Application of CENPM gene and encoded protein thereof as marker and therapeutic target of adrenal cortical carcinoma metastasis

Abstract

The invention discloses an application of a CENPM gene and a coding protein thereof as a marker and a treatment target of adrenal cortical carcinoma metastasis, and relates to the field of biological medicines. The invention provides a key regulatory factor CENPM for adrenal cortical carcinoma metastasis, and the CENPM shows that the CENPM is highly related to tumor prognosis; and a new marker is provided for preparing a product for diagnosing and prognosing the metastasis of the adrenocortical carcinoma. Researches find that proliferation, invasion and migration of adrenal cortex cancer cells can be effectively reduced by inhibiting expression of the CENPM gene or the encoded protein thereof, and a new target is provided for preparing products for treating adrenal cortex cancer or metastatic adrenal cortex cancer.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and specifically to the mechanism, prognosis evaluation and targeted drug therapy of adrenocortical carcinoma metastasis; in particular, to the application of CENPM gene and its encoded protein as a marker and therapeutic target for adrenocortical carcinoma metastasis. Background Art

[0002] Adrenocortical carcinoma is a rare adrenal cortical endocrine malignancy. Although there are only 0.7-2.0 cases per million people each year, adrenocortical carcinoma is still an aggressive and fatal tumor due to late diagnosis, local invasion, distant metastasis or recurrence. 66% of adrenocortical carcinoma cases have distant metastasis, and the lungs, liver and bones are the most commonly affected organs. The median overall survival of metastatic adrenocortical carcinoma is less than 1 year, and the 5-year survival rate is 0-28%. More and more evidence shows that tumor staging has limitations as the strongest tumor prognostic indicator. Some patients with earlier stages will have recurrence and metastasis after surgery, and some patients with later stages will also have long-term survival, indicating the heterogeneity of tumors and the need for more accurate prognostic markers. At present, surgery, radiotherapy, chemotherapy, and mitotane are the main treatments for metastatic adrenocortical carcinoma, and there is no reliable targeted therapy drug. Summary of the invention

[0003] In view of this, the purpose of the present invention is to provide a CENPM gene and its encoded protein as a marker and therapeutic target for adrenocortical carcinoma metastasis. The CENPM gene is centromere protein M (CENPM). Through identification, it was found that CENPM is a key gene regulating adrenocortical carcinoma metastasis. The CENPM gene is highly expressed in patients with adrenocortical carcinoma, and the CENPM protein is highly expressed in patients with adrenocortical carcinoma. The expression level increases with the increase of tumor stage, and it can be used as a new marker for diagnosing adrenocortical carcinoma or metastatic adrenocortical carcinoma.

[0004] To achieve the above object, the technical solution of the present invention is as follows:

[0005] Use of CENPM gene and / or its encoded protein as a target in the preparation of a drug for treating adrenocortical carcinoma or metastatic adrenocortical carcinoma.

[0006] Among them, the sequence of the CENPM gene is shown in SEQ ID NO.1, specifically: 1gctctagggg ctggactcagggcggtttga aagatcggcg cgcaccgcag gagcaacggt61tggtcctgcg gctgtgatgt cggtgttgaggcccctggac aagctgcccg gcctgaacac121ggccaccatc ttgctggtgg gcacggaggatgctcttctgcagcagctgg cggactcgat

[0007] 181gctcaaagag gactgcgcct ccgagctgaa ggtccacttg gcaaagtccc tccctttgcc

[0008] 241ctccagtgtg aatcggcccc gaattgacct gatcgtgttt gtggttaatc ttcacagcaa

[0009] 301atacagtctc cagaacacag aggagtccct gcgccatgtg gatgccagct tcttcttggg

[0010] 361gaaggtgtgtttcctcgcca caggtgctgg gcgggagagc cactgcagcattcaccggca421caccgtggtg aagctggccc acacctatca aagccccctg ctctactgtgacctggaggt

[0011] 481ggaaggcttt agggccacca tggcgcagcg cctggtgcgc gtgctgcagatctgtgctgg541ccacgtgccc ggtgtctcag ctctgaacct gctgtccctg ctgagaagctctgagggccc

[0012] 601ctccctggag gacctgtgag ggtggctggc ccctgggctg ccccttctca tggcttcgtg

[0013] 661ctgactccat aaacattctc tgttgaggat gtccagtcag ggcttgacag gcccaggctc

[0014] 721agcccgccgt ggctgggaag gttccctgca gtgccagtgc tgcagcagggagagctgggc781agaagcagcg aggggggccca gctggcgaga ctgtagcccc ctcccactcccacactcact841cttgcagagc ctgtgtcttt aagcagctgg cgtgttacat ctccatttaaggtttccttt

[0015] 901gaacaaaagg tctgtggcta aaaaaagttt aaaaatca

[0016] The amino acid sequence of the encoded protein is shown in SEQ ID NO.2, specifically:

[0017] 1msvlrpldklpglntatill vgtedallqq ladsmlkedc aselkvhlak slplpssvnr

[0018] 61pridlivfvv nlhskyslqn teeslrhvda sfflgkvcfl atgagreshc sihrhtvvkl

[0019] 121ahtyqsplly cdlevegfra tmaqrlvrvl qicaghvpgv salnllsllr ssegpsledl

[0020] Furthermore, the application is to inhibit the expression of CENPM gene or inhibit the function of protein encoded by CENPM gene.

[0021] Furthermore, the expression of the CENPM gene or the function of the protein encoded by the CENPM gene is inhibited by RNA interference technology or gene editing technology; or the expression of the CENPM gene or the function of the protein encoded by the CENPM gene is inhibited by antisense nucleotide drugs or antibody drugs.

[0022] The second object of the present invention is to provide the use of CENPM gene and / or its encoded protein as a marker in the preparation of a product for diagnosing adrenocortical carcinoma or metastatic adrenocortical carcinoma.

[0023] Furthermore, the product includes a reagent, a kit or a chip for detecting the activity of the CENPM gene or the protein encoded by the CENPM gene.

[0024] Furthermore, the expression level of the marker is positively correlated with adrenocortical carcinoma or metastatic adrenocortical carcinoma.

[0025] The present invention also aims to provide the use of CENPM gene and / or its encoded protein as a marker in the preparation of a product for assessing the severity of adrenocortical carcinoma or a prognostic product; or in the preparation of a product for assessing the severity of metastatic adrenocortical carcinoma or a prognostic product.

[0026] Specifically, the expression of CENPM gene or mRNA in adrenocortical carcinoma is detected by using reverse transcription PCR, real-time quantitative PCR, digital PCR, in situ hybridization, Northern blot, and high-throughput sequencing platforms to evaluate the prognosis and treatment effect of the tumor.

[0027] Immunohistochemistry, western blot and enzyme-linked immunosorbent assay were used to detect the expression of CENPM gene-encoded protein in the adrenal cortex and to evaluate the prognosis and treatment effect of the tumor.

[0028] The present invention also aims to provide the use of an agent for inhibiting the expression of CENPM gene and / or inhibiting the protein encoded by CENPM gene in the preparation of a drug for treating adrenocortical carcinoma.

[0029] The present invention also provides a drug for treating adrenocortical carcinoma or metastatic adrenocortical carcinoma, the drug comprising:

[0030] 1) siRNA to knock down CENPM gene expression;

[0031] 2) DNA or RNA that blocks the expression or transcription of CENPM-encoded proteins;

[0032] 3) Inhibitors against CENPM encoded proteins, including small molecule compounds, antibody drugs, proteins, nucleic acid molecules, polypeptides, lipids, carbohydrates or combinations thereof.

[0033] Furthermore, the sequence of the siRNA for knocking out the expression of the CENPM gene includes at least one of the following:

[0034] siCENPM-1:

[0035] sense(5'-3')GGAAGGCUUUAGGCCACCTT,

[0036] antisense(5'-3')GGUGGCCCUAAAGCCUUCCTT;

[0037] siCENPM-2:

[0038] sense(5'-3')GAUCGUGUUUGUGGUUAAUTT,

[0039] antisense(5'-3')AUUAACCACAACACGAUCTT;

[0040] Furthermore, in the above application, for metastatic adrenocortical carcinoma, the metastatic organs include liver and / or lung.

[0041] The beneficial effects of the present invention include at least:

[0042] (1) Currently, tumor staging is the most reliable indicator for the prognosis of adrenocortical carcinoma. Although the survival rate of advanced adrenocortical carcinoma is very low, there are still some long-term survivors, which shows the heterogeneity of metastatic adrenocortical carcinoma and the necessity of accurate prognostic indicators. The present invention provides CENPM, a key regulator of adrenocortical carcinoma metastasis, which shows a high correlation with tumor prognosis; it provides a new marker for the preparation of products for the diagnosis and prognosis of adrenocortical carcinoma metastasis.

[0043] (2) Currently, the main treatments for metastatic adrenocortical carcinoma are chemotherapy and radiotherapy, and there is a lack of specific targeted therapeutic drugs. The present invention provides CENPM, a key regulatory factor for adrenocortical carcinoma metastasis. Through research, it is found that inhibiting the expression of the CENPM gene or its encoded protein can effectively reduce the proliferation, invasion and migration of adrenocortical cancer cells, providing a new target for the preparation of products for the treatment of adrenocortical carcinoma or metastatic adrenocortical carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1The "Salmon Red" gene module associated with adrenocortical carcinoma metastasis was found by WGCNA. A) WGCNA analysis; B) Gene dendrogram obtained by hierarchical clustering, genes are clustered into 12 modules represented by different colors, and non-clustered genes are displayed in gray; C) Hierarchical clustering dendrogram and adjacency heat map of module characteristic genes and sample phenotypes. The "Salmon Red" gene module has a high degree of adjacency with "cancer" and "metastasis"; D) Pearson correlation analysis between gene modules and clinical phenotypes. The "Salmon Red" gene module is positively correlated with "cancer" (cor=0.70) and "metastasis" (cor=0.41), and negatively correlated with "survival" (cor=-0.49) and "normal" (cor=-0.70); E) Scatter plot of "Salmon Red" module members and correlation with cancer trait GS. The "Salmon Red" gene module is highly correlated with cancer traits; F) Scatter plot of "Salmon Red" gene module members and correlation with metastasis trait GS. The “Salmon Red” module was highly correlated with metastatic traits.

[0045] Figure 2 CENPM is a node gene in the "Salmon Red" module. A) GO functional enrichment analysis of the "Salmon Red" module; B) GSEA enrichment analysis of normal adrenal gland and adrenocortical carcinoma. The "Mitotic sister chromatid separation", "Sister chromatid separation", "Nuclear chromosome separation" and "Mitotic spindle organization" signals in adrenocortical carcinoma are significantly upregulated; C) Venn diagram of genes (GO:0007059) that appear in the "Salmon Red" module and are upregulated in adrenocortical carcinoma and are involved in chromosome segregation; D) PPI network based on 78 genes. The largest PPI network consists of eight CENP family members. Genes with node degrees less than 1 are not included; E) Node diagram of eight CENP family members in the above PPI network. CENPM's node ranks second; F) Spearman analysis of the correlation between the expression of eight CENP family members and the overall survival time of adrenocortical carcinoma. CENPM has the highest negative correlation with the overall survival time of adrenocortical carcinoma.

[0046] Figure 3 CENPM mRNA expression is upregulated in adrenocortical carcinoma and is associated with poor prognosis in patients with adrenocortical carcinoma. A) CENPM mRNA expression in normal adrenal gland and adrenocortical carcinoma. B) CENPM mRNA expression in adrenocortical carcinoma at different pathological stages; CF) CENPM mRNA expression in four adrenocortical carcinoma GEO datasets (GSE10927, GSE75415, GSE12368, GSE143383); GH) Kaplan-Meier survival analysis of OS and DFS in adrenocortical carcinoma. *P<0.05, **P<0.01, ***P<0.001.

[0047] Figure 4 Immunohistochemical analysis of CENPM protein expression in adrenocortical carcinoma. **P<0.01, ***P<0.001.

[0048] Figure 5 The changes in proliferation, migration and invasion of adrenocortical carcinoma cells after knocking out CENPM in vitro. H295R and SW-13 cells transfected with siCENPM-1 or siCENPM-2. A) Western blot analysis of CENPM protein changes; B) RQ-PCR analysis of CENPM mRNA changes after transfection; C) Colony formation assay; D) Transwell invasion assay; E) Wound healing assay *P<0.05, **P<0.01, ***P<0.001.

[0049] Figure 6 The effect of in vivo knockout of CENPM in adrenocortical carcinoma cells on tumor metastasis. A) Construction of mouse model; B) Bioluminescent imaging of adrenocortical carcinoma xenograft mice; C) Gross image of adrenocortical carcinoma liver metastasis tumor; D) HE staining of adrenocortical carcinoma liver metastasis tumor; E) Ki67 staining of adrenocortical carcinoma liver metastasis tumor. **P<0.01. DETAILED DESCRIPTION

[0050] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0051] In addition, the technical solutions between the various embodiments of the present invention can be combined with each other, but it must be based on the fact that ordinary technicians in the field can implement it. When the combination of technical solutions is contradictory or cannot be implemented, it should be deemed that such combination of technical solutions does not exist and is not within the scope of protection required by the present invention.

[0052] The solution proposed by the present invention is specifically described below through specific embodiments:

[0053] Example 1 WGCNA analysis of weighted gene co-expression network of adrenal tissues of adrenocortical carcinoma patients and healthy subjects, and functional enrichment analysis of “Salmon Red” module genes

[0054] 1. Research subjects

[0055] 77 patients with adrenocortical carcinoma from the TCGA database and 127 healthy people from the GTEx database.

[0056] 2. Experimental Methods

[0057] Weighted Gene Co-expression Network Analysis (WGCNA) is a commonly used systems biology method for analyzing gene expression data based on mathematical models. It can be used to identify highly co-varied gene sets and to identify candidate biomarker genes or therapeutic targets based on the connectivity of gene sets and the association between gene sets and clinical phenotypes.

[0058] The results of RNA sequencing of 77 patients with adrenocortical carcinoma were retrieved from the TCGA database, and the results of RNA sequencing of 127 healthy people were retrieved from the GTEx database. The data were downloaded, and one healthy adrenal specimen with significant differences from other specimens was excluded. The weighted co-expression network of 18,000 genes was analyzed using computer R language. After automatic exclusion, the weighted co-expression network of 12,035 genes was finally analyzed by R language. Gene ontology (GO) functional enrichment analysis and gene set enrichment analysis (GSEA) were performed on the genes of the "Salmon Red" module.

[0059] 3. Experimental results

[0060] The WGCNA results show that 12,035 genes are clustered into 12 functional gene modules. Different gene modules are distinguished by colors, and genes that cannot be clustered are displayed in gray ( Figure 1 AB). The module eigengene of "Salmon Red" has a high proximity to "Cancer" and "Metastasis" ( Figure 1 C). Pearson correlation analysis showed that the "Salmon Red" gene module was significantly positively correlated with the clinical phenotypes of "cancer" (correlation coefficient was 0.70) and "metastasis" (correlation coefficient was 0.41), and was significantly negatively correlated with "survival" (correlation coefficient was -0.49) and "normal" (correlation coefficient was -0.70). Figure 1 D). GS (gene significance) is the significance of the genes in the calculation module and the corresponding clinical phenotype. Module Membership (MM) is the correlation between the eigengene of the module and the gene expression spectrum. The MM-GS correlation scatter plot represents the correlation between MM and GS. When the result is closer to 0, it is considered that the gene module is not related to the clinical phenotype. The closer the result is to 1 or -1, the more we believe that the gene module is highly positively or negatively correlated with the clinical phenotype. The results show that the "Salmon Red" gene module is highly positively correlated with "Cancer" (correlation coefficient is 0.78) and "Metastasis" (correlation coefficient is 0.80) ( Figure 1 EF).

[0061] GO analysis and GSEA analysis of the "Salmon Red" module genes showed that these genes were enriched in the process of "Chromosome Separation" ( Figure 2 AB). In the "Salmon Red" gene module, there are 78 genes that are upregulated in adrenocortical carcinoma and are involved in the chromosome segregation process ( Figure 2 C). The protein interaction network of these 78 molecules was constructed. The largest protein interaction network contained 8 CENP family molecules ( Figure 2 D), CENPM and the other 7 CENP molecules are ranked second ( Figure 2 E), but CENPM is the molecule most associated with poor prognosis among these 8 molecules ( Figure 2 F).

[0062] 4. Experimental conclusion

[0063] CENPM is a key gene regulating adrenocortical carcinoma metastasis.

[0064] Example 2 Analysis of CENPM gene expression in adrenocortical carcinoma and normal adrenal tissue

[0065] 1. Research subjects

[0066] 77 patients with adrenocortical carcinoma from the TCGA database, 127 healthy human adrenal tissues from the GTEx database; four data sets from the GEO database: GSE10927, GSE75415, GSE12368, and GSE143383.

[0067] 2. Research Methods

[0068] The results of RNA sequencing of 77 patients with adrenocortical carcinoma were retrieved from the TCGA database, and the results of RNA sequencing of 127 healthy people were retrieved from the GTEx database. Download the data, analyze the expression difference between adrenocortical carcinoma and healthy people RNA-seq; analyze the expression in different adrenocortical carcinoma stages (ECOG stages); compare the survival difference between patients with high expression of CENPM and those with low expression of CENPM.

[0069] 3. Research Results

[0070] The expression of CENPM in adrenocortical carcinoma is higher than that in healthy human adrenal tissue ( Figure 3 A); the expression level of CENPM in stage IV is higher than that in stages I, II and III ( Figure 3 B). GSE10927, GSE75415, GSE12368, and GSE143383 datasets all show that the expression of CENPM in adrenocortical carcinoma is higher than that in healthy human adrenal tissue ( Figure 3CF). The overall survival and disease-free survival rates of patients with high CENPM expression were lower than those of patients with low CENPM expression ( Figure 3 GH).

[0071] 4. Experimental conclusion

[0072] The CENPM gene is highly expressed in patients with adrenocortical carcinoma and is associated with poor prognosis.

[0073] Example 3: Immunohistochemical analysis of CENPM protein expression in normal adrenal tissue, adrenocortical tumors and patients with different stages of adrenocortical carcinoma

[0074] 1. Research subjects

[0075] Paraffin sections of 13 normal adrenal glands, 13 adrenocortical tumors, and 14 adrenocortical carcinomas.

[0076] 2. Experimental Methods

[0077] Immunohistochemistry was used to detect the expression of CENPM protein in adrenal tissue. The specific steps are as follows: the pathological paraffin sections were placed in a 65°C oven for 2 hours and then dewaxed; the fixed sections were placed in antigen repair solution for 15 minutes; the repaired sections were placed in a 3% H2O2 aqueous solution for 15 minutes to remove endogenous peroxidase; the diluted primary antibody working solution (CENPM antibody, Affinity, 1:50) was added dropwise, incubated at 4°C overnight, the remaining liquid was removed after TBST washing, horseradish peroxidase (HRP)-coupled secondary antibody was added dropwise, incubated at room temperature for 2 hours, and DAB color development solution was used for color development.

[0078] 3. Experimental results

[0079] CENPM protein is highly expressed in patients with adrenocortical carcinoma, and the higher the tumor stage, the higher the expression of CENPM ( Figure 4 ).

[0080] 4. Experimental conclusion

[0081] CENPM protein is highly expressed in patients with adrenocortical carcinoma, and the expression level increases with the tumor stage.

[0082] Example 4: Knockdown of CENPM expression in adrenocortical cancer cell lines and detection of changes in cell proliferation, migration and invasion abilities

[0083] 1. Research subjects

[0084] Adrenocortical carcinoma cell lines H295R and SW-13 were provided by the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

[0085] 2. Experimental Methods

[0086] (1) Cell culture

[0087] H295R cells were cultured in DMEM medium containing F12 medium (DMEM / F12) supplemented with 10% fetal bovine serum (FBS), 0.5% insulin-transferrin-selenium (ITS-G) solution, and 1% penicillin / streptomycin (P / S) solution. SW-13 cells were cultured in Leibovitz L-15 medium containing 10% FBS and 1% penicillin / streptomycin.

[0088] (2) Preparation of small interfering RNA (siRNA)

[0089] The siRNA targeting CENPM was synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd., including 2 siRNA targeting CENPM (siCENPM-1, siCENPM-2) and 1 control siRNA (siNC):

[0090] siCENPM-1:

[0091] sense(5'-3')GGAAGGCUUUAGGCCACCTT,

[0092] antisense(5'-3')GGUGGCCCUAAAGCCUUCCTT;

[0093] siCENPM-2:

[0094] sense(5'-3')GAUCGUGUUUGUGGUUAAUTT,

[0095] antisense(5'-3')AUUAACCACAACACGAUCTT;

[0096] siNC:

[0097] sense(5'-3')UUCUCCGAACGUGUCACGUTT,

[0098] antisense(5'-3')ACGUGACACGUUCGGAGAATT.

[0099] (3) siRNA transfection

[0100] H295R or SW-13 cells were inoculated into 24-well plates to ensure that the cell confluence was 50% after 24 hours. When the cell confluence reached 50%, it was replaced with 500 μl of serum-free medium. The GP-transfect-Mate transfection reagent was placed at room temperature and gently mixed before use; 50 μl of serum-free medium was added to a 1.5 ml sterile centrifuge tube, and 1.5 μl of GP-transfect-Mate transfection reagent (Shanghai Jima) was added, and gently mixed with a pipette, and allowed to stand at room temperature for 5 minutes; at the same time, 50 μl of serum-free medium was added to another 1.5 ml sterile centrifuge tube, and 40 pmol of siCENPM-1 or siCENPM-2 or siNCsiRNA was added, and gently mixed with a pipette, and allowed to stand at room temperature for 5 minutes. The GP-transfect-Mate-medium mixture was added dropwise to the siRNA-medium mixture, and gently mixed with a pipette, and allowed to stand at room temperature for 15-20 minutes, and then transfected immediately. After transfection for 4-6 hours, the complete medium was replaced. After 48 hours, the expression of CENPM mRNA was detected by Q-PCR, and after 72 hours, the expression of CENPM protein was detected by western blot.

[0101] (4) Q-PCR detection of CENPM mRNA expression

[0102] Cell RNA was extracted using the Trizol method, and total mRNA was reverse transcribed into cDNA. The mixture was prepared in the dark with the following proportions: a. SYBR-Green qPCR Mix 10 μl; b. Forward Primer 0.5 μl; c. Reverse Primer 0.5 μl; d. cDNA 2 μl; e. deionized water 7 μl, a total of 20 μl; 3 replicate wells were added to each sample and operated on the machine; reaction procedure: a. 95°C, pre-denaturation for 5 minutes; b. 95°C, denaturation for 15 seconds; c. 60°C, annealing; d. 72°C, extension for 30 seconds; e, b, d, a total of 40 cycles; statistical analysis method: 2 -ΔΔ C t Methods The gene expression levels were converted into fold relationships for data collation and analysis.

[0103] (5) Western blot detection of CENPM protein expression

[0104] Total protein was extracted using RIPA lysis buffer containing cocktail and quantified using BCA protein detection kit. Proteins were separated by SDS-PAGE gel electrophoresis and then transferred to PVDF membrane. The membrane was incubated with CENPM primary antibody (Invitrogen, 1:1000) at 4°C overnight, followed by incubation with the corresponding HRP-conjugated secondary antibody for 1 hour at room temperature. Protein signals were detected using Gelview 1500pro (BLT).

[0105] (6) Cell proliferation, migration and invasion assays

[0106] Cell proliferation was detected using a colony formation assay. 72 h after siRNA transfection, 1000 cells were seeded in each well of a 6-well plate and cultured for approximately 20 days. Colonies were stained with crystal violet solution. Cell migration was assessed using a wound healing assay. 72 h after siRNA transfection, cells were incubated in PBS for 10 min, the wound was scratched with a 100 μL pipette tip, and cultured in medium containing 2% FBS for 72 h. Cell invasion was assessed using a transwell invasion assay. The transfected cells were placed in the upper layer of a Matrigel chamber in serum-free medium, and medium containing 25% FBS was placed in the lower layer.

[0107] 3. Experimental results

[0108] Knockdown of CENPM inhibited the expression of CENPM mRNA and protein levels in H295R and SW-13 cells ( Figure 5 AB). Knockdown of CENPM inhibited the colony formation of H295R and SW-13 cells ( Figure 5 C), cell invasion ( Figure 5 D) and cell migration ( Figure 5 E).

[0109] 4. Experimental conclusion

[0110] Knockdown of CENPM inhibited the proliferation, invasion and migration of adrenocortical carcinoma cells.

[0111] Example 5: Knockdown of CENPM expression in adrenocortical cancer cell lines and detection of changes in the metastatic ability of adrenocortical cancer in xenograft mice

[0112] 1. Research subjects

[0113] Six 4-week-old male NPG mice were purchased from Beijing Weitongda Biotechnology Co., Ltd.

[0114] 2. Experimental Methods

[0115] (1) Construction of recombinant lentivirus

[0116] Recombinant LV-luciferase-shCENPM-Puro and LV-luciferase-shScramble-Puro (negative control) lentiviruses were synthesized by Shanghai Jima Biotechnology Co., Ltd.

[0117] Sequence of shCENPM: GGAAGGCTTTAGGGCCACC;

[0118] Sequence of shScramble: TTCTCCGAACGTGTCACGT

[0119] (2) Lentivirus infection and screening of stable transfected strains

[0120] SW-13 cells were cultured at 2.0 × 10 5 The cells were seeded in 6-well plates at a density of 10 cells / mL. When the cells were 50% confluent, the cells were infected with recombinant lentivirus diluted in serum-free medium in the presence of 5 μg / mL polybrene (GenePharma, Co., Ltd, China) at an MOI of 20. After 24 h of incubation, the medium was replaced with complete growth medium containing 10% FBS. Stable clones were selected with 1.0 mg / ml puromycin for 10-14 days.

[0121] (3) Construction of xenograft mouse model

[0122] The mice were divided into two groups: LV-shCENPM and negative control. Each mouse was injected intravenously via the tail vein with 2×10 6 SW-13 cells stably transfected with LV-luciferase-shCENPM-Puro or LV-luciferase-shScramble-Puro were used. 28 days after injection, mice were intraperitoneally injected with D-luciferin sodium salt (Meilun Biotech). 20 minutes after injection, mice were anesthetized with isoflurane and imaged using a small animal in vivo imaging system (PerkinElmer). Afterwards, mice were sacrificed and vital organs such as liver, lung, spleen, and kidney were dissected.

[0123] (4) HE staining

[0124] HE staining of liver tissue, the specific steps are as follows: ① dewaxing: xylene 10min--xylene 10min--anhydrous ethanol 5min--anhydrous ethanol 5min--95% ethanol 5min--85% ethanol 5min--70% ethanol 5min--pure water 5min; ② staining: hematoxylin 4min--tap water rinse 10min--hydrochloric acid ethanol differentiation 3s--tap water rinse 10min (return to blue)--eosin 25s~1min; ③ dehydration: anhydrous ethanol 5min--anhydrous ethanol 5min--anhydrous ethanol 5min; ④ permeabilization: xylene 10min-xylene 10min-xylene 10min; ⑤ sealing: after sealing with neutral resin, let it dry naturally and then place it under a microscope for observation.

[0125] (5)Ki-67 staining

[0126] The pathological paraffin sections were placed in a 65°C oven for 2 hours and then dewaxed; the fixed sections were placed in an antigen retrieval solution for 15 minutes; the repaired sections were placed in a 3% H2O2 aqueous solution for 15 minutes to remove endogenous peroxidase; diluted Ki-67 antibody was added, incubated at 4°C overnight, the remaining liquid was removed after TBST washing, horseradish peroxidase (HRP)-coupled secondary antibody was added, incubated at room temperature for 2 hours, and DAB color developing solution was used for color development.

[0127] 3. Experimental results

[0128] The mouse adrenocortical carcinoma metastasis model was successfully established by injecting SW-13 cells into the tail vein of NPG mice ( Figure 6 A). 28 days after the tail vein injection of SW-13 cells with normal CENPM, strong bioluminescence was observed in the right upper abdomen of mice, indicating that there were a large number of adrenocortical cancer cells there. However, after the tail vein injection of SW-13 cells with knockdown of CENPM, there was no obvious bioluminescence in the right upper abdomen of mice, indicating that there were no adrenocortical cancer cells there. ( Figure 6 B). 28 days after the tail vein injection of SW-13 cells with normal CENPM, mice had more adrenocortical carcinoma metastases in the liver. However, after intravenous injection of SW-13 cells with knockdown of CENPM, the number of adrenocortical carcinoma metastases in the liver was significantly reduced ( Figure 6 C, Figure 6 D). The expression of Ki-67 in the adrenocortical carcinoma metastasis of SW-13 cells with normal CENPM injected by tail vein was higher, indicating that the adrenocortical carcinoma cells had stronger proliferation ability, while the expression of Ki-67 in the adrenocortical carcinoma metastasis of SW-13 cells with knockdown of CENPM injected by tail vein was lower, indicating that the adrenocortical carcinoma cells had weaker proliferation ability ( Figure 6 D).

[0129] 4. Experimental conclusion

[0130] Knockdown of CENPM inhibited adrenocortical carcinoma liver metastasis in mice.

[0131] It should be noted that, in this article, the terms "include", "comprises" or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, an element defined by the sentence "comprises a ..." does not exclude the existence of other identical elements in the process, method, article or device including the element.

[0132] The serial numbers of the above embodiments of the present invention are only for description and do not represent the advantages or disadvantages of the embodiments.

[0133] The above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, which should be included in the scope of the claims of the present invention.

Claims

1. Use of CENPM gene and / or its encoded protein as a target in the preparation of a drug for treating adrenocortical carcinoma or metastatic adrenocortical carcinoma.

2. The use according to claim 1, characterized in that: The application is to inhibit the expression of CENPM gene or inhibit the function of protein encoded by CENPM gene.

3. The use according to claim 2, characterized in that: Inhibit the expression of CENPM gene or inhibit the function of the protein encoded by CENPM gene through RNA interference technology or gene editing technology; or inhibit the expression of CENPM gene or inhibit the function of the protein encoded by CENPM gene through antisense nucleotide drugs or antibody drugs.

4. Use of the CENPM gene and / or its encoded protein as a marker in the preparation of a product for diagnosing adrenocortical carcinoma or metastatic adrenocortical carcinoma.

5. The use according to claim 4, characterized in that: The product includes a reagent, a kit or a chip for detecting the activity of the CENPM gene or the protein encoded by the CENPM gene.

6. The use according to claim 4, characterized in that: The expression level of the marker is positively correlated with adrenocortical carcinoma or metastatic adrenocortical carcinoma.

7. Use of the CENPM gene and / or its encoded protein as a marker in the preparation of a product for assessing the severity of adrenocortical carcinoma or a prognostic product; or use of the CENPM gene and / or its encoded protein as a marker in the preparation of a product for assessing the severity of adrenocortical carcinoma or a prognostic product.

8. Use of an agent for inhibiting the expression of CENPM gene and / or inhibiting the protein encoded by CENPM gene in the preparation of a drug for treating adrenocortical carcinoma.

9. A drug for treating adrenocortical carcinoma or metastatic adrenocortical carcinoma, characterized in that: The drugs are: 1) siRNA to knock down CENPM gene expression; 2) DNA or RNA that blocks the expression or transcription of CENPM-encoded proteins; 3) Inhibitors against CENPM encoded proteins, including small molecule compounds, antibody drugs, proteins, nucleic acid molecules, polypeptides, lipids, carbohydrates or combinations thereof.

10. The drug according to claim 9, characterized in that The sequence of the siRNA for knocking out CENPM gene expression includes at least one of the following: siCENPM-1: sense(5'-3')GGAAGGCUUUAGGCCACCTT, antisense(5'-3')GGUGGCCCUAAAGCCUUCCTT; siCENPM-2: sense(5'-3')GAUCGUGUUUGUGGUUAAUTT, antisense(5'-3')AUUAACCACAACACGAUCTT.

Images