Method for simultaneously detecting multiple protein biomarkers based on rolling circle amplification

Abstract

The invention belongs to the technical field of biological detection, and particularly relates to a detection method for simultaneous imaging or quantification of multiple protein biomarkers on a cell or tissue sample based on rolling circle amplification. On the basis of a rolling circle amplification technology, n fluorescent probes and 2n-1 circular DNA template rolling circle amplification products with different fluorescent hybridization pathways are hybridized, and qualitative and / or quantitative detection of 2n-1 protein biomarkers is realized through multi-channel fluorescence imaging; the method has the advantages that 2n-1 protein biomarkers can be detected through n fluorescent probes, the operation is simple, the sensitivity is high, and the problem that the detection of nucleic acid or protein in the prior art is limited by fluorescence spectrum overlapping and the detection accuracy is low is solved. The problems of prolonged antibody incubation time, antigen epitope loss, tissue degradation, fluorophore inactivation and the like occur when multi-repeat path imaging adopts iterative dyeing, imaging and bleaching / antibody removal methods.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and in particular relates to a detection method for simultaneously imaging or quantifying multiple protein biomarkers on a cell or tissue sample based on rolling circle amplification. Background Art

[0002] In situ protein detection technology relies on antibodies. Currently, antibody-based multiplex imaging methods can be classified according to the antibody labeling mode, and the existing labeling methods include metal tags, fluorophores, DNA oligonucleotide barcodes, enzymes, etc.

[0003] Multiplexed imaging methods that rely on antibody-labeled DNA oligonucleotide barcodes, such as DNA exchange imaging (DEI), immunostaining with signal amplification by exchange reaction (immune-SABER), and co-detection by indexing (CODEX), allow one-step immunostaining and rapid DNA oligonucleotide barcode reading by rapid binding / dissociation of fluorescent oligonucleotides, but suffer from poor label stability after elution and multiple rounds of treatment.

[0004] Fluorescence-based multiplex imaging is limited by the spectral overlap of fluorophores. A single round of imaging can only detect 3-5 target proteins. If more than 5 proteins need to be imaged, multiple rounds of elution and repeated staining are required, which will cause problems such as loss of antigen epitopes and local structural distortion. In addition, elution and repeated staining will significantly increase the complexity of the operation, increase detection time and cost. By using advanced instruments and adjusting fluorophores with different excitation and emission spectra to compensate for spectral overlap, the number of imaging can be increased to a certain extent (less than 10 multiplexes), but the cost will increase significantly.

[0005] At present, the most widely used technology is tyramide dignal amplification (TSA), which directly binds fluorescent dyes to antigens and uses horseradish peroxidase (HRP) for enzymatic activation to perform in situ labeling of target proteins or nucleic acids. Due to the lack of an orthogonal chemical system, TSA is limited to labeling one target at a time. Multiple targets need to be labeled with antibodies in sequence and different fluorescent agents used for signal amplification, but this will result in prolonged antibody incubation time, loss of antigen epitopes, and inactivation of fluorophores.

[0006] Under normal circumstances, if you want to detect multiple proteins simultaneously in the same reaction system using fluorescence detection methods, you need to prepare fluorescent probes of multiple colors, which is a one-to-one correspondence. For example, patent document CN 112557666A discloses a kit for simultaneously detecting multiple biomarkers based on nucleic acid rolling circle amplification reaction. In a specific embodiment, the inventor only achieves simultaneous detection of three target proteins, namely cardiac troponin I, myoglobin and creatine kinase isozymes. Correspondingly, the production of fluorescent probes requires labeling with three different colors of fluorescent groups, namely FAM, Cy3 and Cy5. For example, patent document CN113046422A discloses a flow cytometry detection method for exosome membrane proteins based on rolling circle amplification. In a specific embodiment, four proteins are detected simultaneously in the same reaction system, namely HER-2 protein, EpCAM protein, MUC1 protein, and PSMA protein. Four fluorescent dyes are required when labeling fluorescent probes, namely Pacific Blue, Alexa 488, Alexa 555, and Cy5, corresponding to the PB, FITC, PE, and APC channels of the flow, respectively, to ensure multi-color simultaneous detection of exosome membrane proteins. Therefore, the prior art is applicable to the detection of 1-5 target proteins. If multiple target proteins are to be detected simultaneously, the spectral limit of the traditional fluorescence microscope is exceeded, resulting in spectral overlap.

[0007] In order to solve the problems that the detection of nucleic acids or proteins in the prior art is limited by the overlap of fluorescence spectra, and multiple-channel imaging adopts iterative staining, imaging and bleaching / antibody removal methods, such as prolonged antibody incubation time, loss of antigen epitopes, tissue degradation and fluorophore inactivation, the present invention provides a method for simultaneous detection of multiple protein biomarkers based on rolling circle amplification, which omits the process of iterative antibody staining and bleaching to remove antibodies, significantly reduces the corresponding antibody incubation time and the risk of antigen epitope loss, and can achieve simultaneous imaging detection of more than 100 different target proteins within the fluorescence spectrum. Summary of the invention

[0008] The present invention provides a detection method for simultaneously imaging or quantifying multiple protein biomarkers on a cell or tissue sample based on rolling circle amplification.

[0009] To achieve the above purpose, the present invention adopts the following technical solution:

[0010] A method for simultaneous detection of multiple protein biomarkers based on rolling circle amplification, which uses n fluorescent probes and 2 fluorescent hybridization pathways with different n -1 circular DNA template rolling circle amplification products are hybridized and multi-channel fluorescence imaging is used to realize 2 n - Qualitative and / or quantitative detection of 1 protein biomarker;

[0011] 2 n -1 circular DNA template is a circular DNA template of different types of n probe combinations containing different numbers of fluorescent probe hybridization pathways; the n probe combination types are 1→n (indicating an integer from 1 to n);

[0012] Each circular DNA template sequence in each group contains a primer hybridization region and a hybridization pathway region containing different numbers of fluorescent probes; the number of hybridization pathway regions containing different numbers of fluorescent probes is m, m is less than or equal to n, and the number of circular DNA templates in each group is C n m ;

[0013] n is an integer ≤10, specifically, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0014] The primer hybridization region in each circular DNA template sequence is a region complementary or substantially complementary to the primer sequence labeled with the specific antibody, and the fluorescent probe hybridization pathway region is a region identical or substantially identical to the oligonucleotide sequence of the fluorescent probe.

[0015] The method detects 2 by n fluorescent probes n -1 protein biomarker, the specific antibody of the labeled primer recognizes the protein target, the circular DNA template is added to start rolling circle amplification, a long-chain DNA amplification product is formed, a fluorescent probe is added to hybridize with the long-chain DNA amplification product, and the qualitative and / or quantitative analysis and detection of the protein marker is achieved through multi-channel fluorescence imaging.

[0016] Each group of circular DNA templates contains m fluorescent probe hybridization pathways, and the number of circular DNA templates in the group is C. n m ; At the same time, m is less than or equal to n,

[0017] When m=1, the number of circular DNA templates in this group is C n 1 Each template sequence of the group includes a primer hybridization region and a fluorescent probe hybridization path region, and each fluorescent probe hybridization region is respectively identical or substantially identical to the oligonucleotide sequence of the following n fluorescent probes;

[0018] When m=2, the number of circular DNA templates in this group is C n 2 The template sequence includes one primer hybridization region and two fluorescent probe hybridization regions, and the two fluorescent probe hybridization regions are respectively identical or substantially identical to any two of the oligonucleotide sequences of the following n fluorescent probes;

[0019] When m=3, the number of circular DNA templates in this group is Cn 3 The template sequence includes one primer hybridization region and three fluorescent probe hybridization regions, and the three fluorescent probe hybridization regions are respectively identical or substantially identical to any three of the oligonucleotide sequences of the following n fluorescent probes;

[0020] And so on;

[0021] When m=n, the number of circular DNA templates in this group is C n n The template sequence includes 1 primer hybridization region and n fluorescent probe hybridization regions, and the n fluorescent probe hybridization regions are respectively identical or substantially identical to the oligonucleotide sequences of the following n fluorescent probes.

[0022] When 2 n -1 circular DNA template is composed of n probes arranged in n different patterns, when n is 1, m is 1, the circular DNA template is 1 group, and the number of circular DNA templates in this group is C1 1 indivual;

[0023] When n is 2, m can be 1 or 2, that is, there are two groups. When m is 1, the circular DNA template of this group is C2 1 When m is 2, the circular DNA template is C2 2 indivual;

[0024] When n is 3, m can be 1, 2, 3, that is, 3 groups. When m is 1, the circular DNA template of this group is C3 1 When m is 2, the circular DNA template is C3 2 When m is 3, the circular DNA template is C3 3 indivual;

[0025] When n is 4, m can be 1, 2, 3, 4, that is, 4 groups. When m is 1, the circular DNA template of this group is C4 1 When m is 2, the circular DNA template is C4 2 When m is 3, the circular DNA template is C4 3 When m is 4, the circular DNA template is C4 4 indivual;

[0026] And so on

[0027] When n is n, m can be 1, 2, 3, 4...n, that is, n groups, when m is 1, the circular DNA template of this group is C n 1 When m is 2, the circular DNA template is C n 2 When m is 3, the circular DNA template is C n3 When m is 4, the circular DNA template is C n 4 ...When m is equal to n, the circular DNA template is C n n indivual.

[0028] The number of specific antibodies for the labeled primer is 2 n -1, each specific antibody is labeled with a different primer sequence;

[0029] The fluorescent probe includes a fluorescent imaging probe or a fluorescent quantitative probe. The fluorescent imaging probe is an oligonucleotide sequence modified with a fluorescent group; the fluorescent quantitative probe is an oligonucleotide sequence containing a fluorescent group and a quenching group; the number of the fluorescent probes is n, and each fluorescent probe is a different oligonucleotide sequence.

[0030] Furthermore, the fluorescent group and the quenching group can be at the 5' end, 3' end or in the middle of the sequence of each fluorescent probe, respectively;

[0031] In a preferred embodiment of the present invention, the fluorescent group is selected from FAM, ROX, and Cys, and the quenching group is selected from BHQ2.

[0032] In an embodiment of the present invention, the sample to be tested may be a target protein on a tissue section, or may be a target protein in a body fluid sample captured by antibody-coated magnetic beads. When the sample is a tissue section, simultaneous in situ detection of multiple protein markers can be achieved. The in situ analysis method of the present invention includes an in situ fluorescence imaging method and an in situ fluorescence quantification method.

[0033] In one embodiment, the present invention provides a method for in situ fluorescence imaging of protein biomarkers based on rolling circle amplification, the method comprising the following steps:

[0034] (1) Fully combining a sample containing a protein biomarker with a specific antibody labeled with a primer, and washing away unbound antibodies;

[0035] (2) adding a circular DNA template to the amplification reaction solution to perform rolling circle amplification to obtain a long-chain DNA amplification product;

[0036] (3) Add fluorescent imaging probes to hybridize with the long-chain DNA amplification products to perform fluorescent imaging.

[0037] In another embodiment, the present invention provides a method for in situ fluorescence quantification of protein biomarkers based on rolling circle amplification, the method comprising the following steps:

[0038] (1) Fully combining a sample containing a protein biomarker with a specific antibody of a labeled primer, and washing away unbound antibodies;

[0039] (2) adding a circular DNA template to the amplification reaction solution to perform rolling circle amplification to obtain a long-chain DNA amplification product;

[0040] (3) Add fluorescent quantitative probes to hybridize with the long-chain DNA amplification products, add endonucleases to cut the fluorescent molecules to generate fluorescent signals, and quantitatively detect protein biomarkers by fluorescence intensity.

[0041] The amplification reaction solution includes pih29 DNA polymerase, dNTP, MgAC2, DTT and Tris buffer.

[0042] The endonuclease is Nb.BbxCl or Endonuclease IV.

[0043] A fluorescent imaging kit for multiple protein biomarkers based on rolling circle amplification, the kit comprising 2 n -1 specific antibody solution for labeled primers, 2 n -1 reaction solution containing a circular DNA template and n fluorescent imaging probe solutions, the kit uses n fluorescent probes to achieve 2 n - Fluorescence imaging of 1 protein biomarker;

[0044] The circular DNA template is prepared by the following method:

[0045] S1: Synthesized linear padlock DNA and DNA complementary to the primer, dissolved in buffer respectively;

[0046] S2: Take equal volumes of linear padlock DNA and DNA complementary to the primer, mix them, add T4 ligase, react for 1-2 hours, and heat to inactivate T4 ligase;

[0047] S3: adding exonuclease I and exonuclease III to the above reaction solution, reacting for 2-3 hours, and heating to inactivate exonuclease I and exonuclease III;

[0048] S4: Purify the circular DNA template;

[0049] The DNA complementary to the primer is 2 n -1, each of which is complementary to the primer sequence labeled with the specific antibody; the linear padlock DNA is 2 n -1, of which 2 n -1 linear padlock DNA is each set of linear padlock DNA of different types containing different numbers of fluorescent probe hybridization pathway regions composed of n probe arrangements and combinations; the n probe arrangement and combination types are 1→n (representing an integer from 1 to n);

[0050] Each linear padlock DNA sequence in each group contains a primer hybridization region and a hybridization pathway region containing different numbers of fluorescent probes; the number of hybridization pathway regions containing different numbers of fluorescent probes is m, m is less than or equal to n, and the number of linear padlock DNA sequences in each group is C n m ;

[0051] n is an integer ≤10, specifically, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0052] 2 n -1 reaction solution containing a circular DNA template also includes rolling circle amplification components, and the rolling circle amplification components include pih29 DNA polymerase, dNTP, MgAC2, DTT and Tris buffer.

[0053] 2 n -1 specific antibody for each labeled primer can specifically bind to 2 n - 1 protein biomarker, each specific antibody labeled with a different primer sequence;

[0054] The specific antibody of the labeled primer is prepared by the following method:

[0055] S1: Take 100-200 μl of an antibody solution with a concentration of 1-2 mg / ml, add 3-5 mM SMCC solution and mix thoroughly, react at room temperature for 1-2 h, and ultrafiltrate and centrifuge to obtain an SMCC-labeled antibody solution;

[0056] S2: Add thiol-labeled primer DNA to the SMCC-labeled antibody solution, with the molar ratio of antibody to primer DNA being 1:(8-10), react at room temperature for 1-2 hours, and ultrafiltrate and centrifuge to obtain the specific antibody of the labeled primer;

[0057] The n fluorescent imaging probes are n different oligonucleotide sequences, each probe is modified with a different fluorescent group. Specifically, the fluorescent group and the quenching group can be located at the 5' end, 3' end or in the middle of the sequence of each fluorescent imaging probe; the oligonucleotide sequence can hybridize with the long-chain DNA of rolling circle amplification.

[0058] A protein biomarker fluorescence quantitative kit based on rolling circle amplification, the kit contains the components recorded in the above-mentioned fluorescence imaging kit and an endonuclease, and the kit realizes 2 n - Fluorescence quantification of 1 protein biomarker;

[0059] The circular DNA template is prepared by the following method:

[0060] S1: Synthesized linear padlock DNA and DNA complementary to the primer, dissolved in buffer respectively;

[0061] S2: Take equal volumes of linear padlock DNA and DNA complementary to the primer, mix them, add T4 ligase, react for 1-2 hours, and heat to inactivate T4 ligase;

[0062] S3: adding exonuclease I and exonuclease III to the above reaction solution, reacting for 2-3 hours, and heating to inactivate exonuclease I and exonuclease III;

[0063] S4: Purify the circular DNA template.

[0064] The n fluorescent quantitative probes are n different oligonucleotide sequences, each probe is modified with a different fluorescent group and a quenching group, and further, the fluorescent group and the quenching group can be at the 5' end, 3' end or the middle of the sequence of each fluorescent quantitative probe; the oligonucleotide sequence can hybridize with the long-chain DNA of rolling circle amplification;

[0065] The endonuclease can specifically recognize and cut the AP site on the short double-stranded DNA, cut off the fluorescent probe and make it fall off. The endonuclease is selected from Nb.BbxCl or Endonuclease IV.

[0066] The present invention provides a protein biomarker analysis method that can use n fluorescent probes to detect 2 n -1 protein biomarker is simultaneously subjected to fluorescence imaging or fluorescence quantitative analysis. The principle is: a sample containing the protein biomarker to be tested is mixed with an antibody labeled with a primer sequence. The sample to be tested can be a target protein on a tissue section or a target protein in a body fluid specimen captured by antibody-coated magnetic beads. The target antigen binds specifically to the antibody, the unbound antibody is washed away, a circular DNA template and an enzyme required for rolling circle amplification are added, the DNA sequence labeled with the specific antibody is used as a primer, and the circular DNA is used as a template to start rolling circle amplification to form a single-stranded DNA product with a repeating sequence. At the same time, a fluorescent imaging probe is added, and the DNA sequence on the fluorescent probe hybridizes with the single-stranded DNA to form a short double-stranded DNA with a gap. The imaging is performed in different fluorescent channels to achieve simultaneous imaging analysis of multiple protein biomarkers. Alternatively, a fluorescent quantitative probe is added, and an endonuclease is added to the short double-stranded DNA system with a gap. The endonuclease can specifically recognize and cut the AP site on the short double-stranded DNA, so that the fluorescent probe is cut off and falls off. At this time, the fluorescent group is released, and fluorescence is continuously generated. The fluorescence intensity value is recorded, and the concentration of each protein biomarker is calculated.

[0067] The circular DNA template designed by the inventors includes a primer hybridization region and a fluorescent probe hybridization region. When the number of fluorescent probes is n, the DNA amplified in the fluorescent probe hybridization region can hybridize with 1 fluorescent probe, or 2 fluorescent probes, or 3 fluorescent probes, or 4 fluorescent probes, up to n fluorescent probes, to form 2 fluorescent probes in total. n -1 fluorescent probe hybridization zone. For example, using two fluorescent probes, the fluorescent groups are red light and yellow light respectively. According to the method provided by the present invention, three protein biomarkers can be detected simultaneously. The sequences of the fluorescent probe hybridization zones of the three circular DNA templates are red light probe sequence, yellow light probe sequence, and red light probe sequence + yellow light probe sequence, respectively, so that the three amplified long-chain DNAs can hybridize with the red light probe, or the yellow light probe, or the red light + yellow light probe. By analogy, at this stage, there are 7 non-overlapping spectral ranges that can be simultaneously labeled, so 2 7 -1 = 127 target proteins, no multiple rounds of washing are required.

[0068] The present invention provides a method for detecting 2 by using n fluorescent probes n -1 protein biomarker method, which performs signal amplification by rolling circle amplification. Different fluorescent probe binding sites are designed on the rolling circle. Different fluorescent probes are imaged under different fluorescent channels. While amplifying, rapid, wash-free, multiple protein imaging is achieved based on combined imaging of multiple fluorescent channels. It is simple to operate and has high clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] Figure 1 Schematic diagram of the principle of the in situ analysis method for protein biomarkers.

[0070] Figure 2 Schematic diagram of the process of in situ analysis of protein biomarkers.

[0071] Figure 3 CD3 staining in lymph node tissue, A: immunohistochemical staining; B: primer-modified antibody, no RCA amplification, only adding complementary fluorescent probe for imaging; C: immunofluorescence staining; D: fluorescence imaging based on RCA amplification according to the present invention.

[0072] Figure 4 Antibody-labeled magnetic beads capture the target in the sample and then detect it after amplification. DETAILED DESCRIPTION

[0073] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only some embodiments of the present invention, not all. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0074] The method for simultaneous analysis of multiple protein biomarkers is based on rolling circle amplification fluorescence signal amplification technology, and uses antigen-antibody immune reaction to achieve simultaneous in situ protein imaging and quantitative detection at the single molecule level. The method amplifies the signal by rolling circle amplification, can improve the diagnostic accuracy of the corresponding disease, has high sensitivity, is simple to operate, and has high clinical application value.

[0075] Example 1

[0076] Detecting 1 protein biomarker with 1 fluorescent probe

[0077] like Figure 3 Immunohistochemistry (IHC) and immunofluorescence (IF) showed that positive signals were localized in CD3-positive T lymphocytes ( Figure 3 A, 3C) are currently widely used common techniques for detecting target proteins by antigen-antibody reaction and serve as positive controls for the detection results of this method.

[0078] 1. Kit

[0079] 1.1 Preparation of specific antibodies for labeled primers

[0080] S1: Take 100ul of 1mg / ml CD3 antibody solution and an appropriate amount of 3mM SMCC solution, mix thoroughly, shake at 500rmp for 1h at room temperature, and ultrafilter and centrifuge at 14000g / 5min for 3 times to remove unreacted SMCC;

[0081] S2: Collect the SMCC labeled antibody solution in the filter element into a new ultrafiltration tube, add appropriate amount of thiol labeled primer 1 (SEQ ID NO.1) respectively, the molar ratio of antibody to DNA is 1:8, place it in an oscillator at 500 rpm for 120 minutes, and then centrifuge it at 14000g for several times to obtain the purified specific antibody 1 of labeled primer 1. The molar extinction coefficient of DNA at 260 and 280 nm is calculated using the absorbance values ​​at 260 nm and 280 nm, and the antibody concentration and the amount of DNA connected to each antibody are calculated to facilitate the adjustment of the antibody concentration later.

[0082] 1.2 Preparation of circular DNA template

[0083] S1: Synthesized linear padlock DNA (SEQ ID NO. 4) and DNA complementary to primer 1 (SEQ ID NO. 5), dissolved in 10 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA buffer;

[0084] S2: Take equal volumes of linear padlock DNA and DNA complementary to the primer, mix them, heat at 95°C for 5 min, and cool to room temperature;

[0085] S3: Add T4 ligase to the above mixture, react at 37°C for 2 hours, and heat at 65°C for 5 minutes after the reaction to inactivate the T4 ligase;

[0086] S4: add exonuclease I and exonuclease III to the above reaction solution, place at 37°C for 3 hours to fully remove the uncirculated primers, and heat at 85°C for 20 minutes after the reaction to inactivate exonuclease I and exonuclease III;

[0087] S5: The circular DNA template 1 is purified by ethanol precipitation.

[0088] 1.3 Preparation of fluorescence imaging probes

[0089] The fluorescent imaging probes are as follows:

[0090] 1 GGGAGACTGATTACACGAGG SEQ ID NO.10

[0091] 2. Fluorescence Imaging Analysis

[0092] (1) mixing the sample to be tested containing CD3 antibody with the specific antibody of the labeled primer prepared above, and washing away the unbound antibody;

[0093] (2) adding the circular DNA template prepared above to perform rolling circle amplification in the amplification reaction solution to obtain a long-chain DNA amplification product;

[0094] (3) Adding the fluorescent imaging probe prepared above to hybridize with the long-chain DNA amplification product to perform fluorescent imaging.

[0095] The nucleotide sequences involved in the above embodiments are shown in the following table:

[0096]

[0097] After RCA amplification, the specific CD3 antibody labeled with primers ( Figure 3 D), compared with immunofluorescence ( Figure 3 C), the present invention has a stronger fluorescent color development signal.

[0098] Example 2

[0099] Detection of three protein biomarkers with two fluorescent probes

[0100] 1. Kit

[0101] 1.1 Preparation of specific antibodies for labeled primers

[0102] S1: Take 100ul of 1mg / ml antibody 1, antibody 2, and antibody 3 solution respectively, take an appropriate amount of 3mM SMCC solution and mix thoroughly, shake at 500rmp for 1h at room temperature, and ultrafilter and centrifuge at 14000g / 5min for 3 times to remove unreacted SMCC;

[0103] S2: Collect the SMCC labeled antibody solution in the filter element into a new ultrafiltration tube, add appropriate amounts of thiol labeled primer 1 (SEQ ID NO.1), thiol labeled primer 2 (SEQ ID NO.2), and thiol labeled primer 3 (SEQ ID NO.3) respectively, the molar ratio of antibody to DNA is 1:8, place in an oscillator at 500 rpm for 120 min, and then centrifuge several times at 14000g to obtain purified specific antibody 1 of labeled primer 1, specific antibody 2 of labeled primer 2, and specific antibody 3 of labeled primer 3. Calculate the molar extinction coefficient of DNA at 260 and 280 nm using the absorbance values ​​at 260 nm and 280 nm, calculate the antibody concentration and the amount of DNA connected to each antibody, so as to adjust the antibody concentration later.

[0104] 1.2 Preparation of circular DNA template

[0105] S1: Synthesized linear padlock DNA (SEQ ID NO. 4) and DNA complementary to primer 1 (SEQ ID NO. 5), dissolved in 10 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA buffer;

[0106] S2: Take equal volumes of linear padlock DNA and DNA complementary to the primer, mix them, heat at 95°C for 5 min, and cool to room temperature;

[0107] S3: Add T4 ligase to the above mixture, react at 37°C for 2 hours, and heat at 65°C for 5 minutes after the reaction to inactivate the T4 ligase;

[0108] S4: add exonuclease I and exonuclease III to the above reaction solution, place at 37°C for 3 hours to fully remove the uncirculated primers, and heat at 85°C for 20 minutes after the reaction to inactivate exonuclease I and exonuclease III;

[0109] S5: The circular DNA template 1 is purified by ethanol precipitation.

[0110] According to the same method, circular DNA template 2 was prepared using linear padlock DNA (SEQ ID NO. 6) and DNA complementary to primer 2 (SEQ ID NO. 7). Circular DNA template 3 was prepared using linear padlock DNA (SEQ ID NO. 8) and DNA complementary to primer 3 (SEQ ID NO. 9).

[0111] 1.3 Preparation of fluorescence imaging probes

[0112] The fluorescent imaging probes are as follows:

[0113] 1 GGGAGACTGATTACACGAGG SEQ ID NO.10 2 GCTCTGTCCAAGGAACGGTGTCTA SEQ ID NO.11

[0114] 2. Fluorescence Imaging Analysis

[0115] (1) mixing the sample to be tested containing the three protein markers with the specific antibody of the labeled primer prepared above, and washing away the unbound antibody;

[0116] (2) adding the circular DNA template prepared above to perform rolling circle amplification in the amplification reaction solution to obtain a long-chain DNA amplification product;

[0117] (3) Adding the fluorescent imaging probe prepared above to hybridize with the long-chain DNA amplification product to perform fluorescent imaging.

[0118] The nucleotide sequences involved in the above embodiments are shown in the following table:

[0119]

[0120] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for simultaneous detection of multiple protein biomarkers based on rolling circle amplification, characterized in that: Based on the rolling circle amplification technology, n fluorescent probes are combined with 2 fluorescent hybridization pathways with different numbers. n -1 circular DNA template rolling circle amplification products are hybridized and multi-channel fluorescence imaging is used to realize 2 n - Qualitative and / or quantitative detection of 1 protein biomarker; 2 n -1 circular DNA template is a circular DNA template of different types of n probe combinations containing different numbers of fluorescent probe hybridization pathways; the n probe combination types are 1→n (indicating an integer from 1 to n); Each circular DNA template sequence in each group contains a primer hybridization region and a hybridization pathway region containing different numbers of fluorescent probes; the number of hybridization pathway regions containing different numbers of fluorescent probes is m, m is less than or equal to n, and the number of circular DNA templates in each group is C n m ; n is an integer ≤10, specifically, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

2. The method for simultaneous detection of multiple protein biomarkers based on rolling circle amplification according to claim 1, characterized in that: The primer hybridization region in each circular DNA template sequence is a region complementary or substantially complementary to the primer sequence labeled with the specific antibody, and the fluorescent probe hybridization pathway region is a region identical or substantially identical to the oligonucleotide sequence of the fluorescent probe.

3. The method for simultaneous detection of multiple protein biomarkers based on rolling circle amplification according to claim 1, characterized in that: The method detects 2 by n fluorescent probes n -1 protein biomarker, the specific antibody of the labeled primer recognizes the protein target, the circular DNA template is added to start rolling circle amplification, a long-chain DNA amplification product is formed, a fluorescent probe is added to hybridize with the long-chain DNA amplification product, and the qualitative and / or quantitative analysis of the protein marker is achieved through multi-channel fluorescence imaging.

4. The method for simultaneous detection of multiple protein biomarkers based on rolling circle amplification according to claim 1, characterized in that: Each group of circular DNA templates contains m fluorescent probe hybridization pathways, and the number of circular DNA templates in the group is C. n m ; At the same time, m is less than or equal to n, When 2 n -1 circular DNA template is composed of n probes arranged in n different patterns, and when m = 1, the number of circular DNA templates in this group is C n 1 Each template sequence of the group includes a primer hybridization region and a fluorescent probe hybridization path region, and each fluorescent probe hybridization region is respectively identical or substantially identical to the oligonucleotide sequence of the following n fluorescent probes; When m=2, the number of circular DNA templates in this group is C n 2 The template sequence includes one primer hybridization region and two fluorescent probe hybridization regions, and the two fluorescent probe hybridization regions are respectively identical or substantially identical to any two of the oligonucleotide sequences of the following n fluorescent probes; When m=3, the number of circular DNA templates in this group is C n 3 The template sequence includes one primer hybridization region and three fluorescent probe hybridization regions, and the three fluorescent probe hybridization regions are respectively identical or substantially identical to any three of the oligonucleotide sequences of the following n fluorescent probes; And so on; When m=n, the number of circular DNA templates in this group is C n n The template sequence includes 1 primer hybridization region and n fluorescent probe hybridization regions, and the n fluorescent probe hybridization regions are respectively identical or substantially identical to the oligonucleotide sequences of the following n fluorescent probes.

5. The analysis method according to claim 1, characterized in that The number of specific antibodies for the labeled primer is 2 n -1, each specific antibody is labeled with a different primer sequence; The fluorescent probe includes a fluorescent imaging probe or a fluorescent quantitative probe. The fluorescent imaging probe is an oligonucleotide sequence modified with a fluorescent group; the fluorescent quantitative probe is an oligonucleotide sequence containing a fluorescent group and a quenching group; the number of the fluorescent probes is n, and each fluorescent probe is a different oligonucleotide sequence.

6. A protein biomarker fluorescence imaging kit based on rolling circle amplification, characterized in that: The kit includes 2 n -1 specific antibody solution for labeled primers, 2 n -1 reaction solution containing a circular DNA template and n fluorescent imaging probe solutions, the kit uses n fluorescent probes to achieve 2 n - Fluorescence imaging of 1 protein biomarker; The circular DNA template is prepared by the following method: S1: Synthesized linear padlock DNA and DNA complementary to the primer, dissolved in buffer respectively; S2: Take equal volumes of linear padlock DNA and DNA complementary to the primer, mix them, add T4 ligase, react for 1-2 hours, and heat to inactivate T4 ligase; S3: adding exonuclease I and exonuclease III to the above reaction solution, reacting for 2-3 hours, and heating to inactivate exonuclease I and exonuclease III; S4: Purify the circular DNA template; The DNA complementary to the primer is 2 n -1, each of which is complementary to the primer sequence labeled with the specific antibody; the linear padlock DNA is 2 n -1, of which 2 n -1 linear padlock DNA is each set of linear padlock DNA of different types containing different numbers of fluorescent probe hybridization pathway regions composed of n probe arrangements and combinations; the n probe arrangement and combination types are 1→n (representing an integer from 1 to n); Each linear padlock DNA sequence in each group contains a primer hybridization region and a hybridization pathway region containing different numbers of fluorescent probes; the number of hybridization pathway regions containing different numbers of fluorescent probes is m, m is less than or equal to n, and the number of linear padlock DNA sequences in each group is C n m ; n is an integer ≤10, specifically, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

7. The kit according to claim 6, characterized in that 2 n -1 reaction solution containing a circular DNA template also includes rolling circle amplification components, and the rolling circle amplification components include pih29 DNA polymerase, dNTP, MgAC2, DTT and Trisbuffer.

8. The kit according to claim 6, characterized in that 2 n -1 specific antibody for each labeled primer can specifically bind to 2 n - 1 protein biomarker, each specific antibody labeled with a different primer sequence; The specific antibody of the labeled primer is prepared by the following method: S1: Take 100-200 μl of an antibody solution with a concentration of 1-2 mg / ml, add 3-5 mM SMCC solution and mix thoroughly, react at room temperature for 1-2 h, and ultrafiltrate and centrifuge to obtain an SMCC-labeled antibody solution; S2: Add thiol-labeled primer DNA to the SMCC-labeled antibody solution, with the molar ratio of antibody to primer DNA being 1:(8-10), react at room temperature for 1-2 hours, and ultrafiltrate and centrifuge to obtain the specific antibody of the labeled primer; The n fluorescent imaging probes are n different oligonucleotide sequences, each probe is modified with a different fluorescent group, and the oligonucleotide sequence can hybridize with the long-chain DNA of rolling circle amplification.

9. A fluorescent quantitative kit for multiple protein biomarkers based on rolling circle amplification, characterized in that: The kit contains the components described in claim 6 and an endonuclease, and the kit realizes 2 n - Fluorescence quantification of 1 protein biomarker; The circular DNA template is prepared by the following method: S1: Synthesized linear padlock DNA and DNA complementary to the primer, dissolved in buffer respectively; S2: Take equal volumes of linear padlock DNA and DNA complementary to the primer, mix them, add T4 ligase, react for 1-2 hours, and heat to inactivate T4 ligase; S3: adding exonuclease I and exonuclease III to the above reaction solution, reacting for 2-3 hours, and heating to inactivate exonuclease I and exonuclease III; S4: Purify the circular DNA template.

10. The kit according to claim 9, characterized in that The n fluorescent quantitative probes are n different oligonucleotide sequences, each probe is modified with a different fluorescent group and a quenching group; the oligonucleotide sequence can hybridize with the long-chain DNA of rolling circle amplification; The endonuclease can specifically recognize and cut the AP site on the short double-stranded DNA, cut off the fluorescent probe and make it fall off. The endonuclease is selected from Nb.BbxCl or Endonuclease IV.

Images