SNP (Single Nucleotide Polymorphism) molecular marker related to lactation character of buffalo and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a lactation character of a buffalo and application of the SNP molecular marker. The SNP molecular marker is respectively positioned at the 51th basic group site of Chr242975096, Chr6116041914, Chr6116041915, Chr9103233736 and Chr2326490196, and the nucleotide sequences of the five chromosomes are specifically shown as SEQ ID NO.1-5. The SNP molecular marker can be used for detecting the lactation character of the buffalo. Compared with the prior art, the five SNP molecular markers related to the buffalo lactation character are screened and extracted, and are used for breeding buffalo individuals with high daily average milk yield, so that the breeding time is effectively shortened, and the breeding cost is reduced.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and in particular to a SNP molecular marker associated with buffalo lactation traits and an application thereof. Background Art

[0002] As an important source of milk, buffalo dairy products have important economic and nutritional value worldwide. Especially in Asia, Africa and South America, buffalo milk is the main source of protein and calcium for many families. Buffalo milk is rich in fat, protein and lactose, and its nutritional content is superior to many other dairy products, which makes it popular in the market. In addition, buffalo milk is also used to make a variety of dairy products such as cheese, yogurt and butter, which have unique flavors and textures, further enhancing their commercial value. Buffalo milk has become the world's second largest source of milk after ordinary milk. According to the Food and Agriculture Organization of the United Nations (FAO), the global buffalo milk production in 2022 was about 143.573 million tons. Guangxi Zhuang Autonomous Region is the largest buffalo milk producing province in my country. In 2022, my country's buffalo milk production was about 2.895 million tons, ranking third in the world.

[0003] Lactation ability is one of the important indicators for evaluating the production performance of dairy cows, which usually includes average daily milk yield, milk fat rate, milk protein rate, lactose content and somatic cell count. Average daily milk yield is one of the most basic lactation indicators, which directly reflects the production performance of dairy cows. Milk fat rate and milk protein rate affect the quality and economic benefits of dairy products, and somatic cell count is an important indicator for evaluating the health of dairy cows' udders. Improving lactation indicators can not only increase the economic benefits of dairy farms, but also improve the quality and market competitiveness of dairy products. Average daily milk yield refers to the average amount of milk produced by dairy cows every day during the lactation period. It is an important basis for evaluating the production performance of dairy cows and selecting excellent breeds. Factors affecting average daily milk yield include genetic background, feeding management, nutritional level and environmental conditions. In terms of genetic background, there are significant differences between different breeds and individuals. Therefore, increasing average daily milk yield through genetic improvement has become one of the important goals of dairy cow breeding. Summary of the invention

[0004] The purpose of the present invention is to provide a SNP molecular marker related to the lactation trait of buffalo and its application, aiming to overcome the defects of long time required for breeding buffalo individuals with good lactation function and high daily milk yield and low efficiency of traditional breeding.

[0005] To achieve the above objectives, the present invention provides a SNP molecular marker associated with buffalo lactation traits, wherein the SNP molecular marker is located at the 51st base site in Chr2_42975096, Chr6_116041914, Chr6_116041915, Chr9_103233736, and Chr23_26490196, respectively, and the nucleotide sequences of the above five chromosomes are specifically shown in SEQID NO.1-5.

[0006] Chr2_42975096 is shown in EQ ID NO. 1, and the nucleotide sequence is as follows: CACCCATT TGGCAGGACCTGGAATTCTTGTTTGAAGGGAAAGAATTCTCTTCCCTGG CTTCTGTGGGGGCCTCCCACCTGGCTCCCTTCTCTCCGTTCAG(C / T)CCA GAGCACATCCCAGAGTCTAGCCATCTGGGGCTCTGCAGCTCCCTGGACC CTGAGAAAGCCCTGGACGTGCAGTTCTGAGGCTGAAGTGGGCCGGGG G;

[0007] Chr6_116041914 is shown in EQ ID NO. 2, and the nucleotide sequence is as follows: AAAGAAT CCGCCTGCAATGCGGGAGACCTGGGTTCAGTCCCTGGGTTGGGAAGATCCCTGGAGAAGGGAATGGCTACCCACTCCAGTATTCTGGCCTGG (A / G)GAATTCCATGGACTATATGGTCCATGGGTCGCAGAGTCGGACACGACTGA GTGACTCTCACTTTAGCTCTATCAGACTCTATCGTCCCCAGCCTCCAAG A;

[0008] Chr6_116041915 is shown in EQ ID NO.3, and the nucleotide sequence is as follows: AAGAATC CGCCTGCAATGCGGGAGACCTGGGTTCAGTCCCTGGGTTGGGAAGATCC CCTGGAGAAGGGAATGGCTACCCACTCCAGTATTCTGGCCTGGA(G / A)AATTCCATGGACTATATGGTCCATGGGTCGCAGAGTCGGACACGACTGAG TGACTCTCACTTTAGCTCTATCAGACTCTATCGTCCCCAGCCTCCAAGAT;

[0009] Chr9_103233736 is shown in EQ ID NO. 4, and the nucleotide sequence is as follows: TTTTTAAT GTGTTGTTGGATTCTGATTGCTAGAATTTTGTTAAGGATTTTTGCATCTAT GTTCATCAGTGATATTGGCCTGTAGTTTTCTTTTTTTGTGG(C / G)ATCTTTG TCAGGTTTTGCCACTAGGGTGATGATGGCCTCATAGAATGAGTTTGGAA GTTTACCTTCCTCTGCAATTGTCTGGAAGAGTTTGAGTAGGATA;

[0010] Chr23_26490196 is shown as EQ ID NO.5, and the nucleotide sequence is as follows: TCAACCC TTCCAATGAATATTCAGCACTGAATTCCTTTAGAATAGACCGGTTGGATC TCCTTGCAGTCCAAGGGACTCTCAAGAGTCTTCTCCAACACCA(C / G)GG TTCAAAAGCATCAATTCTCAGGCACTCAGCTTTCTTTATAATCCAACTTT CTTTTATAATCCGACAACAGGAAAAAATATAGCTTTGACTGGACGGAA.

[0011] Preferably, in the above technical solution, the SNP molecular marker is specifically located at the 51st base position of Chr2_42975096, and the 51st base position is C or T;

[0012] The SNP molecular marker is specifically located at the 51st base position of Chr6_116041914, and the 51st base position is A or G;

[0013] The SNP molecular marker is specifically located at the 51st base position of Chr6_116041915, and the 51st base position is G or A

[0014] The SNP molecular marker is specifically located at the 51st base position of Chr9_103233736, and the 51st base position is C or G;

[0015] The SNP molecular marker is specifically located at the 51st base position of Chr23_26490196, and the 51st base position is C or G.

[0016] Preferably, in the above technical solution, the dominant allele base at the 51st base position of Chr2_42975096 is T, and the dominant genotype is TT type;

[0017] The dominant allele base at the 51st base position of Chr6_116041914 is G, and the dominant genotypes are GG type and AG type;

[0018] The dominant allele base at the 51st base position of Chr6_116041915 is G, and the dominant genotype is GA type;

[0019] The dominant allele base at the 51st base position of Chr9_103233736 is G, and the dominant genotypes are CG type and GG type;

[0020] The dominant allele base at the 51st base position of Chr23_26490196 is G, and the dominant genotypes are GG and CG.

[0021] A primer set for amplifying any of the above-mentioned SNP molecular markers associated with buffalo lactation traits.

[0022] Preferably, in the above technical solution, the primer set includes a first primer pair, a second primer pair, a third primer pair, a fourth primer pair, and a fifth primer pair, which are specifically as follows:

[0023] The first primer pair is used to amplify Chr2_42975096, and the first primer pair includes a forward primer SEQ ID NO.6 and a reverse primer SEQ ID NO.7;

[0024] The second primer pair is used to amplify Chr6_116041914, and the second primer pair includes a forward primer SEQ ID NO.8 and a reverse primer SEQ ID NO.9;

[0025] The third primer pair is used to amplify Chr6_116041915, and the third primer pair includes a forward primer SEQ ID NO.10 and a reverse primer SEQ ID NO.11;

[0026] The fourth primer pair is used to amplify Chr9_103233736, and the fourth primer pair includes a forward primer SEQ ID NO.12 and a reverse primer SEQ ID NO.13;

[0027] The fifth primer pair is used to amplify Chr23_26490196, and the fifth primer pair includes a forward primer SEQ ID NO.14 and a reverse primer SEQ ID NO.15.

[0028] The nucleotide sequence of SEQ ID NO.6 is CTCTTCCCTGGCTTCTGTGG, the nucleotide sequence of SEQ ID NO.7 is CCATCCCACTTCCTGTTCCC, the nucleotide sequence of SEQ ID NO.8 is GAGTCGGACACGACTGAGTG, the nucleotide sequence of SEQ ID NO.9 is GAAGGGTCAGTGGGAACGAG, the nucleotide sequence of SEQ ID NO.10 is AGTCCCTGGGTTGGGAAGAT, the nucleotide sequence of SEQ ID NO.11 is GAGTCACTCAGTCGTGTCCG, the nucleotide sequence of SEQ ID NO.12 is CCCACTTGGCCATGGTGTAT, the nucleotide sequence of SEQ ID NO.13 is ACCCATCACAAGCACGGAAA, the nucleotide sequence of SEQ ID NO.14 is CATCTCATCCTCTGCCGTCG, and the nucleotide sequence of SEQ ID NO.15 is CCGTGGTGTTGGAGAAGAC.

[0029] A kit for preparing a SNP molecular marker related to the lactation trait of buffalo using the amplification primer set as described above

[0030] An application of the amplification primer set as described above in molecular marker-assisted breeding of buffalo.

[0031] An application of the amplification primer set as described above in the identification of lactation traits of buffalo.

[0032] A method for detecting buffalo genotype using molecular biology technology, the method comprising the following steps:

[0033] Amplification primers were designed based on the nucleotide sequences on both sides of the five SNP molecular marker sites mentioned above, and the buffalo individual DNA was used as a template for amplification. The amplified products were sequenced for the first generation, and the buffalo individuals were genotyped according to the sequencing results to identify the genotype of the buffalo individual to be tested.

[0034] A method for using molecular markers to assist breeding of buffaloes, extracting genomic DNA of buffaloes, detecting the deoxynucleotide at position 42975096 of chromosome 2, detecting that the deoxynucleotide at position 42975096 is C or T, determining that the genotype of the buffalo to be tested is CC type, CT type or TT type, and selecting buffaloes with TT type genes for the next step of seed selection and / or breeding according to the breeding goal of individuals with high daily average milk production;

[0035] Extracting genomic DNA from buffaloes, detecting the deoxynucleotide at position 116041914 of chromosome 6, detecting that the deoxynucleotide at position 116041914 is A or G, determining that the genotype of the buffaloes to be tested is AA type, AG type or GG type, and selecting buffaloes with GG type and AG type genes for the next step of seed selection and / or breeding according to the breeding goal of individuals with high daily average milk production;

[0036] Extract the genomic DNA of the buffalo, detect the deoxynucleotide at the 116041915th position of chromosome 6, and detect that the deoxynucleotide at the 116041915th position is G or A, and determine that the genotype of the buffalo to be tested is GG type, GA type or AA type. According to the breeding goal of individuals with high daily average milk yield, buffalo with GG type, GA type or AA type genes are selected for the next step of selection and / or breeding. The average daily milk yield of Chr6_116041915 candidate GA type is significantly higher than that of GG type;

[0037] Extracting genomic DNA from buffaloes, detecting the deoxynucleotide at position 103233736 of chromosome 9, detecting that the deoxynucleotide at position 103233736 is C or G, determining that the genotype of the buffalo to be tested is CC type, CG type or GG type, and selecting buffaloes with CG type and GG type genes for the next step of seed selection and / or breeding according to the breeding goal of individuals with high daily average milk production;

[0038] The genomic DNA of the buffalo is extracted, and the deoxynucleotide at the 26490196th position of chromosome 23 is detected. The deoxynucleotide at the 26490196th position is detected to be C or G, and the genotype of the buffalo to be tested is determined to be CC type, CG type or GG type. According to the breeding goal of individuals with high daily average milk production, buffalo with GG type and CG type genes are selected for the next step of selection and / or breeding.

[0039] Compared with the prior art, the present invention has the following beneficial effects:

[0040] The present invention provides 5 SNPs (Chr2_42975096, Chr6_116041914, Chr6_116041915, Chr9_103233736, Chr23_26490196) related to the lactation trait of buffalo, and the 5 SNPs are significantly correlated with the average daily milk yield of buffalo (P<0.05). The 5 SNP molecular markers are applied to the genotype analysis of genes related to the lactation trait of buffalo, and a new molecular marker resource is provided for the molecular marker-assisted selection of the average daily milk yield of buffalo, so as to accelerate the breeding of improved buffalo. By detecting the dominant alleles or dominant genotypes of the 5 SNP molecular marker sites of the buffalo genomic DNA, individuals are directly bred at the genome level without relying on phenotypic information, which can significantly improve the selection efficiency, accelerate the breeding process, save intermediate feeding costs, improve the breeding efficiency, reduce the breeding cost, and have a wide range of application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] The realization of the purpose, functional features and advantages of the present invention will be further explained in conjunction with embodiments and with reference to the accompanying drawings.

[0042] Figure 1 is a Manhattan plot of daily average milk yield of genome-wide association analysis related to lactation traits of buffaloes of the present invention;

[0043] Figure 2 It is a QQ graph of genome-wide association analysis related to lactation traits of buffaloes of the present invention. DETAILED DESCRIPTION

[0044] Although not otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as those commonly understood by those skilled in the art. Terms with definitions in dictionaries should be interpreted as having the same meaning as those disclosed in the relevant technical literature and this article, and should not be interpreted in an idealized or overly formal sense.

[0045] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0046] Example 1

[0047] A SNP molecular marker associated with a lactation trait of a buffalo, wherein the phenotype of the SNP molecular marker combination is to show the average daily milk production trait of the buffalo, and the screening and development method thereof is as follows:

[0048] (1) Data are from the pedigree, production records, and lactation trait records of 1 local buffalo, 46 ​​hybrid buffaloes, 31 buffaloes, and 42 Murrah buffaloes (a total of 120 buffaloes) raised at the Guangxi Buffalo Research Institute in China from 2000 to 2021. The characteristic average daily milk yield is defined as the highest daily milk yield of lactating cows in this parity, in kilograms.

[0049] (2) Sample collection and sequencing

[0050] Genomic DNA was extracted from blood using the phenol / chloroform method. The integrity and yield of genomic DNA were assessed and verified using agarose gel electrophoresis.

[0051] The genomic DNA was digested with restriction endonucleases, and then barcoded sequencing adapters were added. The samples were mixed to construct a small fragment library (300-400 bp) and sequenced using the Illumina HiSeqTM 2000 system (Illumina, San Diego, CA).

[0052] (3) Phenotypic data collation and analysis: The phenotypic data collected in step (1) were statistically analyzed using R software, including minimum, maximum, mean, and standard deviation. The results are shown in Table 1

[0053] Table 1 Statistical analysis of buffalo phenotyping data

[0054]

[0055]

[0056] (4) DNA extraction and sequencing: Blood samples were collected from the jugular vein of buffalo using a vacuum blood collector, and genomic DNA was extracted using the phenol / chloroform method in the Molecular Cloning Experiment Guide IV. DNA purity was tested using an ultraviolet spectrophotometer. After passing the test, the samples were sent to Guangzhou Kidio Biotechnology Co., Ltd. for simplified genome resequencing. The sequencing platform was Illumina HiSeqTM2000. The data from the sequencing machine was filtered and valid information was obtained. The filtering criteria mainly included: 1) filtering out reads containing adapter sequences; 2) removing reads containing N at a ratio greater than 10%; 3) removing low-quality reads (the number of bases with a quality value of Q≤10 accounted for more than 50% of the entire read); after obtaining valid data, further sequencing quality assessment was performed to check the error rate distribution; the sequencing error rate and accuracy are shown in Table 2;

[0057] Table 2 Statistics of buffalo genome DNA resequencing results

[0058]

[0059] (5) Genomic data alignment: The genomic data obtained by sequencing were aligned and analyzed using bioinformatics analysis software BWA, SAMtools, and GATK; the reference genome was the fourth edition of the buffalo reference genome (GCA_003121395.1) (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_003121395.1 / ), and the alignment software bwa (0.7.12) was used to align the filtered reads to the reference genome using the mem algorithm, with alignment parameters of -k32-M; after alignment, the results were marked using pi card (1.129) software (MarkDuplicates, etc.), but were not filtered out. The average alignment rate of the population sample was 99.54%. See Table 3 for details.

[0060] Table 3 Statistics of buffalo genome data comparison results

[0061]

[0062] (6) SNP quality control and filtering: Variant variation refers to the variation caused by the insertion or deletion of a single nucleotide or several nucleotides at the genome level to form DNA sequence polymorphism. We used the UnifiedGenotyper module of the software GATK (3.4-46) to perform variant detection on multiple samples of the processed comparison files. The detected variants were filtered using VariantFiltration with the filtering parameters of -Window 4, -filter "QD<4.0||FS>60.0||MQ<40.0", -G_filter "GQ<20". After the above steps, 2012270 SNPs were initially obtained.

[0063] Because rare alleles (alleles with very low frequency in the population), high deletion rate, high heterozygosity rate and other sites will cause abnormalities in population analysis and whole genome association analysis (linear models are very weak in handling extreme cases), which may cause the software to give wrong results, the original marker sites are filtered using a self-written perl script according to the following conditions:

[0064] 1) Removal of non-biallelic sites.

[0065] 2) Sites with minor allele frequency (MAF) less than 0.05 were removed.

[0066] 3) Sites with a deletion rate greater than 0.5 were removed.

[0067] 4) Sites with heterozygous ratios greater than 0.8 were removed.

[0068] Finally, 691,729 SNPs on autosomes were obtained for subsequent association analysis;

[0069] (7) Genome-wide association analysis (GWAS): Principal component analysis was performed using GCTA software, followed by association analysis using GEMMA software combined with phenotypic information and genomic SNP information. Within a certain trait, individuals whose phenotypic values ​​were dispersed outside the mean ± 3 times the standard deviation were eliminated, and the first three values ​​of the principal component and sex were added as covariates to the mixed linear model. The model is as follows:

[0070] y=Xα+Qβ+Kμ+e

[0071] Among them, y is the phenotype vector, X is the genotype matrix, α is the genotype effect vector, Q is the fixed effect matrix (PCA score matrix in this study), β is the fixed effect vector, K is the random effect matrix, mainly refers to the kinship matrix, μ is the random effect vector, and e is the residual vector. For each SNP site, it is tested whether α is 0. The probability value p of α being 0 is used to measure the degree of association between the marker genotype and the phenotype. The smaller the p value, the smaller the probability of α being 0, and the more likely the marker is associated with the trait.

[0072] (7) Screening and extraction of SNP molecular markers associated with the daily average milk yield of buffaloes: The sites that reached the significant association level were extracted using R software, and the significance threshold was set to the Bonferroni-adjusted genome-wide significance (0.05 / 745, 490 = 6.71 × 10 -8 ) to detect meaningful associations. Information on these loci is available in Figure 1-2 As shown in Table 4, they are associated with the average daily milk yield of buffaloes and can be used for the breeding of buffaloes for the trait of average daily milk yield.

[0073] When breeding buffaloes, the above-mentioned SNP molecular markers can be used to design primers on the nucleotide sequences on both sides of the markers. Blood is collected when the buffaloes are born and genomic DNA is extracted. The primers are used to perform genotyping on the buffalo materials to be tested, and individuals with the genotype of the target trait are retained, which can speed up the breeding process.

[0074] Table 4 Information of 5 molecular markers

[0075]

[0076]

[0077]

[0078] Example 2: Application of 5 SNP marker locus primer sets in detecting the daily average milk yield trait of buffalo

[0079] Blood was collected from the jugular vein of the selected buffaloes and genomic DNA was extracted using a blood genomic DNA extraction kit. The DNA concentration was tested using a nucleic acid concentration meter and the quality of the DNA sample was determined by 1% agarose gel electrophoresis. Amplification primers were designed for the 5 candidate SNP sites selected (as shown in Table 5). The primer sequences are:

[0080] Table 5 Primer design for 5 candidate SNP sites

[0081]

[0082] Note: F in the table refers to the upstream primer Forwardprimer, and R refers to the downstream primer Reverseprimer

[0083] The above primers were used to perform PCR amplification with buffalo blood genomic DNA as template. A 50 μL PCR reaction system was used: ddH2O 19 μL, Premix Taq TM 25 μL, DNA template 2.0 μL, primers (upstream primer and downstream primer are both 10 μmol / L) 2.0 μL each.

[0084] PCR reaction conditions:

[0085] Pre-denaturation at 95°C for 4 min; denaturation at 94°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 5 min.

[0086] The PCR amplification product was purified using the Gel Extraction Kit of Shanghai Shenggong Bioengineering Co., Ltd. The specific steps are shown in the kit instructions. The PCR purification product obtained above was recovered and directly sent to BGI (Shenzhen) Biotechnology Co., Ltd. for first-generation sequencing. The individual genotypes were performed according to the sequencing results. The genotyping results are shown in Table 6.

[0087] Table 6 Genotype frequency and allele frequency of the five candidate SNP loci in buffalo

[0088]

[0089] From Table 6 , it can be seen that the C allele frequency of the Chr2_429750967 mutation site is significantly greater than the T allele frequency;

[0090] The A allele frequency of the Chr6_116041914 mutation site is significantly greater than the G allele frequency;

[0091] The G allele frequency of the Chr6_116041915 mutation site is significantly greater than the A allele frequency;

[0092] The C allele frequency of the Chr9_103233736 mutation site is significantly greater than the G allele frequency;

[0093] The G allele frequency of the Chr23_26490196 mutation site is significantly greater than the G allele frequency.

[0094] Table 7 Verification of SNPs significantly associated with daily milk yield of buffalo

[0095]

[0096]

[0097] The daily average milk yield phenotypic value was expressed as "least square mean ± standard deviation". Data in the same column with different letters on the shoulders indicated significant differences (P<0.05); data with the same letters on the shoulders or no letters on the shoulders indicated no significant differences (P>0.05); SNP locus genotypes were arranged in the order of reference type, heterozygous type, and mutant type.

[0098] As can be seen from Table 7, the average daily milk yield of buffaloes with different genotypes of candidates Chr6_116041914, Chr6_116041914, Chr6_116041915, Chr9_103233736, and Chr23_26490196 was found to be significantly different.

[0099] Chr2_42975096 The average daily milk yield of candidate TT buffalo individuals was significantly higher than that of CT or CC buffalo individuals;

[0100] Chr6_116041914 The average daily milk yield of candidate GG or AG buffalo individuals was significantly higher than that of AA buffalo individuals;

[0101] Chr6_116041915 The average daily milk yield of candidate GA buffalo individuals was significantly higher than that of GG buffalo individuals;

[0102] Chr9_103233736 The average daily milk yield of candidate CG or GG buffalo individuals was significantly higher than that of CC buffalo individuals;

[0103] The average daily milk yield of Chr23_26490196 candidate GG or CG buffalo individuals was significantly higher than that of CC buffalo individuals.

[0104] It can increase milk production and can be used as a molecular marker to identify the average daily milk production of buffaloes to assist breeding and apply it to production.

[0105] Embodiment 3:

[0106] A method for using molecular markers to assist breeding of buffaloes, the method comprising: using the above five SNP molecular markers to respectively design amplification primers on the nucleotide sequences on both sides of the markers during buffalo breeding, collecting blood from the jugular vein of the buffaloes when the buffaloes are 3-6 months old, extracting genomic DNA using a blood genomic DNA extraction kit, performing PCR amplification using buffalo individual DNA as a template, sequencing the amplified products, performing genotyping based on the sequencing results, retaining individuals with target trait genotypes, thereby shortening the breeding period and accelerating the breeding speed.

[0107] The method for selecting / assisted selecting buffalo breeds or strains related to the average daily milk production trait of buffaloes using the SNP molecular markers of the present application is:

[0108] Extracting genomic DNA from buffaloes, detecting the deoxynucleotide at position 42975096 of chromosome 2, detecting that the deoxynucleotide at position 42975096 is C or T, determining that the genotype of the buffaloes to be tested is CC type, CT type or TT type, and selecting buffaloes with TT type genes for the next step of seed selection and / or breeding according to the breeding goal of individuals with high daily average milk production;

[0109] Extracting genomic DNA from buffaloes, detecting the deoxynucleotide at position 116041914 of chromosome 6, detecting that the deoxynucleotide at position 116041914 is A or G, determining that the genotype of the buffalo to be tested is AA type, AG type or GG type, and selecting buffaloes with GG type and AG type genes for the next step of seed selection and / or breeding according to the breeding goal of individuals with high daily average milk production;

[0110] Extracting genomic DNA from buffaloes, detecting the deoxynucleotide at position 116041915 of chromosome 6, detecting that the deoxynucleotide at position 116041915 is G or A, determining that the genotype of the buffaloes to be tested is GG type, GA type or AA type, and selecting buffaloes with GA type genes for the next step of seed selection and / or breeding according to the breeding goal of individuals with high daily average milk production;

[0111] Extracting genomic DNA from buffalo, detecting the deoxynucleotide at position 103233736 of chromosome 9, detecting that the deoxynucleotide at position 103233736 is C or G, determining that the genotype of the buffalo to be tested is CC type, CG type or GG type, and selecting buffalo with CG type and GG type genes for the next step of seed selection and / or breeding according to the breeding goal of individuals with high daily average milk production;

[0112] The genomic DNA of the buffalo is extracted, and the deoxynucleotide at the 26490196th position of chromosome 23 is detected. The deoxynucleotide at the 26490196th position is detected to be C or G, and the genotype of the buffalo to be tested is determined to be CC type, CG type or GG type. According to the breeding goal of individuals with high daily average milk production, buffalo with GG type and CG type genes are selected for the next step of selection and / or breeding.

[0113] The present invention can be implemented in various ways and is not limited to the embodiments described. A person skilled in the art can understand that the present invention can be implemented in other specific ways without changing the technical concept or essential features of the present invention. Therefore, it should be understood that the embodiments described above are exemplary and are not intended to limit the present invention.

Claims

1. A SNP molecular marker associated with buffalo lactation traits, characterized in that: The SNP molecular markers are located at the 51st base position in Chr2_42975096, Chr6_116041914, Chr6_116041915, Chr9_103233736, and Chr23_26490196, respectively. The nucleotide sequences of the above five chromosomes are specifically shown in SEQ ID NO.1-5.

2. The SNP molecular marker associated with the lactation trait of buffalo according to claim 1, characterized in that: The SNP molecular marker is specifically located at the 51st base position of Chr2_42975096, and the 51st base position is C or T; The SNP molecular marker is specifically located at the 51st base position of Chr6_116041914, and the 51st base position is A or G; The SNP molecular marker is specifically located at the 51st base position of Chr6_116041915, and the 51st base position is G or A The SNP molecular marker is specifically located at the 51st base position of Chr9_103233736, and the 51st base position is C or G; The SNP molecular marker is specifically located at the 51st base position of Chr23_26490196, and the 51st base position is C or G.

3. The SNP molecular marker associated with the lactation trait of buffalo according to claim 2, characterized in that: The dominant allele base at the 51st base position of Chr2_42975096 is T, and the dominant genotype is TT type; The dominant allele base at the 51st base position of Chr6_116041914 is G, and the dominant genotypes are GG type and AG type; The dominant allele base at the 51st base position of Chr6_116041915 is G, and the dominant genotype is GA type; The dominant allele base at the 51st base position of Chr9_103233736 is G, and the dominant genotypes are CG type and GG type; The dominant allele base at the 51st base position of Chr23_26490196 is G, and the dominant genotypes are GG and CG.

4. A primer set for amplifying the SNP molecular marker associated with the lactation trait of buffalo as claimed in any one of claims 1 to 3.

5. The primer set for SNP molecular markers related to buffalo lactation traits according to claim 4, characterized in that: The primer set includes a first primer pair, a second primer pair, a third primer pair, a fourth primer pair, and a fifth primer pair, which are specifically as follows: The first primer pair is used to amplify Chr2_42975096, and the first primer pair includes a forward primer SEQ ID NO.6 and a reverse primer SEQ ID NO.7; The second primer pair is used to amplify Chr6_116041914, and the second primer pair includes a forward primer SEQ ID NO.8 and a reverse primer SEQ ID NO.9; The third primer pair is used to amplify Chr6_116041915, and the third primer pair includes a forward primer SEQ ID NO.10 and a reverse primer SEQ ID NO.11; The fourth primer pair is used to amplify Chr9_103233736, and the fourth primer pair includes a forward primer SEQ ID NO.12 and a reverse primer SEQ ID NO.13; The fifth primer pair is used to amplify Chr23_26490196, and the fifth primer pair includes a forward primer SEQ ID NO.14 and a reverse primer SEQ ID NO.

15.

6. A kit for preparing SNP molecular markers related to lactation traits of buffaloes using the amplification primer set as claimed in claim 5.

7. Use of the amplification primer set as claimed in claim 5 in molecular marker-assisted breeding of buffalo.

8. Use of the amplification primer set as claimed in claim 5 in the identification of lactation traits of buffalo.

9. A method for detecting buffalo genotype using molecular biology technology, characterized in that: The method The following steps are involved: According to claim 1, amplification primers are designed for the nucleotide sequences on both sides of the 5 SNP molecular marker sites, and the buffalo individual DNA is used as a template for amplification. The amplified products are sequenced for the first generation, and the buffalo individual is genotyped according to the sequencing results, thereby identifying the genotype of the buffalo individual to be tested.

10. A method for using molecular marker-assisted breeding of buffalo, characterized in that: Extracting genomic DNA from buffalo, detecting the deoxynucleotide at position 42975096 of chromosome 2, detecting that the deoxynucleotide at position 42975096 is C or T, determining that the genotype of the buffalo to be tested is CC type, CT type or TT type, and selecting buffalo with TT type gene for the next step of seed selection and / or breeding according to the breeding goal of individuals with high daily average milk production; Extracting genomic DNA from buffaloes, detecting the deoxynucleotide at position 116041914 of chromosome 6, detecting that the deoxynucleotide at position 116041914 is A or G, determining that the genotype of the buffaloes to be tested is AA type, AG type or GG type, and selecting buffaloes with GG type and AG type genes for the next step of seed selection and / or breeding according to the breeding goal of individuals with high daily average milk production; Extract the genomic DNA of the buffalo, detect the deoxynucleotide at the 116041915th position of chromosome 6, and detect that the deoxynucleotide at the 116041915th position is G or A, and determine that the genotype of the buffalo to be tested is GG type, GA type or AA type. According to the breeding goal of individuals with high daily average milk yield, buffalo with GG type, GA type or AA type genes are selected for the next step of selection and / or breeding. The average daily milk yield of Chr6_116041915 candidate GA type is significantly higher than that of GG type; Extracting genomic DNA from buffaloes, detecting the deoxynucleotide at position 103233736 of chromosome 9, detecting that the deoxynucleotide at position 103233736 is C or G, determining that the genotype of the buffalo to be tested is CC type, CG type or GG type, and selecting buffaloes with CG type and GG type genes for the next step of seed selection and / or breeding according to the breeding goal of individuals with high daily average milk production; The genomic DNA of the buffalo is extracted, and the deoxynucleotide at the 26490196th position of chromosome 23 is detected. The deoxynucleotide at the 26490196th position is detected to be C or G, and the genotype of the buffalo to be tested is determined to be CC type, CG type or GG type. According to the breeding goal of individuals with high daily average milk production, buffalo with GG type and CG type genes are selected for the next step of selection and / or breeding.

Images