Application of a SNP molecular marker combination in the assisted breeding of keel length
10 SNP molecular markers related to keel length were screened through GWAS, and PCR amplification and genotyping analysis were used to select dominant genotype individuals, which solved the problem of slow progress in keel length breeding, and achieved faster breeding progress and higher breeding efficiency.
Patent Information
- Application Number
- CN202510010550.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-03
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2045-01-03
AI Technical Summary
Keel long breeding progresses slowly, and existing methods rely on direct assays or naked-eye observation, resulting in slow progress in generational genetics.
GWAS technology was used to screen out 10 SNP molecular markers significantly related to keel length. Through PCR amplification and genotyping analysis, dominant genotype individuals were selected, disadvantaged genotypes were eliminated, and molecular marker assisted breeding was used to use the dominant genotypes of the SNP1-SNP10 locus.
The progress of generational selection and breeding of keel length has been accelerated and breeding efficiency has been improved. The progress of keel length in each generation has significantly increased, the coefficient of variation has been reduced, and the uniformity has been improved.
Smart Images

Figure CN119710027B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular marker-assisted breeding, and specifically, to the application of a SNP molecular marker combination in the auxiliary breeding of keel length. Background Art
[0002] The body size indexes of poultry are important phenotypic traits for breed selection, and are significantly correlated with the meat performance of poultry such as body weight, dressed weight, and eviscerated weight. They are commonly used indexes for evaluating the body weight, body shape, and slaughter performance of poultry, and can reflect the growth and development status of poultry to a certain extent. Among them, the keel length is one of the important body size traits of chickens. Research shows that there is a significant strong positive correlation between the keel length and the thickness of the pectoral muscle. The pectoral muscle is mainly attached to the sternum and the keel, and is closely related to the growth of the keel. There is a significant correlation between the keel length and the body weight of chickens, and the indexes such as body weight and pectoral muscle rate can be improved by selecting the keel length trait. The development of keel length is a quantitative trait controlled by multiple genes.
[0003] At present, in the process of keel length breeding, the keel length is usually directly measured or observed with the naked eye for breeding, and the genetic progress of generations is slow. Therefore, finding molecular markers significantly related to the keel length is of great significance for improving the genetic progress of keel length in generations. Summary of the Invention
[0004] Aiming at the problem of slow genetic progress of keel length in generations, the present invention provides the application of a SNP molecular marker combination in the auxiliary breeding of keel length, and uses 10 SNP molecular markers significantly related to the keel length to assist in improving the breeding of keel length and accelerating the genetic progress of keel length in generations.
[0005] In order to achieve the above object, the present invention provides the application of a SNP molecular marker combination in the auxiliary breeding of keel length. The SNP molecular marker combination corresponds to the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI as follows:
[0006]
[0007] The screening method of the SNP molecular marker is as follows:
[0008] Taking the chicken genome bGalGal.mat.broiler.GRCg7b (GCF_016699485.2) as a reference, using GWAS sequencing technology and genome-wide association analysis, 10 SNP loci significantly related to the keel length are obtained. The univariate variance analysis in the general linear model of SPSS16.0 software is used for the association analysis and verification of the genotypes of polymorphic loci and the keel length, and the dominant genotypes of 10 SNP loci are screened.
[0009] GWAS is a powerful tool for analyzing the genetic structure of livestock and poultry quantitative traits. By using the GWAS method to study the association between SNP loci and phenotypic values, molecular markers affecting economic traits can be identified, which is especially suitable for complex quantitative traits. Based on this, the present invention screens molecular markers for keel length through GWAS and obtains 10 SNP molecular markers significantly related to keel length. Compared with candidate gene and QTL linkage analysis, GWAS has a high marker density, can resolve rare and low-frequency variations, can analyze the genetic structure of complex traits, and can also identify novel variations, and the results are more reliable.
[0010] The nucleotide sequences of the primers for the above SNP molecular markers are as follows:
[0011]
[0012] Specifically, the breeding method for increasing keel length includes the following steps:
[0013] (1) Determine the genotype of the chicken to be bred, and the genotype is the genotype of the above SNP molecular marker combination;
[0014] (2) Select and retain individuals with the dominant genotypes TT and CT at the SNP1 locus, the dominant genotype GGAA generated by the linkage of the SNP2 and SNP3 loci, the dominant genotype AA at the SNP4 locus, the dominant genotype GG at the SNP5 locus, the dominant genotype CC at the SNP6 locus, the dominant genotype GG at the SNP7 locus, the dominant genotype TT at the SNP8 locus, the dominant genotypes CC and TC at the SNP9 locus, and the dominant genotypes TT and GT at the SNP10 locus.
[0015] Specifically, in step (1), the method for determining the genotype of the chicken to be bred is:
[0016] (1.1) Extract the total genomic DNA of the chicken to be tested; preferably, the genomic DNA of the chicken to be tested is obtained by collecting blood from the wing vein of the chicken to be tested;
[0017] (1.2) According to the SNP molecular marker combination, use the corresponding primer pairs to amplify the target sequence by PCR method, and the sequences of the primer pairs are:
[0018] SNP1F: 5’ CACCAAGCGTGCATAAGAGA3’
[0019] SNP1R: 5’ ACCTGAAGAGTCGTGGATGG3’
[0020] SNP2F: 5’ CCTGCAGGGAGGAATAACAA3’
[0021] SNP2R: 5’ GGCACCTTTACAGCACCATT3’
[0022] SNP3F: 5’ GAAATGGGCTATGTGGCAGT3’
[0023] SNP3R: 5’ CCAGGACTTGTGCCTTTGTT3’
[0024] SNP4F: 5’ TGAACCCATAGGAGTTTTCCA3’
[0025] SNP4R: 5’TGCAGCGCATACCATCTTAC3’
[0026] SNP5F: 5’ GAGGGGTTGAAACTGGATGA3’
[0027] SNP5R: 5’CAAAGCTGGGTGCACAGATA3’
[0028] SNP6F: 5’ GCGTCAGTGGGAATAAGCTC3’
[0029] SNP6R: 5’AGCAGGTTACAGGGCAGAAA3’
[0030] SNP7F: 5’ CTGAAAGGGAGTCAGCCAAG3’
[0031] SNP7R: 5’TCCAAAAGCAGCACTAAGCA3’
[0032] SNP8F: 5’ TGCTGAAAATGTGTTGCTGA3’
[0033] SNP8R: 5’CTGCAGGTGTTTCTGTTCCA3’
[0034] SNP9F: 5’ CTGCAGGGTTTGGAGCAGGC3’
[0035] SNP9R: 5’CTGATGGGCTCAGAGCAAG3’
[0036] SNP10F: 5’GAGCAGGAGGGGGAAGTG3’
[0037] SNP10R: 5’CTTCCCATTGGCCGAGAAC3’;
[0038] (1.3) After sequencing the PCR amplification products, determine the genotypes.
[0039] The PCR products were sent to a biological company for sequencing. The obtained sequences were aligned with the reference genome of chickens to identify polymorphic sites. The nucleotide sequences of the PCR products of the SNP sites are shown below:
[0040] SNP1 - C / T mutation at 199 bp, PCR product length is 223 bp:
[0041] CACCAAGCGTGCATAAGAGATTGAATGAGTTCAGCATTAATAACAGGGGCTGTCCTTCTCATTACACCGACTGCCATTTCTAAAAGGCGTGTTTTAATTAATAAGGAAGCTGAAGAAAAGCATTCAGAGGAAGCACTGTCATTAGTGCAGACGGGTAAGCACAGTGTGTCATGCACGCACTTGGGCAGAACTTTTAATK(C / T)TGCTCCATCCACGACTCTTCAGGT
[0042] SNP2 - G / A mutation at 143 bp, PCR product length is 224 bp:
[0043] CCTGCAGGGAGGAATAACAACTTCAGGTTTTTGAGGTCTCACTCATGTCACAGAGGTAATAGTGTACCTTGAACTCAGCATCCCTGTTACAGCTTCCTCTAGTGGAGCTATGCAGCAAAGCGTTCTCTCTTCGTCCTTAGAGK(G / A)GAAATGGGCTATGTGGCAGTATGGTTCATCTGCCCAGTTTCAGCTCCTCGTGGCTAACATTAATGGTGCTGTAAAGGTGCC
[0044] SNP3 - A / G mutation at 112 bp, PCR product length is 219 bp:
[0045] GAAATGGGCTATGTGGCAGTATGGTTCATCTGCCCAGTTTCAGCTCCTCGTGGCTAACATTAATGGTGCTGTAAAGGTGCCCAGCCAACAATGCCTGTGCAGAGCGGTCACK(A / G)TTTCAGGTATAGTTACCAGTGGCATTGGTTGCCCCAGGATGCCTCTTGGAGTTGAGGACACTGGGTAGCACTGTTTCCACAGAGAAAAACAAAGGCACAAGTCCTGG
[0046] SNP4 - G / A mutation at 157 bp, PCR product length is 248 bp:
[0047] TGAACCCATAGGAGTTTTCCAGCTGAGCAATTACTGAAATGTCAGGATGCCTAGTCTGAATTTGCACATAAAAATGGTATACATGCATTAAAACTTAGCCTTCAAAATTATCTTGTTAAATAGTTAGAAATTAGATAGTGTAAAACAACTGACAATK(G / A)AGAAGGGAAAAGAAAAAAAAGATATTTTTAGTATGAAATACATGTATAATTGCAACTGGTGACTTTTACCTGTAAGATGGTATGCGCTGCA
[0048] SNP5 - A / G mutation at 136 bp, PCR product length is 219 bp:
[0049] GAGGGGTTGAAACTGGATGATCATTGTGGTCCTTTTCAACTCAGGCCATTCTATGATTCTATGATTCTGTATCCTGAAGGAAGTCATAAAATCAGATCATATGATAAAATTACTAACGTAAGAGGATTTGATAGGK(A / G)CTAACAACATCAAATATTTGATACGATCAGATTTGAATTTTCACATAGAATAGTCCTGCAAAATATCTGTGCACCCAGCTTTG
[0050] SNP6 - A / G mutation at 180 bp, PCR product length is 237 bp:
[0051] GCGTCAGTGGGAATAAGCTCAACAGACCAAGCTTATTAGAAATTCATGAACAACTGGCAAAGGTGAGTGAAAAGGAAACATTTGATTTTTCTCTGTTCCATTTCCAGGCTGTTAATTCTGTTTATTAATATGAAAAAGTCTTTAAATTCACGGATCTTGCCCAAGACAAAAGTACAACTK(C / A)ATCACTTACCATATTTCCTGTGGTAGCTGCAGTATGTTTTCTGCCCTGTAACCTGCT
[0052] SNP7 - A / G mutation at 63bp, PCR product length is 227 bp:
[0053] CTGAAAGGGAGTCAGCCAAGAATCCAAGTAGGCCAATGATAAGCTTAGCACATTAGAAAGTTK(A / G)AAATATAAACATGACTCTTATAATTCCAGAAAATAACTCAAATTGTAGGCAAGTATTTTAAAATGCTGTACTTGCAGGCAAAGTAATTGCAGTAAATAATCAATGTAAAAGAGATCAAATATATAAAAACAACCTTCTGAAAACTGCTTAGTGCTGCTTTTGGA
[0054] SNP8 - G / T mutation at 102bp, PCR product length is 202 bp:
[0055] TGCTGAAAATGTGTTGCTGAAGGAAACCAGTTTATAGGAATACACCATTATACTGGTGCTACCCATAAGGTAGGGATCAGAAACTGACAAAAACTGGTGATK(G / T)TTCTTATCTCAGAGATTTTCTCTCTTGATTTTAAGCAGGAAATCTGCAGACTACAACAGGCATGAGACAAGTCTTCTGCATGGAACAGAAACACCTGCAG
[0056] SNP9 - T / C mutation at 60bp, PCR product length is 233 bp:
[0057] CTGCAGGGTTTGGAGCAGGCTGGCGTCCCTGCTTGGCGCCCTAGAGTGGAACCTGGCAGK(T / C)CAAACGGAAAACGTAAAGCTGGGAGAAGATACGTGTGTGCCTGAACAACGTCGCGAGCGTCCTGGCAGGATGGAAGCGGGGATTGCTGGGCTGTGGCTGTGGGGCAGACGCGGGCCTGAGCCCTACATCCCGCTCTGCTGCCGCCGCTGCGCTCCTTGCTCTGAGCCCATCAG
[0058] SNP10 - G / T mutation at 171bp, PCR product length is 218 bp:
[0059] GAGCAGGAGGGGGAAGTGCCGTGCGGTTCCCATCGCTGCCACCACCGCCGCCGCCCAAGCGCTACTGCGGCCCCCGCGCCCCCTGCGCGGCGCGATGGGAGCCGCCTCACCAAGCCCCGCCCCGCAGCCAATGGGAGCGCGGCGGAGGTGGGACTCCGGGGAACGAGGGGK(G / T)ATTGGGCGAGAGCCACACCCGCCTCGCCGTTCTCGGCCAATGGGAAG
[0060] Note: K marked in the above sequence is the mutation site, and the base in the parentheses is the mutated base, which is an allelic gene mutation.
[0061] The specific method for judging individuals with the dominant genotype is as follows:
[0062] First, analyze the correlation between a single SNP marker and keel length. Among the 10 SNPs, there were significant differences in keel length among different genotypes. SNP1 (rs315701680) had three genotypes: CC, CT, and TT. The keel lengths of individuals with genotypes TT and CT were significantly greater than those with genotype CC (P < 0.05). SNP2 (rs738740137) had three genotypes: AA, GA, and GG. The keel length of individuals with genotype GG was significantly greater than those with genotypes AA and GA (P < 0.05). SNP3 (rs317223723) had three genotypes: AA, AG, and GG. The keel length of individuals with genotype AA was significantly greater than those with genotypes GG and AG (P < 0.05). SNP4 (rs732443622) had three genotypes: AA, GA, and GG. The keel length of individuals with genotype AA was significantly greater than those with genotypes GG and GA (P < 0.05). SNP5 (rs315667756) had three genotypes: AA, AG, and GG. The keel length of individuals with genotype GG was significantly greater than those with genotypes AA and GA (P < 0.05). SNP6 (rs314381113) had three genotypes: AA, CA, and CC. The keel length of individuals with genotype CC was significantly greater than those with genotypes AA and CA (P < 0.05). SNP7 (rs732811384) had three genotypes: AA, AG, and GG. The keel length of individuals with genotype GG was significantly greater than those with genotypes AA and AG (P < 0.05). SNP8 (rs314197610) had three genotypes: GG, GT, and TT. The keel length of individuals with genotype TT was significantly greater than those with genotypes GG and GT (P < 0.05). SNP9 (rs13782000) had three genotypes: CC, TC, and TT. The keel lengths of individuals with genotypes CC and TC were significantly greater than those with genotype TT (P < 0.05). SNP10 (rs737401141) had three genotypes: GG, GT, and TT. The keel lengths of individuals with genotypes TT and GT were significantly greater than those with genotype GG (P < 0.05).
[0063] Use Haploview software to analyze the linkage disequilibrium (LD) degree of the 10 SNPs. The results of the linkage disequilibrium analysis showed that SNP2 and SNP3 were in a strong linkage state (D’ value = 1, R 2 = 100), and the other 8 SNP loci were not in a strong linkage state (D’ value < 1, R 2<100), the linkage between SNP2 and SNP3 generated two haplotypes: H1 (AG) and H2 (GA), with haplotype frequencies of 0.893 and 0.098, respectively. Therefore, only the combined genotypes of SNP2 and SNP3 were analyzed for their correlation with keel length, and the combined genotypes of the 8 molecular markers were no longer analyzed for their correlation with keel length. The two haplotypes generated by the linkage of SNP2 and SNP3 combined to produce five genotypes. Association analysis found that the keel length of the H1H1 haplotype (GGAA genotype) was significantly higher than that of other haplotype combinations.
[0064] The TT and CT genotypes at the SNP1 locus, the GGAA genotype generated by the linkage of the SNP2 and SNP3 loci, the AA genotype at the SNP4 locus, the GG genotype at the SNP5 locus, the CC genotype at the SNP6 locus, the GG genotype at the SNP7 locus, the TT genotype at the SNP8 locus, the CC and TC genotypes at the SNP9 locus, and the TT and GT genotypes at the SNP10 locus are the dominant genotypes for keel length and can be used as important molecular markers for molecular-assisted breeding of keel length.
[0065] Through the above technical solutions, the present invention achieves the following beneficial effects:
[0066] In molecular marker-assisted breeding of keel length, the method of selecting individuals with dominant genotypes at 10 SNP loci (SNP1 - SNP10) and eliminating individuals with inferior genotypes at the SNP1 - SNP10 loci can be used to assist in improving the selection of keel length and accelerating the breeding progress of keel length generations. BRIEF DESCRIPTION OF THE DRAWINGS
[0067] Figure 1 is the Manhattan plot of molecular markers related to keel length;
[0068] Figure 2 is the QQ plot of molecular markers related to keel length;
[0069] Figure 3 is the linkage disequilibrium analysis plot of 10 SNP molecular markers. DETAILED DESCRIPTION OF THE INVENTION
[0070] The following detailed description of the specific embodiments of the present invention is provided in conjunction with the examples. It should be understood that the specific embodiments described herein are only for the purpose of illustration and explanation of the present invention and are not intended to limit the present invention.
[0071] Example 1 Screening of Molecular Markers Significantly Related to Keel Length
[0072] 1. Experimental Materials
[0073] The selected experimental subjects were the terminal sire line A of Lihua yellow - footed partridge chickens. The main selected traits of this line were body weight, feed conversion ratio, dressing percentage, etc. It has undergone six generations of closed breeding. The experimental chicken flock was raised in the Jintan breeding base of Jiangsu Lihua Animal Husbandry Co., Ltd. in Changzhou, Jiangsu Province. All experimental chickens were hatched in the same batch and raised in the same chicken house. The experimental chickens were raised in a two - stage manner. From 1 to 4 weeks of age, they were brooded in cages, and after 5 weeks of age, they were transferred to individual cages. They were fed with the company's standard breeder diet, and the chickens had free access to water and food during the experimental period. Immunization followed the standard procedures established by the company.
[0074] 2. Measurement of keel length
[0075] Randomly select 400 male chickens of the specialized line A of Lihua yellow - footed partridge chickens. After fasting for 12 hours, weigh them, record the leg numbers, and measure the keel length of 60 - day - old male chickens. The specific measurement method: use a vernier caliper to measure the distance from the front end to the end of the chicken's keel. All keel length measurements were taken by the same person, and the measured parts were basically the same.
[0076] 3. Mining of molecular markers for keel length
[0077] At 60 days of age, collect 1.5 mL of wing - vein blood from the population whose keel lengths have been measured for all chickens. Anticoagulate with EDTA. After collecting the blood, gently shake the anticoagulation tube up and down slowly to make the EDTA in the tube fully contact and mix evenly with the blood. Then store the anticoagulation tube in an insulated box with an ice pack. After the blood collection is completed, quickly transport it to the laboratory and store it at - 20°C for later use. Use the TIANGEN Blood Genomic DNA Extraction Kit (centrifugal column type) (YDP348) to extract DNA. Determine the integrity and purity of DNA by gel migration (1% agarose gel electrophoresis), and use a Qubit 4 fluorescence quantifier (Thermo Fisher, Shanghai) to measure the DNA concentration to ensure that the concentration of the extracted DNA sample is greater than 15 ng / μL.
[0078] Whole - genome re - sequencing: The DNA samples that passed the quality inspection were uniformly sent to Beijing Bozhigeya Biotechnology Co., Ltd. for whole - genome re - sequencing, including the preparation of genomic libraries and sequencing on the MGISEQ - 2000 platform.
[0079] Quality control: Mainly filter the original genomic reads of paired-end sequencing on the MGISEQ-2000 platform using the fastp (v.0.20.0) preprocessor (set to default parameters) to remove low-quality reads, adapters, and reads containing poly-N. Finally, use the BWA (v0.7.17) software to align the reads obtained after quality control to the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in the reference NCBI; use the Picard software to remove the reads with duplicate alignments; analyze through the GATK 4.0 software to obtain high-quality SNP sites.
[0080] Genome-wide association study: Use the PLINK (v1.90p) software to perform principal component analysis (PCA) on the quality-controlled SNP sites to prevent false positive results caused by population stratification. Perform association analysis of body weight traits through the linear mixed model (LMM) of the GEMMA (v0.98.5) software.
[0081] y = Wα + xβ + u + , u ~ MVNn(0, λτ -1 K), ~ MVNn(0, λτ -1 I n )
[0082] where y is the phenotype vector; W is the fixed effect matrix (the first three principal components including PCA); α is the fixed effect vector; x is the genotype vector, β is the effect vector of SNPs; u is the random effect vector; represents the residual vector. MVNn is the n-dimensional multivariate normal distribution, λ is the ratio of genetic variance to residual variance (the ratio of the random effect vector u to the residual vector ), τ -1 is the residual variance, K is the kinship matrix calculated based on SNPs using GEMMA, and I n is the identity matrix.
[0083] Use the (-indep-pairwise 50 10 0.2) parameter in the PLINK software to infer the number of effective SNPs for independent tests, and finally infer that the number of effective independent test SNPs is 4,325,210. After multiple testing, the Bonferroni correction method is used to set the significant threshold. In this study, the genome-wide significant level p is 1.16×10 -7(0.05 / the number of effective independent test SNPs), and then take the negative logarithm of the p-value to the base 10, which is the genome-wide significant level threshold; the genome-wide potential significant level p is 2.31×10 -6 (1 / 432529), take the negative logarithm of log10, which is the potential significant level threshold of 5.63. Use the Cmplot package in R to visualize the GWAS results. Annotate the neighboring genes within 100 Kb upstream and downstream of the significant loci through Bedtools (v2.30.0) software.
[0084] After quality inspection, perform genome-wide association analysis on the keel length phenotypic values of 366 chickens. The results are as Figure 1 、 Figure 2 shown. It can be seen from the Manhattan plot that a total of 10 SNP loci (above the threshold of 5.63) potentially significantly associated were mapped on chicken chromosomes 1, 3, 4, 10, 14, and 24. The QQ plot further verifies the reliability of the GWAS results. Summarize the significantly associated keel length molecular markers screened, as shown in Table 1:
[0085] Table 1 Molecular markers significantly associated with keel length
[0086]
[0087] The physical positions of the chromosomes of the markers mentioned above refer to the chicken whole genome (bGalGal1.mat broiler.GRCg7b).
[0088] 4. Genetic polymorphism analysis of 10 SNPs loci significantly associated with keel length
[0089] Use PopGene (version 1.31) to statistically analyze the genotype frequencies, gene frequencies, and heterozygosity (He) of the 10 SNP molecular markers obtained, and use the chi-square test to detect whether the SNP loci are in Hardy-Weinberg (H-W) equilibrium. The analysis results are shown in Table 2.
[0090] It can be seen from Table 2 that all 10 SNP loci have 3 genotypes. After H-W equilibrium detection, among the 10 SNPs loci, except for the three loci of SNP5, SNP6, and SNP10 deviating from the H-W equilibrium state (P<0.05), the other 7 SNP loci are in the H-W equilibrium state (P>0.05). Four SNP loci (SNP1, SNP2, SNP3, SNP10) have low genetic diversity (He<0.25), and the other 6 SNP loci (SNP4, SNP5, SNP6, SNP7, SNP8, SNP9) have moderate genetic diversity (0.25<He<0.50).
[0091] Table 2 Genetic polymorphisms of 10 SNP loci and Hardy-Weinberg equilibrium test
[0092]
[0093] 5. Analysis of dominant genotypes of SNP molecular markers for keel length
[0094] Univariate analysis of variance in the general linear model of SPSS 16.0 software was used to analyze the association between the genotypes of polymorphic loci and keel length. Fixed factor: different genotypes of SNP markers; dependent variable: keel length. The Tukey HSD method was used for multiple comparisons of the significant differences in keel length between different marker genotypes. P < 0.05 indicates significant differences.
[0095] First, the correlation between a single SNP marker and keel length was analyzed. There were significant differences in keel length among different genotypes of the 10 SNPs loci. SNP1 (rs315701680) had three genotypes CC, CT, and TT. The keel lengths of individuals with genotypes TT and CT were significantly greater than that of genotype CC (P < 0.05); SNP2 (rs738740137) had three genotypes AA, GA, and GG. The keel length of individuals with genotype GG was significantly greater than those of genotypes AA and GA (P < 0.05); SNP3 (rs317223723) had three genotypes AA, AG, and GG. The keel length of individuals with genotype AA was significantly greater than those of genotypes GG and AG (P < 0.05); SNP4 (rs732443622) had three genotypes AA, GA, and GG. The keel length of individuals with genotype AA was significantly greater than those of genotypes GG and GA (P < 0.05); SNP5 (rs315667756) had three genotypes AA, AG, and GG. The keel length of individuals with genotype GG was significantly greater than those of genotypes AA and GA (P < 0.05); SNP6 (rs314381113) had three genotypes AA, CA, and CC. The keel length of individuals with genotype CC was significantly greater than those of genotypes AA and CA (P < 0.05); SNP7 (rs732811384) had three genotypes AA, AG, and GG. The keel length of individuals with genotype GG was significantly greater than those of genotypes AA and AG (P < 0.05); SNP8 (rs314197610) had three genotypes GG, GT, and TT. The keel length of individuals with genotype TT was significantly greater than those of genotypes GG and GT (P < 0.05); SNP9 (rs13782000) had three genotypes CC, TC, and TT. The keel lengths of individuals with genotypes CC and TC were significantly greater than that of genotype TT (P < 0.05); SNP10 (rs737401141) had three genotypes GG, GT, and TT. The keel lengths of individuals with genotypes TT and GT were significantly greater than that of genotype GG (P < 0.05).
[0096] The software Haploview was used to analyze the degree of linkage disequilibrium (LD) of 10 SNPs, and the results of the linkage disequilibrium analysis are shown in Figure 3 . Figure 3 The value R in the box 2 is obtained by multiplying the D’ value by 100. It can be seen from Figure 3 that the SNP2 and SNP3 loci are in strong linkage (D’ value = 1, R 2 = 100), and the other 8 SNP loci are not in strong linkage (D’ value < 1, R 2 < 100). The linkage between SNP2 and SNP3 produced 2 haplotypes: H1 (AG) and H2 (GA), and the haplotype frequencies were 0.893 and 0.098 respectively. Therefore, only the correlation between the combined genotypes of SNP2 and SNP3 and the keel length was analyzed, and the correlation between the combined genotypes of the 8 molecular markers and the keel length was no longer analyzed. The 2 haplotypes produced by the linkage of SNP2 and SNP3 combined to produce 5 genotypes (Table 4). As can be seen from Table 4, through association analysis, it was found that the keel length of the H1H1 haplotype (GGAA genotype) was significantly higher than that of other haplotype combinations.
[0097] The TT and CT genotypes at the SNP1 locus, the GGAA genotype produced by the linkage of the SNP2 and SNP3 loci, the AA genotype at the SNP4 locus, the GG genotype at the SNP5 locus, the CC genotype at the SNP6 locus, the GG genotype at the SNP7 locus, the TT genotype at the SNP8 locus, the CC and TC genotypes at the SNP9 locus, and the TT and GT genotypes at the SNP10 locus are the dominant genotypes for the keel length and can be used as important molecular markers for molecular-assisted breeding of the keel length.
[0098] In the breeding of the keel length, the method of selecting individuals with dominant genotypes at 10 SNP loci (SNP1 - SNP10) and eliminating individuals with inferior genotypes at the SNP1 - SNP10 loci can be used to assist in improving the selection of the keel length and accelerating the breeding progress of the keel length generation.
[0099] Table 3 Association analysis of gene loci and keel length traits (mean ± standard deviation)
[0100]
[0101] Table 4 Association analysis of haplotype combinations at the SNP2 and SNP3 loci and keel length traits
[0102] (mean ± standard deviation)
[0103]
[0104] Example 2 Verification of molecular marker-assisted breeding for keel length
[0105] At 60 days of age, the chickens in the terminal sire line A of Lihua Yellow-Footed Partridge Chickens were genotyped, and the individuals with the advantageous genotype of longer keel length were retained. The specific scheme is as follows:
[0106] (1) At 60 days of age, 800 male chickens of line A were bled from the wing vein using a disposable syringe, and DNA was extracted by the phenol-chloroform method to extract the total genomic DNA of the chickens to be tested;
[0107] PCR amplification primers: Download the DNA template sequence information from the NCBI website, and design primers for 10 SNP loci (rs315701680, rs738740137, rs317223723, rs732443622, rs315667756, rs314381113, rs732811384, rs314197610, rs13782000, rs737401141) of the relevant genes using the primer premier software. The relevant information of the primer sequences is shown in Table 5.
[0108] Table 5 Relevant information of primer sequences
[0109]
[0110] (2) PCR amplification, electrophoresis and sequencing genotyping: The PCR amplification products were analyzed by 1.5% agarose gel electrophoresis and sequenced for genotyping. The male chickens of line A of Lihua Partridge Chickens were genotyped, and the individuals with the advantageous genotype of longer keel length were retained.
[0111] The total PCR reaction system was 50 μL: 4 μL of DNA template, 2 μL of dNTP (2 mmol / L), 0.6 μL of Mg 2+ (3 mmol·L -1 ) 0.6 μL, 5 μL of 1×PCR reaction buffer, 1 μL each of upstream and downstream primers (10 μmol·L -1 ), 2.5 μL of Taq polymerase (1 U·μL -1 ), and made up to 50 μL with ultrapure water.
[0112] PCR reaction program: Pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 5 min. The PCR amplified target fragment was detected by 1.5% agarose gel electrophoresis.
[0113] The PCR amplification products were sent to a sequencing company for sequence polymorphism detection. The nucleotide sequences of the PCR products of 10 SNPs loci are as follows:
[0114] SNP1 - C / T mutation at 199bp, PCR product length is 223bp:
[0115] CACCAAGCGTGCATAAGAGATTGAATGAGTTCAGCATTAATAACAGGGGCTGTCCTTCTCATTACACCGACTGCCATTTCTAAAAGGCGTGTTTTAATTAATAAGGAAGCTGAAGAAAAGCATTCAGAGGAAGCACTGTCATTAGTGCAGACGGGTAAGCACAGTGTGTCATGCACGCACTTGGGCAGAACTTTTAATK(C / T)TGCTCCATCCACGACTCTTCAGGT
[0116] SNP2 - G / A mutation at 143bp, PCR product length is 224bp:
[0117] CCTGCAGGGAGGAATAACAACTTCAGGTTTTTGAGGTCTCACTCATGTCACAGAGGTAATAGTGTACCTTGAACTCAGCATCCCTGTTACAGCTTCCTCTAGTGGAGCTATGCAGCAAAGCGTTCTCTCTTCGTCCTTAGAGK(G / A)GAAATGGGCTATGTGGCAGTATGGTTCATCTGCCCAGTTTCAGCTCCTCGTGGCTAACATTAATGGTGCTGTAAAGGTGCC
[0118] SNP3 - A / G mutation at 112bp, PCR product length is 219bp:
[0119] GAAATGGGCTATGTGGCAGTATGGTTCATCTGCCCAGTTTCAGCTCCTCGTGGCTAACATTAATGGTGCTGTAAAGGTGCCCAGCCAACAATGCCTGTGCAGAGCGGTCACK(A / G)TTTCAGGTATAGTTACCAGTGGCATTGGTTGCCCCAGGATGCCTCTTGGAGTTGAGGACACTGGGTAGCACTGTTTCCACAGAGAAAAACAAAGGCACAAGTCCTGG
[0120] SNP4 - G / A mutation at 157bp, PCR product length is 248bp:
[0121] TGAACCCATAGGAGTTTTCCAGCTGAGCAATTACTGAAATGTCAGGATGCCTAGTCTGAATTTGCACATAAAAATGGTATACATGCATTAAAACTTAGCCTTCAAAATTATCTTGTTAAATAGTTAGAAATTAGATAGTGTAAAACAACTGACAATK(G / A)AGAAGGGAAAAGAAAAAAAAGATATTTTTAGTATGAAATACATGTATAATTGCAACTGGTGACTTTTACCTGTAAGATGGTATGCGCTGCA
[0122] SNP5 - A / G mutation at 136 bp, PCR product length is 219 bp:
[0123] GAGGGGTTGAAACTGGATGATCATTGTGGTCCTTTTCAACTCAGGCCATTCTATGATTCTATGATTCTGTATCCTGAAGGAAGTCATAAAATCAGATCATATGATAAAATTACTAACGTAAGAGGATTTGATAGGK(A / G)CTAACAACATCAAATATTTGATACGATCAGATTTGAATTTTCACATAGAATAGTCCTGCAAAATATCTGTGCACCCAGCTTTG
[0124] SNP6 - A / G mutation at 180 bp, PCR product length is 237 bp:
[0125] GCGTCAGTGGGAATAAGCTCAACAGACCAAGCTTATTAGAAATTCATGAACAACTGGCAAAGGTGAGTGAAAAGGAAACATTTGATTTTTCTCTGTTCCATTTCCAGGCTGTTAATTCTGTTTATTAATATGAAAAAGTCTTTAAATTCACGGATCTTGCCCAAGACAAAAGTACAACTK(C / A)ATCACTTACCATATTTCCTGTGGTAGCTGCAGTATGTTTTCTGCCCTGTAACCTGCT
[0126] SNP7 - A / G mutation at 63 bp, PCR product length is 227 bp:
[0127] CTGAAAGGGAGTCAGCCAAGAATCCAAGTAGGCCAATGATAAGCTTAGCACATTAGAAAGTTK(A / G)AAATATAAACATGACTCTTATAATTCCAGAAAATAACTCAAATTGTAGGCAAGTATTTTAAAATGCTGTACTTGCAGGCAAAGTAATTGCAGTAAATAATCAATGTAAAAGAGATCAAATATATAAAAACAACCTTCTGAAAACTGCTTAGTGCTGCTTTTGGA
[0128] SNP8 - G / T mutation at 102 bp, PCR product length is 202 bp:
[0129] TGCTGAAAATGTGTTGCTGAAGGAAACCAGTTTATAGGAATACACCATTATACTGGTGCTACCCATAAGGTAGGGATCAGAAACTGACAAAAACTGGTGATK(G / T)TTCTTATCTCAGAGATTTTCTCTCTTGATTTTAAGCAGGAAATCTGCAGACTACAACAGGCATGAGACAAGTCTTCTGCATGGAACAGAAACACCTGCAG
[0130] SNP9 - T / C mutation at 60 bp, PCR product length is 233 bp:
[0131] CTGCAGGGTTTGGAGCAGGCTGGCGTCCCTGCTTGGCGCCCTAGAGTGGAACCTGGCAGK(T / C)CAAACGGAAAACGTAAAGCTGGGAGAAGATACGTGTGTGCCTGAACAACGTCGCGAGCGTCCTGGCAGGATGGAAGCGGGGATTGCTGGGCTGTGGCTGTGGGGCAGACGCGGGCCTGAGCCCTACATCCCGCTCTGCTGCCGCCGCTGCGCTCCTTGCTCTGAGCCCATCAG
[0132] SNP10 - G / T mutation at 171 bp, PCR product length is 218 bp:
[0133] GAGCAGGAGGGGGAAGTGCCGTGCGGTTCCCATCGCTGCCACCACCGCCGCCGCCCAAGCGCTACTGCGGCCCCCGCGCCCCCTGCGCGGCGCGATGGGAGCCGCCTCACCAAGCCCCGCCCCGCAGCCAATGGGAGCGCGGCGGAGGTGGGACTCCGGGGAACGAGGGGK(G / T)ATTGGGCGAGAGCCACACCCGCCTCGCCGTTCTCGGCCAATGGGAAG
[0134] Note: K marked in the above sequence is the mutation site, and the base in the parentheses is the mutated base, which is an allelic gene mutation.
[0135] (3)Method for measuring keel length at 60 days of age: Use a vernier caliper to measure the distance from the front end to the end of the chicken keel. All keel length measurements are taken by the same person, and the measured parts are basically the same.
[0136] (4)Marker-assisted selection for keel length
[0137] For SNP1 locus, the TT and CT genotypes; for the GGAA genotype produced by the linkage of SNP2 and SNP3 loci; for SNP4 locus, the AA genotype; for SNP5 locus, the GG genotype; for SNP6 locus, the CC genotype; for SNP7 locus, the GG genotype; for SNP8 locus, the TT genotype; for SNP9 locus, the CC and TC genotypes; and for SNP10 locus, the TT and GT genotypes are the dominant genotypes for keel length.
[0138] In marker-assisted breeding for keel length, by selecting individuals with dominant genotypes at SNP1 - SNP10 loci and eliminating individuals with inferior genotypes, the selection for keel length can be assisted to improve, and the breeding progress of keel length across generations can be accelerated.
[0139] Through genome-wide association analysis, 10 SNP molecular markers significantly associated with keel length were screened. Validation experiments on marker-assisted breeding for keel length in the 5th and 6th generations of the terminal sire line A of Lihua yellow-footed partridge chickens showed that the operation was simple, and it could improve keel length faster. As shown in Table 6, after two generations of breeding, the keel length of roosters increased by 1.18 mm in the 5th generation compared to the 4th generation, and by 1.02 mm in the 6th generation compared to the 5th generation, with an average increase of 1.1 mm per generation. Compared with about 0.5 mm progress in keel length per generation in the 2nd - 4th generations, the keel length in the 5th and 6th generations increased significantly, the coefficient of variation decreased significantly, and the uniformity improved significantly, accelerating the breeding progress of keel length.
[0140] Table 6 Measurement results of keel length in different generations of line A of Lihua partridge chickens
[0141]
[0142] Determination of age: 60 days
[0143] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all fall within the protection scope of the present invention.
[0144] In addition, it should be noted that, among the various specific technical features described in the above specific embodiments, without conflict, they can be combined in any appropriate way. To avoid unnecessary repetition, the present invention will not separately describe various possible combination methods.
[0145] Furthermore, any combination can be made between various different embodiments of the present invention, as long as it does not violate the idea of the present invention, and it should also be regarded as the content disclosed by the present invention.
Claims
1. Use of a SNP molecular marker combination in the assisted breeding of the keel length of yellow - footed partridge chickens, characterized in that, The SNP molecular marker combination includes a total of 10 SNP loci, namely SNP1 to SNP10, as follows: SNP1 corresponds to the 170,194,700th position on the plus strand of chromosome 1 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published by NCBI. It has a C or T polymorphism and is numbered rs315701680; SNP2 corresponds to the 15,305,633rd position on the plus strand of chromosome 3 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published by NCBI. It has a G or A polymorphism and is numbered rs738740137; SNP3 corresponds to the 15,305,745th position on the plus strand of chromosome 3 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published by NCBI. It has an A or G polymorphism and is numbered rs317223723; SNP4 corresponds to the 78,036,233rd position on the plus strand of chromosome 4 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published by NCBI. It has a G or A polymorphism and is numbered rs732443622; SNP5 corresponds to the 78,750,083rd position on the plus strand of chromosome 4 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published by NCBI. It has an A or G polymorphism and is numbered rs315667756; SNP6 corresponds to the 10,111,788th position on the plus strand of chromosome 10 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published by NCBI. It has a C or A polymorphism and is numbered rs314381113; SNP7 corresponds to the 10,468,445th position on the plus strand of chromosome 10 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published by NCBI. It has an A or G polymorphism and is numbered rs732811384; SNP8 corresponds to the 10,534,417th position on the plus strand of chromosome 10 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published by NCBI. It has a G or T polymorphism and is numbered rs314197610; SNP9 corresponds to the 13,797,770th position on the plus strand of chromosome 14 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published by NCBI. It has a T or C polymorphism and is numbered rs13782000; SNP10 corresponds to the 1,536,829th position on the plus strand of chromosome 24 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI. It is a G or T polymorphism with the number rs737401141; The dominant genotypes of the SNP1 locus are TT and CT, the dominant genotype produced by the linkage of the SNP2 and SNP3 loci is GGAA, the dominant genotype of the SNP4 locus is AA, the dominant genotype of the SNP5 locus is GG, the dominant genotype of the SNP6 locus is CC, the dominant genotype of the SNP7 locus is GG, the dominant genotype of the SNP8 locus is TT, the dominant genotypes of the SNP9 locus are CC and TC, and the dominant genotypes of the SNP10 locus are TT and GT; The chickens to be selected and bred with the dominant genotype are individuals with relatively long keel lengths.
2. A breeding method for improving the keel length of yellow - footed partridge chickens, characterized in that, It includes the following steps: (1) Determine the genotypes of the chickens to be selected and bred, and the genotypes are the genotypes of the SNP molecular marker combination described in claim 1; (2) Select and retain individuals with the dominant genotypes TT and CT at the SNP1 locus, the dominant genotype GGAA produced by the linkage of the SNP2 and SNP3 loci, the dominant genotype AA at the SNP4 locus, the dominant genotype GG at the SNP5 locus, the dominant genotype CC at the SNP6 locus, the dominant genotype GG at the SNP7 locus, the dominant genotype TT at the SNP8 locus, the dominant genotypes CC and TC at the SNP9 locus, and the dominant genotypes TT and GT at the SNP10 locus.
3. The breeding method according to claim 2, characterized in that, In step (1), the method for determining the genotypes of the chickens to be selected and bred is: (1.1) Extract the total genomic DNA of the chickens to be tested; (1.2) According to the SNP molecular marker combination, use the corresponding primer pairs to amplify the target sequence by PCR method. The sequences of the primer pairs are: SNP1F: 5’ CACCAAGCGTGCATAAGAGA3’ SNP1R: 5’ ACCTGAAGAGTCGTGGATGG3’ SNP2F: 5’ CCTGCAGGGAGGAATAACAA3’ SNP2R: 5’ GGCACCTTTACAGCACCATT3’ SNP3F: 5’ GAAATGGGCTATGTGGCAGT3’ SNP3R: 5’ CCAGGACTTGTGCCTTTGTT3’ SNP4F: 5’ TGAACCCATAGGAGTTTTCCA3’ SNP4R: 5’TGCAGCGCATACCATCTTAC3’ SNP5F: 5’ GAGGGGTTGAAACTGGATGA3’ SNP5R: 5’CAAAGCTGGGTGCACAGATA3’ SNP6F: 5’ GCGTCAGTGGGAATAAGCTC3’ SNP6R: 5’AGCAGGTTACAGGGCAGAAA3’ SNP7F: 5’ CTGAAAGGGAGTCAGCCAAG3’ SNP7R: 5’TCCAAAAGCAGCACTAAGCA3’ SNP8F: 5’ TGCTGAAAATGTGTTGCTGA3’ SNP8R: 5’CTGCAGGTGTTTCTGTTCCA3’ SNP9F: 5’ CTGCAGGGTTTGGAGCAGGC3’ SNP9R: 5’CTGATGGGCTCAGAGCAAG3’ SNP10F: 5’GAGCAGGAGGGGGAAGTG3’ SNP10R: 5’CTTCCCATTGGCCGAGAAC3’; (1.3) After sequencing the PCR amplification product, judge the genotype.
4. The breeding method according to claim 3, characterized in that The nucleotide sequences of the PCR amplification products are shown in SEQ ID NO.1~SEQ ID NO.10, and the lengths of the PCR products are 223bp, 224bp, 219bp, 248bp, 219bp, 237bp, 227bp, 202bp, 233bp, 218bp.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) site located on chromosome 7 and related to chicken growth traits and application
CN116837110A
Application of genetic marker related to chicken keel length in chicken genetic breeding
CN117551783A