered... PMP1 Gene mutations will severely delay the prophase I process of meiosis, affecting pollen development and leading to male infertility. PMP1 Gene mutations have created new male-sterile lines in rice, which have great potential in rice hybridization breeding. Attached Figure Description

[0017] Figure 1 For the present invention pmp1 Phenotypic analysis diagram of mutants.

[0018] Figure 2 For the present invention PMP1 Map-based cloning of genes and analysis of gene mutation sites.

[0019] Figure 3 For the present invention pmp1 A diagram illustrating the relationship between meiosis process and pollen development in mutant strains.

[0020] Figure 4 For the present invention PMP1 The results of gene expression analysis are shown in the figure.

[0021] Figure 5 For the present invention pmp1-1 and pmp1-2 Phenotypic analysis diagram of mutants. Detailed Implementation

[0022] The technical solution of the present invention will be further described in detail below with reference to the embodiments: This embodiment is implemented under the premise of the technical solution of the present invention, and provides detailed implementation methods and specific operation processes, but the protection scope of the present invention is not limited to the following embodiments.

[0023] The sources of the reagents and materials involved in the examples are as follows:

[0024] The wild-type rice used in this embodiment of the invention is the cultivated variety Zhongxian 3037, which was preserved in our laboratory. The wild-type rice mentioned in this embodiment of the invention... pmp1 The mutant is Zhongxian 3037 after... 60 Induced by Co~γ radiation pmp1-1 and pmp1-2This mutation was obtained through gene editing in the cultivated variety of Chinese indica 3037. The above mutation can be achieved through gene editing.

[0025] Apart from the biological materials and reagents specifically mentioned above, the other materials and reagents mentioned in this invention are available to the public from commercial or free channels both domestically and internationally, and will not be described in detail here.

[0026] This invention is achieved through 60 Co-γ radiation induced the growth of Indica 3037 seeds, and genetically stable male-sterile mutants were obtained through screening. pmp1 . pmp1 The mutant's vegetative growth was not significantly different from that of the wild type. During the reproductive growth stage, no pollen was produced at all, but the pistil could be pollinated normally and produce fruit. pmp1 In the mutant, the prophase I stage of meiosis in male gametes is severely delayed, leading to abnormal pollen formation and degradation, ultimately causing male sterility. This can be addressed by genetically engineering the removal of [the mutant's morphology]. PMP1 This also leads to a male infertility phenotype. This indicates... PMP1 In the future, it can be used as a male sterility gene in the creation of heterosis in rice, and has great development value and application prospects.

[0027] Example 1 Male sterility mutant pmp1 Acquisition and genetic analysis

[0028] (1) Through 60 Co-γ radiation mutagenesis was performed on the cultivated variety of Chinese indica 3037, using 300 Gy radiation for 15 days to screen for genetically stable male-sterile mutants. pmp1 Mutant. pmp1 The mutant exhibited normal vegetative growth and showed no significant differences in several agronomic traits compared to the wild type, but failed to produce seeds during the reproductive growth stage. Further research revealed that the pistils could be pollinated normally, but no pollen was produced at all.

[0029] (2) pmp1 The mutant was used as the female parent, and the japonica rice variety Wuyunjing 8 was used as the male parent to produce the F1 generation. The F1 generation showed normal vegetative and reproductive growth. Self-pollination of the F1 generation produced the F2 generation, and it was found that the F2 population exhibited segregation of normal and sterile phenotypes, with the ratio of fertile to sterile plants conforming to Mendelian segregation ratio of 3:1 (c 2 =0.1935, P >0.05) indicates pmp1 The male sterility trait in the mutant is controlled by a pair of recessive nuclear genes. Self-fertilization of the F2 generation produces the F3 generation.

[0030] Example 2 PMP1 Map-based cloning of genes

[0031] In the F2 and F3 generations, sterile plants were selected for genetic linkage analysis. Using STS molecular markers, the target gene was located on chromosome 3. Further fine mapping pinpointed the target gene to a physical region of approximately 198 kb. Gene prediction using the RiceGAAS (Rice Genome Automated Anotation System) revealed a protein encoding a PHD (Plant Homeodomain) zinc finger domain within this region, containing 695 amino acids. PCR amplification and sequencing analysis revealed that the sterile mutant... LOC_Os03g50780 A single-base substitution (GA) occurred in the third exon of the gene, causing tryptophan to become a stop codon, resulting in premature termination of amino acid translation. This mutant was named... pmp1 The primers for fine map-based cloning are shown in Table 1.

[0032] Table 1 PMP1 Fine-targeting molecular markers

[0033]

[0034] Example 3 PMP1 Gene functional analysis

[0035] (1) pmp1 Analysis of the sterility phenotype of mutants

[0036] a. In order to clarify pmp1 The cause of male infertility in mutants was determined by DAPI staining in wild-type and... pmp1 The meiotic process of pollen mother cells in the mutant was observed. In wild-type florets (5.8-6.3 mm), some meiotic cells had already entered the second meiotic division, while... pmp1 In mutant florets of 5.8–6.3 mm, meiotic cells remained in pachytene stage. In wild-type florets of 6.4–6.8 mm, only 7.3% of meiotic cells remained in pachytene to late stage I, while in florets of the same length… pmp1 In the florets, all observed meiotic cells were in the coarse to diagenetic stage. When the florets reached 7.2 mm in length, the pollen mother cells in the wild type had already completed meiosis to form microspores, while pmp1 In the mutant, pollen mother cells were still undergoing meiosis. These results indicate that... pmp1 In the mutant, the prophase I of meiosis in pollen mother cells is severely delayed.

[0037] b. To further investigate pmp1 Abnormalities in pollen development in mutants were observed, through semi-thin sections, in comparison with wild-type and... pmp1Pollen development in the mutants was observed. In wild-type and... pmp1 In the mutant 5.8 mm florets, there was no significant difference in the formation of the four somatic cell layers in the anthers, and the pollen mother cells could normally enter prophase I of meiosis. In the wild-type 7.2 mm florets, the pollen mother cells completed meiosis to form microspores, at which point... pmp1 The mutant pollen mother cells were still in prophase I of meiosis. Mature pollen grains could be seen in the wild-type 8.5 mm florets, while... pmp1 In the mutant 8.5 mm florets, the pollen mother cells were completely degraded, and no pollen was produced.

[0038] (2) pmp1 Expression analysis of mutants

[0039] a. To investigate PMP1 The gene expression pattern was analyzed by quantitative fluorescence analysis in different tissues (roots, stems, leaves, and spikes) of the wild type. The results showed that... PMP1 The gene is expressed in the roots, stems, leaves, and panicles of rice. Compared to other parts, PMP1 The gene is expressed at a higher level in the spikelet, and the expression level is highest in spikelets of 1-3 cm.

[0040] b. To investigate more accurately PMP1 The spatiotemporal expression patterns of genes were determined by in situ mRNA hybridization on cross sections of wild-type anthers. The results showed that... PMP1 The mRNA signaling of this substance first appears in the primary sporogenous cells and primary wall cells during the two-layer somatic cell stage, and is further enhanced in the inner-layered hierarchical wall cells and sporogenous cells during the three-layer somatic cell stage. After the formation of the four-layer somatic cell stage, PMP1 High expression levels were observed in newly formed tapetum and pollen mother cells, but these levels decreased sharply during subsequent meiosis. Preparation PMP1 The probe of justice could not detect any signal at any stage of the anther process. Therefore, PMP1 The gene is specifically expressed primarily in the inner somatic cells of the anther and in the microspore mother cells.

[0041] Figure 1 A is wild type and pmp1 The plant morphology of the mutant, B being the wild type and pmp1 Anther morphology analysis of the mutant, C represents wild type and pmp1 Anther I2-KI staining analysis of mutants, D represents wild type and pmp1 Mature embryo sac structure in mutants, E represents wild type and pmp1 The fruit set of the mutant after saturated pollination.

[0042] Figure 2 In the image, A represents the result of map-based cloning, and B represents... PMP1 Gene structure diagram and mutation sites.

[0043] Figure 3 A is wild type and pmp1 Observation of chromosome behavior during meiosis in mutant florets with diameters of 5.8-6.3 mm; B represents wild-type and... pmp1 Analysis of meiotic progression in florets of different lengths in mutants, C represents wild type and... pmp1 Analysis of semi-thin sections of florets of different lengths from mutants.

[0044] Figure 4 A in the middle is PMP1 The results of gene expression in wild-type roots, stems, leaves, and spikelets of different lengths are shown in Figure B, which represents the results of mRNA in situ hybridization experiments performed on cross sections of wild-type anthers.

[0045] Example 4 PMP1 Site-directed mutation of genes

[0046] (1) PMP1 Obtaining and validating CRISPR-Cas9 site-directed mutants

[0047] To further confirm PMP1 Gene mutations are a cause of male infertility. PMP1 The gene was subjected to CRISPR-Cas9 site-directed mutagenesis, and the phenotype of the site-directed mutant plants was further observed to see if it was consistent with the gene. pmp1 The mutants have the same phenotype.

[0048] During the experiment, the pCAMBIA1300-cas9 binary vector was used as the transformation vector. Separately, [the following were selected]. PMP1 The target sites are the specific sequences of exon 1 ("TGCGATTACTGCCGCTGGGC") and exon 3 ("TCCTGTGAAGACATGCACAC"). The intermediate vector SK-gRNA is digested with AarI (Ferment), and the target sequence, annealed to form a double strand, is then inserted. Then... Kpn I and Bam The intermediate vector containing the target sequence and the pCAMBIA1300-cas9 binary vector were double-digested with HI, and the DNA fragment excised from the intermediate vector was inserted into pCAMBIA1300-cas9. Both expression vectors were then transformed into Agrobacterium EHA105 cells using electroporation, followed by transformation into mature embryo callus of wild-type Indica 3037. Transgenic lines were identified using PMP-CAS91-F / R and PMP-CAS92-F / R primers, respectively. Primer sequences are as follows:

[0049] Cas9-pmp1-1-F: GGCATGCGATTACTGCCGCTGGGC

[0050] Cas9-pmp1-1-R: AAACGCCCAGCGGCAGTAATCGCA

[0051] Cas9-pmp1-2-F: GGCATCCTGTGAAGACATGCACAC

[0052] Cas9-pmp1-2-R: AAACGTGTGCATGTCTTCACAGGA

[0053] PMP-CAS91-F:GCAAAATTACGGAAACGC

[0054] PMP-CAS91-R: TCAATGCCCAAACTACCAA

[0055] PMP-CAS92-F: ATGATAAGCACGCAAAGG

[0056] PMP-CAS92-R: ACACTGGAGCAGGTCAAT

[0057] Identification results of the T0 and T1 generation transgenic lines showed that the two vectors caused... PMP1 Insertion of 1 bp into both exon 1 and exon 3 resulted in changes in the reading frame and premature termination of translation. These two mutants were named... pmp1-1 and pmp1-2 .

[0058] (2) Phenotypic analysis of CRISPR-Cas9 site-directed mutants

[0059] CRISPR-Cas9 site-directed knockout pure and mutant strains were tested separately. pmp1-1 and pmp1-2 Further phenotypic analysis was performed. The results showed that both mutants were infertile and lacked pollen. These results indicate that... PMP1 The mutation is the cause of the male sterility phenotype in mutants.

[0060] Figure 5 A is wild type. pmp1-1 mutants and pmp1-2 Peripheral analysis of the mutants showed that B was wild-type. pmp1-1 mutants and pmp1-2 Anther morphology analysis of the mutant, C represents wild type, pmp1-1 mutants and pmp1-2 I2-KI staining analysis of the anthers of mutants.

[0061] In summary, the present invention controls PMP1 Genes and their encoded proteins were used to obtain mutant rice plants with abnormal male reproductive development, thereby controlling the male reproductive development and fertility of rice. The rice mutants obtained by this invention showed no significant difference from the source parents during the vegetative growth stage, but after entering the reproductive growth stage, the microspore meiosis process was abnormal, no pollen was produced, and the plant was eventually sterile. This invention has very important application value in agricultural production.

[0062] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any transformations or substitutions that can be conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. The application of knocking out or altering the PMP1 gene in rice varieties in the breeding of male-sterile rice lines, characterized in that... The application involves using conventional genetic engineering methods to delete or mutate the amino acid sequence encoded by the PMP1 gene, thereby reducing or eliminating the activity of the polypeptide corresponding to the amino acid sequence, and obtaining a male-sterile rice line. The nucleotide sequence of the PMP1 gene is shown in SEQ ID No. 1, and the amino acid sequence encoded by the PMP1 gene is shown in SEQ ID No.

2.

2. A method for creating a male-sterile rice line, characterized in that, Includes the following steps: A conventional rice variety was selected, treated, and bred to obtain the rice male-sterile line. The treatment involved using conventional genetic engineering methods to knock out or alter the coding sequence shown in SEQ ID No. 1, causing the amino acid sequence shown in SEQ ID No. 2 to be deleted or mutated, thereby reducing or eliminating the activity of the polypeptide corresponding to the amino acid sequence, and obtaining the rice male-sterile line.

3. The method according to claim 2, characterized in that, The specific method for creating the rice male-sterile line is as follows: using conventional genetic engineering methods, the nucleotide sequence shown in SEQ ID No. 1 in a conventional rice variety is mutated to SEQ ID No. 3, thereby cultivating a rice male-sterile line.

4. The method according to claim 3, characterized in that, The rice variety in question is Zhongxian 3037.

5. The use of the male-sterile rice line obtained by the method according to claim 2 in rice seed production, characterized in that, The intended use is to conduct hybridization breeding using the male-sterile rice line described in claim 2 as the female parent.

Citation Information

Patent Citations

  • Application of male sterility gene OsLAP5 and method for recovering rice male sterility

    CN104313034A

  • Application of male sterility gene OsDPW2 and rice sterility recovery method

    CN106011167A