Application of efcab2 gene in constructing animal model of hydrocephalus and method of constructing the model

By knocking out the zebrafish efcab2 gene using CRISPR/Cas9 technology and constructing a hydrocephalus model, the unclear pathogenic mechanism of the efcab2 gene was resolved, providing tools for in-depth research and drug development, and promoting the exploration of treatment strategies for hydrocephalus.

CN119709879BActive Publication Date: 2025-09-26TIANJIN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411948953.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-27
Publication Date
2025-09-26
Estimated Expiration
2044-12-27

AI Technical Summary

Technical Problem

In the existing technology, the function of the efcab2 gene in the pathogenesis of hydrocephalus has not been fully clarified, and there is a lack of effective animal models for studying its pathogenic mechanism and potential therapeutic targets.

Method used

The CRISPR/Cas9 gene knockout technology was used to knock out the efcab2 gene in zebrafish to construct an animal model of hydrocephalus. Synthetic gRNA and Cas9 mRNA were co-injected into zebrafish embryos to observe the characteristics of hydrocephalus caused by efcab2 gene deficiency.

Benefits of technology

An efficient animal model of hydrocephalus was established, which enabled in-depth research into the pathogenesis of hydrocephalus caused by EFCAB2 gene defects, provided a potential drug development platform for therapeutic targets, and promoted the progress of hydrocephalus disease research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119709879B_ABST
    Figure CN119709879B_ABST
Patent Text Reader

Abstract

The present invention discloses the use of the efcab2 gene in constructing an animal model of hydrocephalus and a method for constructing the model. This invention belongs to the technical field of animal model preparation in biological and basic medical research. The invention provides the use of the efcab2 gene in constructing an animal model of hydrocephalus, and the nucleotide sequence of the efcab2 gene is shown as SEQ ID NO. 1. A method for constructing a zebrafish animal model of hydrocephalus is also provided, comprising: synthesizing guide RNA (gRNA) and Cas9 mRNA based on the efcab2 gene, and mixing them to obtain a mixture; co-injecting the mixture with phenol red reagent into zebrafish embryos at the I-cell stage, culturing them until the third day after fertilization to obtain zebrafish embryos; measuring the expression level of the efcab2 gene mRNA, and observing the fourth ventricle, spine, and pericardium. Using CRISPR gene knockout technology, an animal model of hydrocephalus caused by efcab2 gene deficiency is established to elucidate the pathogenesis and potential therapeutic targets of efcab2 gene-deficient hydrocephalus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of animal model preparation in biology and basic medical research, and in particular relates to the application of the efcab2 gene in constructing a hydrocephalus animal model and a method for constructing the model. Background Art

[0002] Hydrocephalus is a neurological disorder characterized by excessive accumulation of cerebrospinal fluid (CSF) in the brain, leading to abnormal enlargement of the ventricles, increased intracranial pressure, and brain damage. The prevalence of hydrocephalus is extremely high, with recent increases in children (≤18 years), adults (19-64 years), and the elderly (≥65 years). Children and the elderly are most commonly affected. Hydrocephalus in adults, often secondary to various brain disorders, has a lower overall incidence than in children. Congenital hydrocephalus (CH), also known as infantile hydrocephalus, has an incidence of over 0.2 in 1,000 children. Fetal intracranial hemorrhage, infection, congenital malformations, and genetic factors can all contribute to CH. Global epidemiological studies indicate that up to 40% of CH cases are caused by genetic factors, and the majority of cases are sporadic, with variable phenotypes, making it difficult to identify the causative gene. Identified gene mutations account for less than 5% of CH cases, and more gene targets and the pathogenic mechanisms by which gene mutations cause hydrocephalus need to be studied.

[0003] Previous research has revealed that the efcab2 gene encodes a protein with a calcium-binding domain. Studies have shown that it is expressed in the motility complex of ciliary microtubules and has calcium-binding activity. Motile cilia play a vital role in cerebrospinal fluid circulation. Based on these two observations, efcab2 is hypothesized to be a causative gene for hydrocephalus. However, its function and the underlying mechanisms in the development of hydrocephalus remain to be determined. Gene-edited animals are an important tool for studying molecular and pathogenic mechanisms in biomedical research.

[0004] Zebrafish share a high degree of genetic homology with humans, with their genome sharing over 87% similarity, making them an ideal model for studying human neurological diseases. The transparency of their embryos facilitates intuitive observation of nervous system development and pathological processes, facilitating large-scale genetic and phenotypic studies. Furthermore, zebrafish exhibit a rich array of behavioral patterns, including spatial memory, associative memory, and anxiety, which provide effective tools for assessing various aspects of neurological diseases and facilitate the study of disease pathogenesis. Their optical transparency allows for real-time neuroimaging, facilitating the non-invasive assessment of cellular activity and status in vivo, providing a powerful imaging tool for drug screening and contributing to a deeper understanding of brain structure and function. Summary of the Invention

[0005] To address the above technical problems, the present invention proposes the application of the efcab2 gene in constructing an animal model of hydrocephalus and a method for constructing the model. CRISPR gene knockout technology is used to establish an animal model of hydrocephalus caused by the efcab2 gene, in order to elucidate the pathogenesis and potential therapeutic targets of hydrocephalus caused by the efcab2 gene deficiency, and to develop therapeutic drugs for patients with hydrocephalus caused by the efcab2 gene deficiency.

[0006] To achieve the above object, the present invention provides the use of the efcab2 gene in constructing an animal model of hydrocephalus. The nucleotide sequence of the efcab2 gene is shown in SEQ ID NO.1.

[0007] Preferably, the hydrocephalus animal model is a hydrocephalus zebrafish animal model.

[0008] Preferably, a zebrafish animal model of hydrocephalus is constructed by knocking out the efcab2 gene.

[0009] The present invention also provides use of a preparation for regulating the expression of the efcab2 gene in preparing a drug for treating hydrocephalus.

[0010] The present invention also provides a method for constructing a zebrafish hydrocephalus animal model, comprising the following steps:

[0011] (1) synthesizing gRNA based on the efcab2 gene;

[0012] (2) In vitro synthesis of Cas9 mRNA;

[0013] (3) mixing the gRNA obtained in step (1) and the Cas9 mRNA obtained in step (2) to obtain a mixed solution;

[0014] (4) injecting the mixture obtained in step (3) and phenol red reagent into the zebrafish embryo at the I-cell stage, culturing at 27.5-28.5° C. until the third day after fertilization, to obtain zebrafish embryos;

[0015] (5) Determine the mRNA expression level of the efcab2 gene in the zebrafish embryo obtained in step (4), and observe the fourth ventricle, spine, and pericardium of the zebrafish embryo obtained in step (4).

[0016] Preferably, the nucleotide sequence of the gRNA in step (1) is shown as one or more of SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.

[0017] Preferably, the nucleotide sequence of the Cas9 mRNA in step (2) is as shown in SEQ ID NO.6.

[0018] Preferably, the content of gRNA in the mixed solution in step (3) is 25 ng, and the final concentration of Cas9 mRNA in the mixed solution is 300 ng / μL.

[0019] Preferably, the zebrafish embryos in step (5) have lower efcab2 gene mRNA expression, an enlarged fourth ventricle area, scoliosis, and pericardial edema compared to wild zebrafish embryos.

[0020] The present invention also provides application of the method for constructing a hydrocephalus zebrafish animal model in preparing a hydrocephalus animal model.

[0021] Compared with the prior art, the present invention has the following advantages and technical effects:

[0022] The present invention utilizes the CRISPR / Cas9 system to knock out the efcab2 gene and obtain a corresponding targeted gene-edited zebrafish-specific hydrocephalus model. This not only deepens our understanding of gene regulation in the pathogenesis of hydrocephalus caused by efcab2 gene deficiency, but also suggests that efcab2 can be used as a therapeutic target for hydrocephalus, providing a high-level animal model for translational medicine and new drug development.

[0023] This study has significant value in many aspects. On the one hand, it can deeply explore the pathogenesis of hydrocephalus, systematically revealing the pathogenesis and development of the disease from cellular microstructure to molecular signaling networks, and accurately explore potential therapeutic targets, providing a key entry point for subsequent intervention strategies. On the other hand, it can serve as an ideal animal model for patients with efcab2 gene-deficient hydrocephalus, establishing an efficient animal model platform for drug screening and development for this condition. Its application will help comprehensively promote substantial progress in the field of hydrocephalus research in key areas such as pathogenesis elucidation, drug development innovation, and treatment strategy exploration, thereby laying a solid tool foundation and providing strong theoretical support for the ultimate conquest of hydrocephalus. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0025] Figure 1 The Sanger sequencing and amino acid sequence of the sample tested in Example 1;

[0026] Figure 2qPCR amplification statistics of the samples tested in Example 1, * represents p < 0.1 compared with the control group;

[0027] Figure 3 The fourth ventricle imaging and area statistics of the samples tested in Example 1, wherein A is the fourth ventricle imaging, the scale is 200 μm, and B is the imaging area statistics. * indicates p < 0.1 compared with the control group;

[0028] Figure 4 These are diagrams showing scoliosis and pericardial edema phenomena exhibited by the samples tested in Example 1, wherein A is a diagram of the control group sample, B is an enlarged diagram of the control group sample, C is a diagram of the mutant group sample, and D is an enlarged diagram of the mutant group sample. DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0034] Example 1

[0035] 1. gRNA synthesis in vitro

[0036] (1) Determination of CRISPR target sites

[0037] Based on the zebrafish efcab2 gene (SEQ ID NO. 1), gRNA target design was performed using the Benchling (https: / / www.benchling.com / crispr) cloud-based CRISPR design software, as shown in Table 1.

[0038] Table 1 gRNA targets

[0039] Site Sequence (5'-3') PAM exon1 ttcatggtcaaatacatcaa(SEQ ID NO.16) agg exon2 acagccaagtgaacgaatga(SEQ ID NO.17) tgg exon3 tcatgcaattcagcttctga(SEQ ID NO.18) agg exon4 tcatagcgcacaaatccagt(SEQ ID NO.19) ggg

[0040]

[0041] (2) Design primers for in vitro synthesis of gRNA, as shown in Table 2 below.

[0042] Table 2 Primers for gRNA synthesis

[0043]

[0044]

[0045] (3) Synthesize gRNA template in vitro. The reaction system is shown in Table 3 below, and the reaction procedure is shown in Table 4 below.

[0046] Table 3 Reaction system

[0047] Total reaction volume 50 μL 5X Phusion Reaction Mixbuffer 10 μL 10mM dNTP (2.5mM each) 1 μL top-strandoligo (10 μM) 1 μL Bottom 80bp Ultramar (10μM) 1 μL Phusion DNA polymerase 1 μL <![CDATA[ddH2O]]> 36μL

[0048] Table 4 Reaction procedure

[0049] step Temperature (℃) Time (min) 1 98 2 2 50 10 3 72 10 4 Keep

[0050] The ultrathin DNA product purification kit DP203 (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) was used for purification to obtain four products with a sequence size of 119 bp.

[0051] The nucleotide sequence of gRNA1 is SEQ ID NO. 2: TAATACGACTCACTATAGGTTCATGGTCAAATA CATCAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT.

[0052] The nucleotide sequence of gRNA2 is SEQ ID NO.3: TAATACGACTCACTATAGGACAGCCAAGTGAA CGAATGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT.

[0053] The nucleotide sequence of gRNA3 is SEQ ID NO.4: TAATACGACTCACTATAGGTCATGCAATTCAGC TTCTGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT.

[0054] The nucleotide sequence of gRNA4 is SEQ ID NO.5: TAATACGACTCACTATAGGTCATAGCGCACAAA TCCAGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT.

[0055] (4) In vitro transcription of gRNA, the reaction system is shown in Table 5.

[0056] Table 5 Reaction system

[0057] Total reaction volume 20 μL 10X Reaction Buffer 1.5 μL ATP (100 mM) 1.5 μL UTP (100mM) 1.5 μL CTP (100 mM) 1.5 μL GTP (100 mM) 1.5 μL Template DNA 300 ng (~8 μL) T7RNAPolymeraseMix 1.5 μL <![CDATA[RNAase-freeH2O]]> 3μL

[0058] Reaction procedure (metal bath): After mixing, incubate at 37°C overnight; then add 1 μL of 2U / μL DNase I (RNAase-free) and incubate at 37°C for 20 minutes.

[0059] Purify RNA (LiCl method): Add 30 μL of RNase-free HO and 30 μL of 7.5 M LiCl precipitation solution. Incubate at -20°C for at least 2 hours. Centrifuge at 14,000 rpm at 4°C for 30 minutes. Remove the supernatant and add 500 μL of 75% ethanol (diluted with RNase-free HO) to wash the precipitate. Centrifuge again under the same conditions for 15 minutes. Aspirate the supernatant, wait for complete ethanol evaporation, and dissolve in 10-20 μL of RNase-free HO for concentration determination.

[0060] 2. In vitro synthesis of Cas9 mRNA

[0061] (1) Plasmid construction and amplification.

[0062] The nucleotide sequence of the plasmid is shown in SEQ ID NO.20.

[0063]

[0064] (2) Plasmid linearization, the reaction system is shown in Table 6 below.

[0065] Table 6 Reaction system

[0066] Total reaction volume 100 μL 10X CutSmart Buffer 10 μL XbaI (20000U / mL) 20 units (~1.5 μL) pT3TS-nCas9n (~300 ng / μL) 5.5 μg (~18.5 μL) <![CDATA[ddH2O]]> 70μL

[0067] Reaction procedure: Incubate at 37°C overnight.

[0068] The DNA was purified using the ultrathin DNA product purification kit DP203 (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0069] (3) In vitro transcription of Cas9 mRNA using mMESSAGE T3 Kit (purchased from ThermoFisher Scientific), the reaction system is shown in Table 7 below.

[0070] Table 7 Reaction system

[0071] Total reaction volume 20 μL 10X Reaction Buffer 2μL 2XNTP / CAP 10 μL lineartemplateDNA 0.1~1μg(<6μL) EnzymeMix 2μL

[0072] Reaction procedure: Gently mix, centrifuge, and incubate at 37°C for 3 hours. Add 1 μL of TURBO DNase I, gently mix, centrifuge, and incubate at 37°C for 15 minutes to remove DNA.

[0073] RNA purification (LiCl method): Add 30 μL of RNase-free HO and 30 μL of 7.5 M LiCl precipitation solution. Incubate at -20°C for at least 2 hours. Centrifuge at 14,000 rpm at 4°C for 30 minutes. Remove the supernatant and add 500 μL of 75% ethanol (diluted with RNase-free HO) to wash the precipitate. Centrifuge again under the same conditions for 15 minutes. Aspirate the supernatant, wait for complete ethanol evaporation, and then dissolve in 70 μL of RNase-free HO and measure the concentration.

[0074]

[0075] 3. Microinjection

[0076] A mixture of four gRNAs (25 ng) and Cas9 mRNA (final concentration 300 ng / μL) was co-injected with phenol red reagent (0.5 uL) into zebrafish embryos at the I-cell stage and cultured in E3 culture medium (prepared with 5 mM NaCl, 0.17 mM KCl, 0.4 mM CaCl2, 0.33 mM MgSO4 and pure water) at a constant temperature (28°C) and a photoperiod (light / dark cycle) of 14 h:10 h in an incubator.

[0077] 4. Sanger sequencing

[0078] (1) Genome lysis

[0079] Place a zebrafish embryo in an EP tube and remove the E3 medium. Add 20 μL of lysis buffer (Tris-HCl 10 mM, KCl 50 mM, Tween-20 0.3%, NP-40 0.3%). Incubate at 98°C for 10 minutes. Cool to 55°C and add 1 μL of Proteinase K. Incubate overnight at 98°C for 10 minutes. The reaction solution can be used directly as a PCR template or stored at 4°C.

[0080] (2) Design amplification primers as shown in Table 8 below.

[0081] Table 8 Amplification primers

[0082]

[0083] (3) PCR amplification obtained a product sequence of about 1.4 kb in size, which was a partial sequence of the efcab2 gene (SEQ ID NO. 1).

[0084] (4) Perform Sanger sequencing.

[0085] (5) Sequencing results

[0086] The comparison results are as follows Figure 1 As shown, the gene sequences of all mutants were changed, and the amino acid arrangement obtained by translation of the target sequence was also changed, indicating that the mutation type of the mutant was a missense mutation.

[0087] 5. qPCR amplification

[0088] (1) Total RNA extraction from zebrafish embryos

[0089] a. Add 200 μL Trizol (RNAFREE EP tube) to at least 30 zebrafish embryos. Crush them with an electric grinder and rinse the grinder with the remaining 800 μL.

[0090] b. Leave at room temperature for 5 minutes until the liquid is completely transparent.

[0091] c. Add 200 μL of chloroform, shake vigorously for 15 seconds to break the genomic DNA, and let it stand at room temperature for 3 minutes.

[0092] d. Centrifuge at 4°C, 13,000 rpm, for 15 min.

[0093] e. Transfer the upper aqueous phase to another EP tube, add an equal volume of isopropanol and mix (about 500 μL), and let it stand at room temperature for 10 minutes.

[0094] f. Centrifuge at 4°C, 13,000 rpm, for 10 min. Carefully aspirate the liquid with a pipette tip and allow the RNA to settle to the bottom of the tube.

[0095] g. Wash the RNA pellet with 1 mL of 75% ethanol and gently shake the centrifuge tube to resuspend the pellet.

[0096] h. Centrifuge at 13,000 rpm for 5 minutes at 4°C. Discard the ethanol and dry the RNA pellet at room temperature for 5-10 minutes.

[0097] i. Dissolve the RNA sample in 50 μL H2O (adjust according to the amount of RNA) at 60°C for 10 min and store at -80°C.

[0098] (2) Reverse transcription into cDNA.

[0099] To remove residual genomic DNA, prepare the reaction mixture in an RNase-free centrifuge tube as shown in Table 9.

[0100] Table 9 Components and usage of reaction solution

[0101] Reaction solution components Usage 5×gDNAdigesterMix 6μL Total RNA 2μg (volume calculated based on RNA sample concentration) <![CDATA[RNasefreeddH2O]]> Add to a total volume of 30 μL

[0102] After the preparation, gently pipette and mix with an RNase-free pipette tip, and incubate at 42°C for 2 minutes.

[0103] The reverse transcription system was prepared as shown in Table 10.

[0104] Table 10 Reverse transcription reaction system preparation

[0105] Reaction solution components Usage Step 1 reaction solution 30μL 4×HifairⅢSuperMixplus 5μL

[0106] The reverse transcription reaction program settings are shown in Table 11.

[0107] Table 11 Reverse transcription program settings

[0108] Reaction temperature (℃) Duration (min) 25 5 55 15 85 5

[0109] (3) Design qPCR amplification primers.

[0110] Table 12 qPCR amplification primers

[0111]

[0112]

[0113] The cDNA synthesized in step (2) was used as template DNA and diluted 5-10 times (so that the Ct value after amplification was between 20 and 30). The total reaction system was 20 μL (prepared on ice), and the reaction system was shown in Table 13 below.

[0114] Table 13 qPCR reaction system

[0115] Reaction solution components Usage amount (μL) HieffqPCRSYBRGreenMasterMix 10 Upstream primer (10 μM) 0.4 Downstream primer (10 μM) 0.4 Template DNA 2 <![CDATA[ddH2O]]> 7.2

[0116] After the preparation is completed, mix the reaction solution.

[0117] (4) Perform qPCR amplification.

[0118] A three-step amplification program was used, with pre-denaturation at 95°C for 5 min, deformation at 95°C for 10 s, annealing at 50-60°C for 20 s, and extension at 72°C for 20 s, for 40 cycles.

[0119] (5) Amplification results

[0120] Amplification results such as Figure 2 As shown, compared with the control group (Control), the mRNA expression level of efcab2 gene in the mutant group (KO) was significantly reduced.

[0121] 6. Observe whether the fourth ventricle is enlarged

[0122] (1) Intraventricular dye injection

[0123] When zebrafish developed to the 3rd day after fertilization, they were fixed with 0.4% agarose and injected with FITC-dextran fluorescent dye into the cerebral ventricle.

[0124] (2) Fluorescence microscopy imaging.

[0125] (3) Count the fluorescent area of ​​the ventricles.

[0126] The results of fluorescence imaging and area statistics of the fourth ventricle are as follows Figure 3 China A and Figure 3 As shown in middle B, the fourth ventricle area of ​​zebrafish in the mutant group (KO) was significantly enlarged compared with the control group (Control).

[0127] 7. Observe whether scoliosis and pericardial edema occur

[0128] (1) Microscope imaging.

[0129] (2) Observe scoliosis and pericardial edema.

[0130] like Figure 4 Middle A, Figure 4 Middle B, Figure 4 Middle C and Figure 4 As shown in middle D, compared with the control group (Control), the mutant group (KO) zebrafish showed scoliosis and pericardial edema.

[0131] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. The application of efcab2 gene in constructing an animal model of hydrocephalus is characterized by: The nucleotide sequence of the efcab2 gene is shown in SEQ ID NO.1; The hydrocephalus animal model is a hydrocephalus zebrafish animal model; A zebrafish animal model of hydrocephalus was constructed by knocking out the efcab2 gene; The method for constructing the hydrocephalus zebrafish animal model comprises the following steps: (1) synthesizing gRNA based on the efcab2 gene; (2) Synthesis of Cas9 mRNA in vitro; (3) mixing the gRNA obtained in step (1) and the Cas9 mRNA obtained in step (2) to obtain a mixed solution; (4) The mixture obtained in step (3) and the phenol red reagent were co-injected into the zebrafish embryo at the I-cell stage, and cultured at 27.5-28.5°C until the third day after fertilization to obtain zebrafish embryos; (5) measuring the mRNA expression level of the efcab2 gene in the zebrafish embryos obtained in step (4), and observing the fourth ventricle, spine, and pericardium of the zebrafish embryos obtained in step (4); The nucleotide sequences of the gRNA in step (1) are shown as SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.

5.

2. The use of the efcab2 gene according to claim 1 in constructing an animal model of hydrocephalus, characterized in that: The nucleotide sequence of the Cas9 mRNA in step (2) is shown in SEQ ID NO.

6.

3. A method for constructing a zebrafish hydrocephalus animal model, characterized in that: The following steps are involved: (1) synthesizing gRNA based on the efcab2 gene described in claim 1; (2) Synthesis of Cas9 mRNA in vitro; (3) mixing the gRNA obtained in step (1) and the Cas9 mRNA obtained in step (2) to obtain a mixed solution; (4) The mixture obtained in step (3) and the phenol red reagent were co-injected into the zebrafish embryo at the I-cell stage, and cultured at 27.5-28.5°C until the third day after fertilization to obtain zebrafish embryos; (5) measuring the mRNA expression level of the efcab2 gene in the zebrafish embryos obtained in step (4), and observing the fourth ventricle, spine, and pericardium of the zebrafish embryos obtained in step (4); The nucleotide sequences of the gRNA in step (1) are shown as SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.

5.

4. The method for constructing a zebrafish hydrocephalus animal model according to claim 3, characterized in that: The nucleotide sequence of the Cas9 mRNA in step (2) is shown in SEQ ID NO.

6.

5. The method for constructing a zebrafish hydrocephalus animal model according to claim 3, characterized in that: The content of gRNA in the mixed solution in step (3) is 25 ng, and the final concentration of Cas9 mRNA in the mixed solution is 300 ng / μL.

6. The method for constructing a zebrafish hydrocephalus animal model according to claim 3, characterized in that: Compared with wild zebrafish embryos, the zebrafish embryos described in step (5) have lower efcab2 gene mRNA expression, an enlarged fourth ventricle area, scoliosis, and pericardial edema.

7. Use of the method for constructing a zebrafish hydrocephalus animal model according to any one of claims 3 to 6 in preparing a zebrafish hydrocephalus animal model.

Citation Information

Patent Citations

  • Gene panel kit of Immotile cilia syndrome and application of gene panel kit

    CN110438220A

  • Assessment method of hydrocephalus animal experiment model

    CN117503408A