Population tracing SNP (Single Nucleotide Polymorphism) molecular marker for bean

Abstract

The invention discloses a bean weevil population traceability SNP molecular marker and application thereof. By re-sequencing genomes of population samples with different geographical sources of the bean weevil, the SNP marker and the corresponding detection primer which can be used for tracing ten populations, namely EsecRussian, Luwenda, Bhuji, Karamon, Congo, Uganda, Angora, German and Chile, of the bean weevil are developed. The SNP marker can be used for tracing ten populations of Guizhou, Yunnan and overseas. The population tracing SNP marker site is good in genetic stability and reliable in detection result, the affiliation and the source of the detected population can be accurately judged according to a peak map obtained after amplification of a detection site amplification primer, the population source of the intercepted bean weevil can be clearly determined, and international agricultural product trade and national ecological and agricultural safety are guaranteed.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology detection technology, and in particular to a SNP molecular marker technology used for tracing the origin of bean weevils population and its application. Background Art

[0002] At present, the main focus of molecular routine identification of quarantine pests and diseases at home and abroad is on species identification, while there is a lack of accurate and rapid detection technology for the identification of genetic differentiation characteristics of geographical populations within species (infraspecific units). It is worth noting that for the same biological species, due to long-term geographical division, the intraspecific genetic differentiation will produce genetic differences under the corresponding ecological background conditions (such as biotypes and geographical populations). On the other hand, the encounter of different infraspecific units (biotypes and geographical types, etc.) may produce hybrid dominant populations with stronger ecological adaptability than the original geographical populations themselves, and generate new harmful potential. Therefore, the implementation of species identification at the species level cannot accurately identify the genetic differentiation characteristics of geographical populations of species. It is necessary to develop molecular detection and identification technology at the infraspecific level that can be used for the identification of genetic backgrounds of different geographical species, so as to accurately trace and track their sources of transmission, and help solve the problem of traceability of quarantine pests in international trade.

[0003] Phaseolus vulgaris Acanthoscelidesobtectus (Say) It belongs to the order Coleoptera and the family Fabaceae. Its larvae bore into the seeds of more than 40 legume crops, including beans, cowpeas, mung beans, adzuki beans, chickpeas, and peas, causing them to lose their commodity value and affecting global legume trade and food security.

[0004] There are four existing technologies similar to the present invention: (1) simplified genome sequencing and analysis, (2) detection and analysis of specific barcode gene fragments (mitochondrial and nuclear genes, etc.), (3) microsatellite (SSR) molecular markers and analysis, and (4) SNP molecular marker technology. The first three technologies have obvious deficiencies in population traceability detection, while the use of SNP molecular markers is mainly used in medical disease diagnosis, molecular markers of agricultural breeding traits, and molecular markers for meat traceability in food. At present, there is no corresponding technology and application for the development of SNP molecular markers for quarantine pest population traceability.

[0005] (1) Simplifying genome sequencing and analysis This technology integrates and analyzes the genetic differentiation characteristics and sources of variation among populations at the genome level by simplifying the genome sequencing of samples from populations of different sources, such as the strain typing and transmission source analysis of the new coronavirus (covid-19) based on the genome sequence, and the study of the rapid expansion mechanism of the invasive weed Mikania micrantha (Liu, Bo; Yan, Jian; Li, Weihua et al. Mikaniamicrantha genome provides insights into the molecular mechanism of rapid growth. Nature Communications, 2020, 11(1). DOI:10.1038 / s41467-019-13926-4). The advantage of this technology is that the population typing information is comprehensive and accurate. However, this technology requires the use of second-generation (library construction) or third-generation sequencing technology to sequence and analyze population samples, which is labor-intensive, costly, and time-consuming. It is especially not suitable for routine detection of species with large genome data such as port insects. It is difficult to determine the population source under the condition of a single population sample.

[0006] (2) Detection and analysis of specific barcoded gene fragments (mitochondrial and nuclear genes, etc.) Barcode gene fragments are mainly used as molecular markers for species identification and can also be used as a preliminary analysis of the genetic structure of a population, such as the analysis of the genetic structure of geographic populations of Acanthoscelides obtectus Say based on the mitochondrial CO1 gene (Oliveira M RC, Correˆa AS, Souza GA d, Guedes RNC, Oliveira LO D. 2013. Mesoamerican Origin and Pre- and Post-Columbian Expansions of the Ranges of Acanthoscelides obtectus Say, a Cosmopolitan Insect Pest of the Common Bean. PLoS ONE 8(7): e70039) (doi:10.1371 / journal.pone.0070039). However, due to the relative conservatism of barcode sequences and the very limited information they can reflect on the diversity of genetic differentiation of populations, as well as the poor stability of variable marker sites, barcode sequences are not suitable as molecular markers for tracing the origin of specific populations.

[0007] (3) Microsatellite (SSR) molecular markers and analysis Microsatellite markers, also known as short tandem repeats (STRs) or simple sequence repeats (SSRs), are simple repeat sequences uniformly distributed in the genome of eukaryotes. They are composed of tandem repeat fragments of 2 to 6 nucleotides. Since the number of repetitions of the repeating units shows high variability and abundance among individuals, microsatellite markers are widely used in population genetic molecular markers. Microsatellite loci are usually amplified by PCR, and the amplified products are analyzed by electrophoresis and alleles are separated according to size for detection. However, microsatellites as molecular markers of genetic variability also have poor stability and lack of reliable molecular markers for specific populations. Conventional detection requires the collection of a large number of population samples, and the origin of the population cannot be determined under single sample conditions. In addition, the reliability of detecting the difference of alleles through electrophoresis patterns is poor.

[0008] (4) SNP molecular markers and detection SNP (Single Nucleotide Polymorphism) molecular marker technology, the so-called SNP refers to the DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level. This variation may appear in the form of a single base conversion (such as C←→T) or a transversion (such as C←→A), or it may be caused by the insertion or deletion of a base. SNP is widely used in many fields such as biology, medicine, and agriculture. In the medical field, SNP research helps to locate, clone, and identify disease genes, and can be used for disease diagnosis and prediction of pathogenic risks, as well as pharmacogenomics and the discovery of new drugs. In the agricultural field, SNP analysis can help breeders better understand the genetic diversity of crops and accelerate the cultivation of excellent varieties. In the food field, the use of SNP molecular markers can be used to trace the variety of meat sold.

[0009] In the field of plant quarantine, SNP molecular markers have not yet been used to trace the population of quarantine pests. Since the detection and application of SNP molecular markers are not universal, specific SNP molecular marker technology needs to be developed and established by screening genome data for specific species research objects. Summary of the invention

[0010] In view of the shortcomings of the above-mentioned existing population tracing technology, the present invention develops a group of Phaseolus vulgaris ( Acanthoscelidesobtectus) Population tracing SNP molecular markers were developed and applied. By resequencing the genomes of samples from populations of different geographical origins of the Phaseolus vulgaris, specific SNP molecular tracing markers for different geographical populations of the Phaseolus vulgaris were developed from the comparative analysis of genome sequence data. These markers serve as identification marks for the origins of their specific geographical populations, thus forming a detection method that can be applied to population tracing.

[0011] The present invention provides SNP markers for tracing the origins of 10 populations of Phaseolus vulgaris in Guizhou and Yunnan as well as overseas in Ethiopia, Rwanda, Burundi, Cameroon, Congo, Uganda, Angola, Germany and Chile and corresponding amplification primers for detection. The population tracing SNP marker sites developed by the present invention have good genetic stability and reliable detection results. The peak graph obtained after amplification using the SNP marker site amplification primers in the detection process can accurately determine the ownership and origin of the detected population.

[0012] The present invention provides a population tracing SNP molecular marker for Phaseolus vulgaris, which includes one or more of the following molecular markers: The traceability SNP site for the German population is T at the 546923rd base position on the reference genome chromosome CAVLJG010001675.1 of the Phaseolus vulgaris. The traceability SNP molecular marker for the German population at this site is G. The traceability SNP site for the Guizhou population is G at the 48615734th base position on the reference genome chromosome CAVLJG010000007.1 of the Phaseolus vulgaris. The traceability SNP molecular marker for the Guizhou population at this site is A. For the traceability SNP site of the Ethiopian population, the 44479353th base position on the reference genome chromosome CAVLJG010000003.1 of the Phaseolus vulgaris is A, and the traceability SNP molecular marker of the Ethiopian population at this site is G; The traceability SNP site for the Angolan population is A at the 29220510th base position on the reference genome chromosome CAVLJG010000006.1 of Phaseolus vulgaris, and the traceability SNP molecular marker for the Angolan population at this site is G; For the traceability SNP site of the Yunnan population, the 20116048th base position on the reference genome chromosome CAVLJG010000002.1 of Phaseolus vulgaris is C, and the traceability SNP molecular marker of the Yunnan population at this site is A; For the traceability SNP site of the Chilean population, the 76234th base position on the reference genome chromosome CAVLJG010000001.1 of Phaseolus vulgaris is T, and the traceability SNP molecular marker of the Chilean population at this site is A; The traceability SNP site for the Cameroon population is T at the 110012864th base position on the reference genome chromosome CAVLJG010000003.1 of Phaseolus vulgaris, and the traceability SNP molecular marker of the Cameroon population at this site is A; For the traceability SNP site of the Ugandan population, the 23872448th base position on the reference genome chromosome CAVLJG010000008.1 of Phaseolus vulgaris is G, and the traceability SNP molecular marker of the Ugandan population at this site is T; The traceability SNP site for the Burundi population is A at the 39379808th base position on the reference genome chromosome CAVLJG010000004.1 of Phaseolus vulgaris, and the traceability SNP molecular marker of the Burundi population at this site is G; The 92046044th base position of the traceability SNP site for the Congolese population on the reference genome chromosome CAVLJG010000005.1 of the Phaseolus vulgaris is A, and the traceability SNP molecular marker of the Congolese population at this site is C.

[0013] The present invention also provides detection primers for detecting the SNP molecular markers for tracing the bean weevil population.

[0014] Specifically, it includes one or more pairs of the following primers: The detection primers for the traceability SNP locus molecular markers of the German population are GER-6923-F / GER-6923-R, the forward primer sequence is TTAGAATGATTGATGACCGGGTG, and the reverse primer sequence is ACCATAGAAAGGCATCTTCAAGC; The detection primers for the traceability SNP site molecular markers of the Guizhou population are GZ-5734-F / GZ-5734-R, the forward primer sequence is AACATGAAGGACATTACCGAGTC, and the reverse primer sequence is TAACCAAGATATCCGACGCTTTC; The detection primers for the traceability SNP locus molecular marker G for the Ethiopian population are 9353-F / 9353-R, the forward primer sequence is CTTCTCCCACTCCCAGTCTC, and the reverse primer sequence is Gacaaatccgtggtgggaac; The detection primers for the traceability SNP locus molecular markers of the Angolan population are 0510-F / 0510a-R, the forward primer sequence is TATCCCCACTAGGTCGTTGAAG, and the reverse primer sequence is AGTGCATCACTTGGTCATAACG; The detection primers for the traceability SNP site molecular markers of the Yunnan population are 6048-F / 6048-R, the forward primer sequence is ACACGGGTGAAAACAACTGG, and the reverse primer sequence is TCATCGGCTTGTTGCTATGG; The detection primers for the traceability SNP locus molecular markers of the Chilean population are 6234-F / 6234-R, the forward primer sequence is GCCAATTCCTGAAACCCTATCC, and the reverse primer sequence is ttAAATGCGCCCCAAAATTTGC; The detection primers for the traceability SNP locus molecular markers of the Cameroon population are 2864-F / 2864-R, the forward primer sequence is tgttggcctgtaaacgaagc, and the reverse primer sequence is ACCTAATGCTCAATGCGCTG; The detection primers for the traceability SNP locus molecular markers of the Ugandan population are 2448-F / 2448-R, the forward primer sequence is TCTATTTTGTCGGTGCACAGC, and the reverse primer sequence is ATCAGATCCCTCTTTGGCCC; The detection primers for the traceability SNP site molecular marker of the Burundi population are 9808-F / 9808-R, the forward primer sequence is TAAGCTTGTAGCCCCATCCC, and the reverse primer sequence is AGATGCACTGTGTAATCGGC; The detection primers for the traceability SNP site molecular marker for the Congolese population are 6044-F / 6044-R, the forward primer sequence is aacagGATACCTACTCCCTGAC, and the reverse primer sequence is atcgTCTTGTGTGTAAAAGGGC.

[0015] The present invention provides application of the Phaseolus vulgaris population tracing SNP molecular marker in the detection of the geographical population tracing of Phaseolus vulgaris.

[0016] The present invention also provides the application of the detection primer in the detection of geographical population tracing of Phaseolus vulgaris.

[0017] The present invention further provides a method for tracing the bean weevil population using a bean weevil population tracing SNP molecular marker, which comprises the following steps: extracting genomic DNA from a single head of a bean weevil sample, and amplifying it with the detection primers described in any one of claims 2 or 3; sequencing or amplifying the peak graph according to the amplified product, and determining the origin of the population to be tested by referring to the genotype of a specific population tracing site; The population of Phaseolus vulgaris is from Guizhou, Ethiopia, Rwanda, Burundi, Cameroon, Congo, Uganda, Angola, Germany or Chile.

[0018] Among them, the method of extracting genomic DNA from a single head of the bean weevil sample was carried out using a kit suitable for extracting trace samples.

[0019] In a specific implementation manner, the amplification conditions are: pre-denaturation at 94°C for 4 minutes before cycling; denaturation at 94°C for 30 seconds, annealing at 50°C-58°C (depending on the specific primers) for 30 seconds, extension at 72°C for 45 seconds, 36 cycles, and finally extension at 72°C for 10 minutes, the system temperature is reduced to 12°C, and the PCR amplification is terminated.

[0020] Specifically, the amplification system is prepared in 25 µL. If the concentration of the genomic DNA template is adjusted to no less than 0.4 ng / µL, the amounts of the upstream primer and the downstream primer are 0.24 mmol / L, respectively.

[0021] In a specific embodiment, in the method for tracing the bean weevil population, the amplification product is used to amplify the target detection sequence of the bean weevil population sample by one or more primers. Use SnapGene to open the ab1 sequencing file, find the flanking sequence of the SNP, determine the target region on the sequencing peak graph based on the flanking sequence of the SNP (generally 10bp), and determine the source of the sample based on the SNP type; the specific judgment criteria are as follows: According to the SNP traceability site amplification peak diagram obtained by primers GER-6923-F / GER-6923-R, the traceability SNP genotype of the German population is GG, while the genotypes of Ethiopia, Angola, Burundi, Congo, Guizhou, Cameroon, Rwanda, Uganda, Yunnan and Chile are all TT; According to the SNP traceability site amplification peak graph obtained by primer 6048-F / 6048-R, the traceability SNP genotype of the Yunnan population is AA, while the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda and Chile are all CC or AC; According to the SNP traceability site amplification peak diagram obtained by primers GZ-5734-F / GZ-5734-R, the traceability SNP genotype of the Guizhou population is AA, while the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Cameroon, Uganda, Yunnan and Chile are all GG; According to the SNP traceability site amplification peak graph obtained by primers 9353-F / 9353-R, the traceability SNP genotype of the Ethiopian population is GG, while the genotypes of Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA; According to the SNP traceability site amplification peak graph obtained by primers 0510-F / 0510a-R, the traceability SNP genotype of the Angolan population is GG, while the genotypes of Ethiopia, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA; According to the SNP traceability site amplification peak diagram obtained by primers 9808-F / 9808-R, the traceability SNP genotype of the Burundi population is GG, while the genotypes of Ethiopia, Angola, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA; According to the SNP traceability site amplification peak graph obtained by primer 6044-F / 6044-R, the traceability SNP genotype of the Congolese population is CC, while the genotypes of Ethiopia, Angola, Burundi, Germany, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA; According to the SNP traceability site amplification peak diagram obtained by primers 2864-F / 2864-R, the traceability SNP genotype of the Cameroon population is AT, while the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Uganda, Yunnan and Chile are all TT; According to the SNP traceability site amplification peak diagram obtained by primer 2448-F / 2448-R, the traceability SNP genotype of the Ugandan population is TT, while the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Yunnan and Chile are all GG; According to the SNP tracing site amplification peak graph obtained by primers 6234-F / 6234-R, the tracing SNP genotype of the Chilean population is AA, while the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda and Yunnan are all TT.

[0022] Beneficial effects achieved by the present invention: The population traceability SNP sites of Phaseolus vulgaris established in the present invention are obtained based on screening in the whole genome sequence. Its technical advantage lies in the richer quantity and quality of SNP sites for screening, which can fully meet the reliability and stability of the marker sites, thereby ensuring the quality of the test results.

[0023] The population tracing SNP site detection established by the present invention is simple, convenient and practical. Since the SNP molecular marker is a single site for each target population, no multi-site combination marker is required, which greatly saves the detection workload and makes the application detection fast and simple.

[0024] The population tracing SNP sites of the present invention are obtained based on the screening of genome sequence variation sites, the population tracing SNP candidate screening sites are more abundant, the sites that can be selected are more stable and reliable, and the quality of the detection results can be effectively guaranteed. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the SNP tracing site identification map of the German population of Phaseolus vulgaris; Figure 2 This is the SNP tracing site identification map of the Yunnan population of Phaseolus vulgaris; Figure 3 This is the SNP tracing site identification map of the Guizhou population of Phaseolus vulgaris; Figure 4 This is the SNP tracing site identification map of the Ethiopian population of Phaseolus vulgaris; Figure 5 This is the SNP tracing site identification map of the Angola population of Phaseolus vulgaris; Figure 6 This is the SNP tracing site identification map of the Burundi population of Phaseolus vulgaris; Figure 7 This is the SNP tracing site identification map of the Congo population of Phaseolus vulgaris; Figure 8 This is the SNP tracing site identification map of the Cameroon population of Phaseolus vulgaris; Fig. 9 This is the SNP tracing site identification map of the Ugandan population of Phaseolus vulgaris; Fig.10 This is the SNP tracing site identification map of the Chilean population of Phaseolus vulgaris. DETAILED DESCRIPTION

[0026] The present invention is further described below in conjunction with specific embodiments, but the present invention is not limited by the embodiments.

[0027] Unless otherwise specified, the experimental materials, reagents, instruments and methods used in the following examples are conventional experimental materials, reagents, instruments and methods in the art and can be purchased through commercial channels.

[0028] Example 1: Mining of SNP molecular markers for tracing the population of Phaseolus vulgaris The following population-specific sequences were obtained by screening and analyzing the whole genome sequence of Phaseolus vulgaris populations: 1. Ethiopian population >CAVLJG010000003.1_44479353-44479353:._us:400_ds:400CAVLJG010000003.1_44479353_A_G ttagttttgtataaatctcagtataaatatataaaatataaatatacagcTCTATGCATTCCTTGCTTTCCTATTACTATCAGTCTCGTTCCTAACACCGTTTCTTGCCTCTGTAGAAGGTGTTTCCACCTTCTCCCACTCCCAGTCTCCATCTAGAGGTACTTCGTTTTCGAAATCGAAATTCCATTTCTCAGCTGCTCTCTTCCTTTCAGCCTATGAAATCATGAATTTGTTAATAGTcatccaaaataaaaaaaaacatagctaAAAGCCTTATTTTGATATCTCAAAGATATCCTAAACAGCAATTGAATCAGGCAAAccgtaagagatacgaagtcagtTAAATAGTGGCAAAAGGACAACAAAATTTTTGCCcgactttatttgtggtgggatt[a / g]taaaataaattgcattatAACAATGCAACTTTTTCTCCTCTCCAAAacggcataatcagaatttcaatataacgtttcgACTCTTGTTCTCAATCGGTAACTTTACTTTTTCTAATGGACGCTAAAATTTACAGGGCTAAATGCAGTTTTTGcctctgatttcaaaaatttacaacttatcatacagggtgtttatttgaaaagttcccaccacggatttgtCGAAAATCACTGATTAGAaggaaaaacgccgagacacgtgaAAAGATTTAACTTTAACCGAAGACTACTCCACCCAGTTTCACCCTCTGCAcgccagggtcattcccttaaaaatcttaaatgacaaggggtaacGAGAAATAGCTTGTTTAAAAGGTCTTTCGATGTCCTTCATTTT。

[0029] 2. Angola >CAVLJG010000006.1_29220510-29220510:._us:400_ds:400CAVLJG010000006.1_29220510_A_G TCCATCTCTAAAATTGACGGGGTCTTATTTCTGATTCAACCCTCGTAATATGCCTCAGAATTATAACAAATTTTGATGTATCTTACCTAAGAGGGTATGCCAATCAAATTTCACATCCATTCTGTTCTTTATCCCCACTAGGTCGTTGAAGTATACGTTTAATATACTGCTATCGTTGGTTACTTTCACATCAGCactgaaacatttaaaaaaatacaatgcAGACCTTCTACTATGACTCAGATGTGAGTATAAAGGTATATCACATTCAAATGCAACATTTCTGATAGCCGGTTGCTGCTGAATCAAATCAAAGAATACCCATTTCCAAACTTCAATAGATCTAAATTTTAAACAAGTCTTTTAAAAGTTACAATGTTAACAGTTGCAAACACAATAC[A / G]ATCTTGCCACTAGCCTAACCAGTGTTACCTGccatattataattattattattattattattagatgtgTTGCTAACTATATGTCCAAGGGTTTGAGAATTAAAGGTACTCACTATGCATTGCTTCTGATGTACTTGAAGTTCAATACTCCAGCCGAGCTTTCGGCATAGTACTCCGTAGATTCGCAGTCTGGCAGACATCCACATGCCCTTCCAGTTACTTTCTCCAGCGTCGTGAAATCTTTCGATGTAACGTTATGACCAAGTGATGCACTGATCAATAACTCTTCAAGGAAAAAACTTATTGTTACATAACGTCCCTTAAATCCACATATAAAACTCCCTCATTCTTGGTGAGACTCGTTATTACGGTACAGGCATTGAACAACATATGGAAACCT。

[0030] 3. Burundi >CAVLJG010000004.1_39379808-39379808:._us:400_ds:400CAVLJG010000004.1_39379808_A_G TGGTTGTTTTAGGTGATTCGATTCAATGGTTTTGATCCTGGCCTGTCATAACACatccaaaaaatggcgtcaggtaggcTGACTCACATAAAGGGAATCTGTAATGCTAAGCTTGTAGCCCCATCCCTGGGATATACTCCGAACTTTTTATAGAGTCTATACGAACTGTTATAAAACCCTTTAAAAATATAGAATACCTTTGGGCTTCCCCCTTACACTGTGGAGCTAAATTTgatttgaatattcaaatgaTACAAGATATTTTAAGTAAAATGAGGCTCAACCTAAttttatttctaaaatgtttatttttttaatacaatacataaaaatacCTGTTATTCAAGTTGTTTGTAATCTAAAAATAATCGGTATTACCGATGTACCGTGTAAATTTACA[A / G]TTGGCAATTTCTCTACATGAGTTTCGGGACTATCTAAACATTTTCCGAAACCATACCTAAAAAAAGAAttgaatttcattatttttatgcTAGGTAAATTTTTCCAAAGATTGTGCAAACCgtaaatactgtcaaagtttttAGGACACCAAAATATTCGAATCATTTAATCCTGATTATTCGCCGATTACACAGTGCATCTACCTGATTTATATACATATGTGATAAAAGTTATTACTTACTTGAAGATTGAAGTTCAGGAAGATGTAATGTGAGGCAAGCAGTTCATTTCAGGCCTCTCTTCGTTCCAGGCACTTTATCACGCACCACATGTCCTATATAAATTTATTCGTGACTTTTATTGTCCAAAACTGGATTTCGCTCTTGCTGGATCCATTTG。

[0031] 4, Germany >CAVLJG010001675.1_546923-546923:._us:300_ds:300 CAVLJG010001675.1_546923_T_G TTCTTGCATTTTGCAAAAAGACTCATGATTAATCGAAATGAAATTTTTGTGTTATGCTGATGCAGACTGATCTGGAAACAGTGCGGTGTGGCAGCGTTGTAATTATTTAGAATGATTGATGACCGGGTGACACAAGAATGAAGTTGGATTGTTTTTTTCGGGAAGTGAAAAATGATGTTTAGGTTTAAGTATTCATAATCGCTGCGCCTGTTTAATTAAGAGCTAGGTGATTAGTTCGTGTTTTTCCCCTCTGAACTTTTGGTCCTCCAAATGAAAAAGACCGCAGTTTTATTTTCGCTT[T / G]GCCGCAAAATTGGACAGAAGAATCACTCTTTTCGCAACACCGAGATTTTATGGTAGATCCAAAATCCAACAGAATGATAAAGGCAGGAATATTGACTTAGCTAGGTTTAAGATAAAATTTGCAATTATAAAAGAATGTGTCTGTACAGACAGTAAAATTCAACTTCAAATTCTTATAAACCAATCTTGAGCTTGAAGATGCCTTTCTATGGTATAAAAAATtcgtaacgtatgtcctaaaagttttgacacaaagtatttatctgatttttttaaatgaagaaatttattcaaACACTAA。

[0032] 5. Congo >CAVLJG010000005.1_92046044-92046044:._us:400_ds:400CAVLJG010000005.1_92046044_A_C GTACTGGAGATGGTTACCATTGTGGCTGAAACATATACGTTAAAGAAGAATTCCAAATATATGTAATTTCATTGGCCAGACAAACGTGCGGGATTATCAATATGAAAACCTAAGGaaaagtttcagatgttacattacccTGAATCATACTCGTATATCAATTATAAaactaaaattattcaaaaaacagGATACCTACTCCCTGACTTTGACATATGACTGACATGTTTCTGTTGATTTCAGCATATTAATTTTCTCTCCTCCGACTATTGTTTTGAATAGATAAATAAGAAACATTTCTCTGcagatatcaaattattactCAGCAATTAATAAGAATtataaaatattactatttttttctttaaaagtaTTTAACCCAAATCCCACATCATGAACA[A / C]CACTGGAGAAGAAAAAACAGGTATACATCAGAAAGTTGTTTCTTAATACATTCTAGCCATGTAtcgatttttattaaaatttttaagagtAATATAGATATTATAAAAAGGTTTTCAAAACTTTATCCTCATGGTTCTAAAATACTTGAACtgatgaaacaccctgtatattatccaTGTCTAGTCCCTAGTCAAACTTTCACGTCAATAATATCTGATGTTTTTTCTGTGATGGTGCAAgaattatagtttatatttaactaGTTAGCCCTTTTACACACAAGAcgattactccgaaaattatggtcataattctgctgaaaatttgcatggaaaaaatattgaagattttgtCTACAAccagtatgacacaagcaaacaaaatttcccagtaattcat。

[0033] 6, Guizhou >CAVLJG010000007.1_48615734-48615734:._us:300_ds:300CAVLJG010000007.1_48615734_G_A TGCTTCAAAATTTTAGTCTGTTCAGCGCTTCAATGATGTGGAAGATTGCATTTATAAAACCATGGTTATACAAAATCTTGAGTTtcttattttgagaaaaatacgCATTTTTTGACGCACcttatctttaattttgaatacaTCGCTCAATTTAGAAACCACCTTTAACATGAAGGACATTACCGAGTCCTAATTCTTTTGGAGATAGATCTACATGAAGCAATTTCTGCTTGTTCTAGAACATTACATTTCCATGAATTTTCTAAACCTTTGCAGGTGCAGCTTAAAACGTTCATTAAT[G / A]TGATTCCCTACCAGGACTGCCGTAACGTCAATAAAGTAATTTGTTTAAAGAGAAACATAATGCAGTAATGGATCTAAACATGTATGTCTAATGGAATGTCGACCCCTGACTTTCGGTGCAGTTGTTATCCATCTGATAAATGTGGCATATCTTTGTACAAAAGCAGGTTAGGCCCTCAGCCACAATCGGGACGATTTTGCCAGTTTCCAGGTGAACTACTATTTTGTCATGACGGGCGTAGCTAAGCTTTCGTAAAATCGTAAAGATATTGTGAAAGCGTCGGATATCTTGGTTATTCGT。

[0034] 7, Cameroon >CAVLJG010000003.1_110012864-110012864:._us:500_ds:500CAVLJG010000003.1_110012864_T_A

[0035] 8. Uganda >CAVLJG010000008.1_23872448-23872448:._us:400_ds:400CAVLJG010000008.1_23872448_G_T TTCATctcttatatttttttggacGTTCAAATACGAGGTTGGTTATCTCCAGCTAAAATGCGTTAATCAATTATCGTATCTATTTGTCGGTGCACAGCGATAAgcaatgagaaaaaaattaaaggtgGCTCACCGACCCGCATTCCAGGAGTAACGGAGCACTAGTTCAAAACAATTGGACATGTACCTTGcccaaattaaaaataatgcaATAACTCCTGAACCGCGATGGCGCCATTTTCCAGCCGGCATATATCACTGGCCGAAATTAGGTATCAGACGTTAATGAAAGCTTAGCCTTGGAAATCCCGGCCTAAGCCTAGGGGAGGGGGTATTATGCAAGTGGGGTCCAGAATGCCGGGATATGCGATTGTTATGTGTTGATCAAGAAAGCAGGGAG[G / T]GCCGTTACGCGGGTAATTGTGGGGTGGCTATTGCTTTTTTAACCAAATACCCGGGGTGATAATGGCCCCTGATTACGTCTCGACCCCCGAACAGATTAATTCCTACGGCGGCGTCGCGTTGGCTGGATATTGCCTGCTGCTCCTGTTCGTTGATGCTCTTTTATTTTTACGGGGCCAAAGAGGGATCTGATGGAAATTATCTAATAATTTTCACGCTTCGAAGTTCTTACCGGATATTACTGGGGCTGGCAGAAGGTCCCGTTTTGACTTACCCGACCAAATGCAATGGGGTAACATCAACCTagtcaaatttgtttttatagtaGCTCAAATAGATTGTTTACATCCAGTTTTCAAGGATAAAACAGTTTATCATCGTTTTTTACTCCCCACGttcact。

[0036] 9. Yunnan >CAVLJG010000002.1_20116048-20116048:._us:400_ds:400CAVLJG010000002.1_20116048_C_A TATGCGAGTGCCGCTGAAGAGGGAGAGTTAACTCCAGAATTAGTGATGTTAATGAAAAAACTCTGGGCAGACCCAGGTGTGCAGCTATGTTTTTCACGTTCCAGAGAATATCAATTGAATGATTCTGCAGCATACTACCTGAATCCTTAGACAGGATTTCGAAGCCTAATTATGTGCCTTCACAACAAGATGTACTTAGGACACGGGTGAAAACAACTGGGATAGTTGAAACAAACTTTTCCTTCAAAAACTTACATTTCAAGTAAGTTGATGTCAGAGCAGATCGTAATGAATTTAATAATGGATTATTGAATTATTTCTTTGCAGGATGTTTGATGTTGGCGGGCAAAGATCAGAAAGGAAAAAATGGATACACTGTTTTGAAGGTGTCACAGCAAT[C / A]ATTTTCTGTGTTGCACTATCAGGTAAAATATTCATTACTATTTATCTAATAATTGGAACAAAAAAGATAACTCATCGAAAAATTGATTGATAGTTTTGTCGTCTGAGATCCTCGGGTCAGTCCTCAAATCAATCTGACATCGGATTTGGAATCTACACACCAAATTTACCCGTAAAATGAGTTTTTACCCACATCACAGGTACTAGAAATTGTTTATGACAACTTGCCTTGCAAAATTCACGTATAGGTTTTTCCATAGCAACAAGCCGATGAAAATCGGTACAGTTAGATAATTTAGGACGCTGCATCCAAATATGATGATCAACGGATTTTAAGGTGTCGTTTGGTCAAATTTTGGGCAGAAACTTAGTCGCCCAAGATCATTTGTCAGCCCCAGTCT。

[0037] 10. Chile >CAVLJG010000001.1_76234-76234:._us:400_ds:400 CAVLJG010000001.1_76234_T_A TCTCGTATACACTGAATATACTTACTGTTTGGAAAGCCAAGCATAATGTTCAAACGCCAATTCCTGAAACCCTATCCTGCTTCTGAATCGATCGATGTGAGATTTAAACGTTGAAATAGCATCCCTCGCTAGATTTAGAAGAAACAGAAGCCGGCATATTTTGTAGTTGATGAAACCGGCAATGGTGCGGATCTCGAGCGA GTTCGTGTCCACTATTCGTATTTCTAACAGGTTTTCATATGCGTGGTTGTAGTGCCTGAAAATATGCATCATCACCTGCGCGCCAAGTCGACGTAAACATGAACACAATTCATGAAGAAATCCGTGGATTactataattgttttttttgttaatatcttaattGATCTTCTAAATTAATTAGTCATTGTTGGACTTCT[T / A]AATTTCCAAAATTCGATGGTTccacagaattttcaaaatttataaatcgatatttttcaagattaTTGAACTGTCATCGGCAAAAAATAGCAGCTAAAAATGATCCAAAGAtttaaaatttacaaatttattaaagatttaaaaaatcggAATTTCCAAATCCTCAGTTTACCAAATTTAAAATTCCAGAAAAGACTTC ATAATTTGACCTTTCCAAATTTTCCAAGTGCAAATTTTGGGGCGCATTTaactataattattaattttcataacataattttgtaaatagcaactaaaaaataatcttgcaacttttttgttattatcttaatttttatattgatcttattACAAATTAATTAGTCATACTTGATTGTTGGACTTTCCATTGCAGTAACA.

[0038] Thus, a set of SNP molecular markers that can be used to detect the origin of Phaseolus vulgaris populations in 10 countries and regions was obtained. The population sources, sample numbers, and SNP tracing site genotypes used in the screening are shown in Table 1.

[0039] Table 1. Sample numbers and traceability SNP loci information of 10 geographical populations of Phaseolus vulgaris.

[0040]

[0041] List 2 of SNP traceability marker sites and detection primers for Phaseolus vulgaris populations established by the present invention.

[0042] Table 2 Primer sequences for SNP combination site detection in geographical population tracing of common bean

[0043] According to the traceability detection site (Table 1) and its detection primer (Table 2), for the samples of Phaseolus vulgaris that may cover the technical invention, single-head genomic DNA is extracted; the population traceability site detection primers (Table 2) provided by the present invention are used to amplify (PCR) the target detection sequence of the Phaseolus vulgaris population sample. Use SnapGene to open the ab1 sequencing file, search for the flanking sequence of the SNP, determine the target area on the sequencing peak graph according to the flanking sequence of the SNP (generally 10bp), and determine the source of the sample according to the SNP type.

[0044] The specific steps are as follows: Sample collection The samples must be insect bodies or tissues whose DNA is not degraded and not infected by pathogens.

[0045] Genomic DNA extraction Select a commercial kit suitable for extracting trace samples (such as QIAGEN's DNeasy Blood and Tissue Kit (50) or other equivalent kits. Refer to the instructions for use for the extraction method. For micro-insect sampling, single-head insect bodies are generally suitable. Before elution, try to remove organic solvents such as alcohol from the DNA purified by the separation column. After elution, the solution should be tested for DNA concentration and quality.

[0046] SNP tracing site sequence amplification According to the population samples to be tested, the traceability primers in Table 2 are used to amplify the SNP sites.

[0047] Amplification system and conditions Take the preparation of 25µL amplification system as an example (Table 3). If the DNA template concentration is lower than 10ng / µL, the amount of template should be appropriately increased.

[0048] Table 3 PCR reaction mixture and dosage of COI sequence

[0049] The PCR reaction conditions are: pre-denaturation at 94°C for 4 min before cycling; denaturation at 94°C for 30 s, annealing at 50°C~58°C (depending on the specific primers) for 30 s, extension at 72°C for 45 s, 36 cycles, and finally extension at 72°C for 10 min. The system temperature was reduced to 12°C to end the PCR amplification.

[0050] Amplification product sequencing and SNP site determination The amplified product is generally sent to a sequencing company for sequencing. The origin of the traceable population is determined by searching the sequencing peak graph to find the consistency between the target site and the reference base of the traceable population.

[0051] The SNP traceability site verification results of 10 bean weevils populations are shown in Table 4. The verification site identification map is based on the German population as an example. Figure 1 .

[0052] Table 4 Verification results of SNP detection sites for tracing the bean weevil population

[0053] According to the amplification peak of the SNP traceability site obtained by amplification of the German population primers GER-6923-F / GER-6923-R, the origin of the population to be tested was determined by referring to the genotype of the traceability site of the specific population in Table 3. The traceability SNP genotype of the target population Germany is GG, and the genotypes of other countries such as Ethiopia, Angola, Burundi, Congo, Guizhou, Cameroon, Rwanda, Uganda, Yunnan and Chile are all TT ( Figure 1 ).

[0054] According to the SNP traceability site amplification peak obtained by amplification of the Yunnan population primers 6048-F / 6048-R, the origin of the population to be tested was determined by referring to the genotype of the traceability site of the specific population in Table 3. The traceability SNP genotype of the target population Yunnan is AA, and the genotypes of other countries such as Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda and Chile are all CC or AC ( Figure 2 ).

[0055] According to the amplification peak of the SNP traceability site obtained by the Guizhou population primers GZ-5734-F / GZ-5734-R, the origin of the population to be tested was determined by referring to the genotype of the traceability site of the specific population in Table 3. The traceability SNP genotype of the target population Guizhou is AA, and the genotypes of other countries such as Ethiopia, Angola, Burundi, Germany, Congo, Cameroon, Uganda, Yunnan and Chile are all GG ( Figure 3 ).

[0056] According to the amplification peak of the SNP traceability site obtained by amplification of the Ethiopian population primers 9353-F / 9353-R, the origin of the population to be tested was determined by referring to the genotype of the traceability site of the specific population in Table 3. The traceability SNP genotype of the target population Ethiopia is GG, and the genotypes of other Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA ( Figure 4 ).

[0057] According to the SNP traceability site amplification peak obtained by amplification of the Angolan population primers 0510-F / 0510a-R, the origin of the population to be tested was determined by referring to the genotype of the traceability site of the specific population in Table 3. The traceability SNP genotype of the target population Angola is GG, and the genotypes of other countries such as Ethiopia, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA ( Figure 5 ).

[0058] According to the peak graph of the SNP traceability site amplified by primers 9808-F / 9808-R of the Burundi population, the origin of the population to be tested was determined by referring to the genotype of the traceability site of the specific population in Table 3. The traceability SNP genotype of the target population Burundi is GG, and the genotypes of other countries such as Ethiopia, Angola, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA ( Figure 6 ).

[0059] According to the amplification peak of the SNP traceability site obtained by amplification of the Congolese population primers 6044-F / 6044-R, the origin of the population to be tested was determined by referring to the genotype of the traceability site of the specific population in Table 3. The traceability SNP genotype of the target population Congo is CC, and the genotypes of other countries such as Ethiopia, Angola, Burundi, Germany, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA ( Figure 7 ).

[0060] According to the SNP traceability site amplification peak obtained by amplification of the Cameroon population primers 2864-F / 2864-R, the origin of the population to be tested was determined by referring to the genotype of the traceability site of the specific population in Table 3. The traceability SNP genotype of the target population Cameroon is AT, and the genotypes of other countries such as Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Uganda, Yunnan and Chile are all TT ( Figure 8 ).

[0061] According to the SNP traceability site amplification peak obtained by amplification of the Ugandan population primers 2448-F / 2448-R, the origin of the population to be tested was determined by referring to the genotype of the traceability site of the specific population in Table 3. The traceability SNP genotype of the target population Uganda is TT, and the genotypes of other countries such as Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Yunnan and Chile are all GG ( Fig. 9 ).

[0062] According to the SNP traceability site amplification peak obtained by amplification of the Chilean population primers 6234-F / 6234-R, the origin of the population to be tested was determined by referring to the genotype of the traceability site of the specific population in Table 3. The traceability SNP genotype of the target population Chile is AA, and the genotypes of other countries such as Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda and Yunnan are all TT ( Fig.10 ).

[0063] The population tracing SNP sites of the present invention are obtained based on the screening of genome sequence variation sites, and the technical advantage is that the population tracing SNP candidate screening sites are more abundant, the sites that can be selected are more stable and reliable, and the quality of the detection results can be effectively guaranteed.

[0064] Although the present invention has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. The SNP molecular marker for tracing the bean weevil population is characterized by: Include one or more of the following molecular markers: The traceability SNP site for the German population is T at the 546923rd base position on the reference genome chromosome CAVLJG010001675.1 of the Phaseolus vulgaris. The traceability SNP molecular marker for the German population at this site is G. The traceability SNP site for the Guizhou population is G at the 48615734th base position on the reference genome chromosome CAVLJG010000007.1 of the Phaseolus vulgaris. The traceability SNP molecular marker for the Guizhou population at this site is A. For the traceability SNP site of the Ethiopian population, the 44479353th base position on the reference genome chromosome CAVLJG010000003.1 of the Phaseolus vulgaris is A, and the traceability SNP molecular marker of the Ethiopian population at this site is G; The traceability SNP site for the Angolan population is A at the 29220510th base position on the reference genome chromosome CAVLJG010000006.1 of Phaseolus vulgaris, and the traceability SNP molecular marker for the Angolan population at this site is G; For the traceability SNP site of the Yunnan population, the 20116048th base position on the reference genome chromosome CAVLJG010000002.1 of Phaseolus vulgaris is C, and the traceability SNP molecular marker of the Yunnan population at this site is A; For the traceability SNP site of the Chilean population, the 76234th base position on the reference genome chromosome CAVLJG010000001.1 of Phaseolus vulgaris is T, and the traceability SNP molecular marker of the Chilean population at this site is A; The traceability SNP site for the Cameroon population is T at the 110012864th base position on the reference genome chromosome CAVLJG010000003.1 of Phaseolus vulgaris, and the traceability SNP molecular marker of the Cameroon population at this site is A; For the traceability SNP site of the Ugandan population, the 23872448th base position on the reference genome chromosome CAVLJG010000008.1 of Phaseolus vulgaris is G, and the traceability SNP molecular marker of the Ugandan population at this site is T; The traceability SNP site for the Burundi population is A at the 39379808th base position on the reference genome chromosome CAVLJG010000004.1 of Phaseolus vulgaris, and the traceability SNP molecular marker of the Burundi population at this site is G; The 92046044th base position of the traceability SNP site for the Congolese population on the reference genome chromosome CAVLJG010000005.1 of the Phaseolus vulgaris is A, and the traceability SNP molecular marker of the Congolese population at this site is C.

2. A detection primer for detecting the SNP molecular marker for tracing the bean weevil population as described in claim 1.

3. The detection primer according to claim 2, characterized in that It includes one or more pairs of the following primers: The detection primers for the traceability SNP locus molecular markers of the German population are GER-6923-F / GER-6923-R, the forward primer sequence is TTAGAATGATTGATGACCGGGTG, and the reverse primer sequence is ACCATAGAAAGGCATCTTCAAGC; The detection primers for the traceability SNP site molecular markers of the Guizhou population are GZ-5734-F / GZ-5734-R, the forward primer sequence is AACATGAAGGACATTACCGAGTC, and the reverse primer sequence is TAACCAAGATATCCGACGCTTTC; The detection primers for the traceability SNP locus molecular marker G for the Ethiopian population are 9353-F / 9353-R, the forward primer sequence is CTTCTCCCACTCCCAGTCTC, and the reverse primer sequence is Gacaaatccgtggtgggaac; The detection primers for the traceability SNP locus molecular markers of the Angolan population are 0510-F / 0510a-R, the forward primer sequence is TATCCCCACTAGGTCGTTGAAG, and the reverse primer sequence is AGTGCATCACTTGGTCATAACG; The detection primers for the traceability SNP site molecular markers of the Yunnan population are 6048-F / 6048-R, the forward primer sequence is ACACGGGTGAAAACAACTGG, and the reverse primer sequence is TCATCGGCTTGTTGCTATGG; The detection primers for the traceability SNP locus molecular markers of the Chilean population are 6234-F / 6234-R, the forward primer sequence is GCCAATTCCTGAAACCCTATCC, and the reverse primer sequence is ttAAATGCGCCCCAAAATTTGC; The detection primers for the traceability SNP locus molecular markers of the Cameroon population are 2864-F / 2864-R, the forward primer sequence is tgttggcctgtaaacgaagc, and the reverse primer sequence is ACCTAATGCTCAATGCGCTG; The detection primers for the traceability SNP locus molecular markers of the Ugandan population are 2448-F / 2448-R, the forward primer sequence is TCTATTTTGTCGGTGCACAGC, and the reverse primer sequence is ATCAGATCCCTCTTTGGCCC; The detection primers for the traceability SNP site molecular marker of the Burundi population are 9808-F / 9808-R, the forward primer sequence is TAAGCTTGTAGCCCCATCCC, and the reverse primer sequence is AGATGCACTGTGTAATCGGC; The detection primers for the traceability SNP site molecular marker for the Congolese population are 6044-F / 6044-R, the forward primer sequence is aacagGATACCTACTCCCTGAC, and the reverse primer sequence is atcgTCTTGTGTGTAAAAGGGC.

4. Application of the Phaseolus vulgaris population tracing SNP molecular marker according to claim 1 in the detection of the geographical population tracing of Phaseolus vulgaris.

5. Use of the detection primers as described in any one of claims 2 or 3 in tracing the geographical population of Phaseolus vulgaris.

6. A method for tracing the origin of Phaseolus vulgaris populations using SNP molecular markers, characterized in that: The following steps are involved: Extract genomic DNA from a single head of a bean weevil sample, and amplify it with the detection primers described in any one of claims 2 or 3; perform sequencing or amplification peak graph based on the amplified product, and determine the origin of the population to be tested by referring to the genotype of the specific population tracing site; The population of Phaseolus vulgaris is from Guizhou, Ethiopia, Rwanda, Burundi, Cameroon, Congo, Uganda, Angola, Germany or Chile.

7. The method for tracing the origin of Phaseolus vulgaris populations according to claim 6, characterized in that: The method for extracting genomic DNA from a single head of Phaseolus vulgaris specimens was carried out using a kit suitable for extraction of trace samples.

8. The method for tracing the origin of Phaseolus vulgaris populations according to claim 6, characterized in that: Amplification conditions: pre-denaturation at 94°C for 4 min before cycling; denaturation at 94°C for 30 s, annealing at 50°C~58°C (depending on the specific primers) for 30 s, extension at 72°C for 45 s, 36 cycles, and finally extension at 72°C for 10 min. The system temperature was reduced to 12°C to end PCR amplification.

9. The method for tracing the origin of Phaseolus vulgaris populations according to claim 6, characterized in that: The amplification system is prepared in 25 µL. If the concentration of genomic DNA template is adjusted to no less than 0.4 ng / µL, the dosage of upstream primer and downstream primer is 0.24 mmol / L respectively.

10. The method for tracing the origin of Phaseolus vulgaris population according to any one of claims 6 to 9, characterized in that: The amplified product is amplified by one or more primers as described in claim 3 to amplify the target detection sequence of the bean weevil population sample; the target region is determined on the sequencing peak graph according to the flanking sequence of the SNP, and the source of the sample can be determined according to the SNP type; the specific judgment criteria are as follows: According to the SNP traceability site amplification peak diagram obtained by primers GER-6923-F / GER-6923-R, the traceability SNP genotype of the German population is GG, while the genotypes of Ethiopia, Angola, Burundi, Congo, Guizhou, Cameroon, Rwanda, Uganda, Yunnan and Chile are all TT; According to the SNP traceability site amplification peak graph obtained by primer 6048-F / 6048-R, the traceability SNP genotype of the Yunnan population is AA, while the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda and Chile are all CC or AC; According to the SNP traceability site amplification peak diagram obtained by primers GZ-5734-F / GZ-5734-R, the traceability SNP genotype of the Guizhou population is AA, while the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Cameroon, Uganda, Yunnan and Chile are all GG; According to the SNP traceability site amplification peak graph obtained by primers 9353-F / 9353-R, the traceability SNP genotype of the Ethiopian population is GG, while the genotypes of Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA; According to the SNP traceability site amplification peak graph obtained by primers 0510-F / 0510a-R, the traceability SNP genotype of the Angolan population is GG, while the genotypes of Ethiopia, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA; According to the SNP traceability site amplification peak diagram obtained by primers 9808-F / 9808-R, the traceability SNP genotype of the Burundi population is GG, while the genotypes of Ethiopia, Angola, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA; According to the SNP traceability site amplification peak graph obtained by primer 6044-F / 6044-R, the traceability SNP genotype of the Congolese population is CC, while the genotypes of Ethiopia, Angola, Burundi, Germany, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA; According to the SNP traceability site amplification peak diagram obtained by primers 2864-F / 2864-R, the traceability SNP genotype of the Cameroon population is AT, while the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Uganda, Yunnan and Chile are all TT; According to the SNP traceability site amplification peak diagram obtained by primer 2448-F / 2448-R, the traceability SNP genotype of the Ugandan population is TT, while the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Yunnan and Chile are all GG; According to the SNP tracing site amplification peak graph obtained by primers 6234-F / 6234-R, the tracing SNP genotype of the Chilean population is AA, while the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda and Yunnan are all TT.

Images