Sequence combination for identifying cattle-derived components, buffalo-derived components and yak-derived components based on RPA-CRISPR / Cas12a and application of sequence combination

Abstract

The invention provides a sequence combination for identifying cattle-derived components, buffalo-derived components and yak-derived components based on RPA-CRISPR / Cas12a and application of the sequence combination, and belongs to the technical field of biological detection.The sequence combination for rapidly detecting the cattle-derived components, the yak-derived components and the buffalo-derived components based on RPA-CRISPR / Cas12a comprises an RPA primer pair for detecting the cattle-derived components, the yak-derived components and the buffalo-derived components and a specific crRNA sequence, the invention also discloses a kit prepared by using the sequence combination and a detection method for detecting cattle, yak and buffalo-derived components in food by using the kit. According to the detection method disclosed by the invention, an RPA amplification method is combined with a CRISPR / Cas12a detection method, and real-time detection is carried out by detecting a fluorescence signal; the detection method disclosed by the invention is simple and rapid, has good specificity and sensitivity, can be used for detection only by simple constant-temperature heating, and has the advantage of rapidly detecting cattle, yak and buffalo derived components on site.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a sequence combination based on RPA-CRISPR / Cas12a for identifying components of cattle, buffalo, and yak origin and its application. Background Technology

[0002] Yellow cattle, water buffalo, and yak are my country's main cattle breeds. With the continuous expansion of the market, adulteration and counterfeiting of meat products occur frequently, disrupting market order and seriously harming consumers' legitimate rights. Meanwhile, as the global meat supply chain continues to extend, the sources of raw materials for meat products are becoming increasingly diversified, and the production and processing stages are becoming more decentralized, further increasing the difficulty of traceability and the regulatory costs for regulatory authorities. Furthermore, the potential transmission risk of mad cow disease and the dietary restrictions of certain religious groups also place higher demands on the accurate identification of bovine components. Therefore, establishing a rapid, accurate, and specific detection method for identifying bovine components from yellow cattle, water buffalo, and yak is of great significance for combating meat adulteration, ensuring food safety, protecting consumer rights, and meeting religious and cultural needs.

[0003] Currently, the main methods for identifying animal-derived components include: protein immunoassay, spectroscopy, mass spectrometry, and nucleic acid amplification.

[0004] Protein immunoassay uses the affinity adsorption of antibodies to specific proteins in animals to identify species. However, it is difficult to perform effective and accurate provenance identification for samples with denatured characteristic proteins caused by processing or for closely related species with highly homologous protein sequences, which has significant limitations in practical applications.

[0005] Spectroscopy utilizes the absorption, scattering, or emission characteristics of light by chemical molecular bonds in a sample to analyze species. It is non-destructive and rapid, but the identification of results is highly dependent on the spectral database model. A massive spectral database needs to be established in advance before application. Furthermore, the spectral database model has poor transferability and universality, high maintenance costs, and is easily affected by sample matrix interference.

[0006] Mass spectrometry mainly uses the difference in mass-charge ratio of characteristic polypeptides and other biomacromolecules in a sample to identify species. It has the advantages of high sensitivity and high resolution. However, the equipment used is expensive and the operation is cumbersome and complicated. It not only requires complex sample pretreatment, but the detection is also susceptible to matrix effects. Furthermore, it has high requirements for the experimental environment and technical personnel.

[0007] Nucleic acid amplification is currently the mainstream method for detecting animal-derived species. It achieves accurate identification of different animal-derived species by amplifying and analyzing the specific DNA sequences of the target species, and has the advantages of high sensitivity and strong specificity. It is currently mainly divided into four categories: conventional PCR, real-time fluorescence PCR, digital PCR, and isothermal amplification techniques. Real-time fluorescence PCR and conventional PCR techniques are the most widely used. For example, the literature (CN201711131754-Primers and methods for detecting three source components from yak, cattle, and buffalo in beef products-Application Publication) utilizes high-resolution melting curve analysis technology to identify these three source components through single-base site differences, with a sensitivity of 0.01 ng / μL. Meanwhile, the literature (CN202011424505-Real-time fluorescence PCR detection reagents and methods for cattle, buffalo, and yak-Application Publication) uses the Taqman probe fluorescence PCR method, which identifies these three source components through the fluorescence amplification curves of the three animals, with a sensitivity of 0.025 ng / μL. The literature (Chen Xiaoyu, Lu Lixia, Xiong Xiong, et al. Identification of bovine components in beef and its products by conventional polymerase chain reaction [J]. Food and Fermentation Industries, 2019, 45(03):215-222.) shows that conventional PCR based on the Cytb gene can detect bovine components at a concentration of 0.001 ng / µL. However, this method cannot further distinguish between components from yellow cattle, buffalo, or yak. ​​In addition, the above methods still have certain limitations: conventional PCR requires gel electrophoresis, which is cumbersome and prone to aerosol pollution; quantitative real-time PCR relies on expensive thermal cycling instruments and professional operators, making it difficult to meet the needs of rapid on-site detection in resource-limited environments; although HRM technology has high sensitivity, it has stringent requirements for instrument resolution and reaction conditions, and primer design is difficult. Although digital PCR has absolute quantitative capabilities, the high cost of instruments and equipment, high sample requirements, long processing time, complex operation, high technical requirements, and high laboratory dependence limit its application and popularization at the grassroots level. Isothermal amplification techniques, such as loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), and enzyme-catalyzed recombinant isothermal amplification (ERA), do not require thermal cycling equipment, have fast reaction speeds, are easy to operate, and have low requirements for the operating environment, making them suitable for application and promotion in grassroots laboratories. However, compared with real-time fluorescence PCR, they are more prone to non-specific amplification and have a higher risk of false positives, which limits their application in the identification of animal-derived species.

[0008] In recent years, the CRISPR / Cas system has demonstrated great potential in the field of molecular diagnostics due to its high specificity in nucleic acid recognition and programmability. In particular, the CRISPR / Cas12a protein possesses not only cis-cleavage activity for specifically recognizing and cleaving target DNA, but also trans-cleavage activity for non-specific single-stranded DNA (ssDNA). When the Cas12a-crRNA complex recognizes and binds to target DNA, the trans-cleavage activity is activated, efficiently cleaving the fluorescently labeled ssDNA reporter probe in the system, thereby converting the target recognition signal into a detectable fluorescent signal. Combining the CRISPR / Cas12a system with isothermal amplification technology can fully leverage the advantages of both: it eliminates the need for thermal cycling equipment, rapidly amplifying target nucleic acids within 15-30 minutes under isothermal conditions; and the single-base level recognition specificity of the CRISPR / Cas12a system effectively avoids false positives caused by non-specific amplification. For example, literature (CN202211120428-A rapid detection method and kit for rhinoceros nucleic acid based on CRISPR fluorescence method) discloses a rapid detection method for rhinoceros-derived components based on CRISPR-Cas12a. This method achieves high-sensitivity, rapid on-site detection of rhinoceros-derived components by recognizing rhinoceros mitochondrial genes with specific crRNA and combining it with ERA amplification. Literature (CN202510535740-A primer set, detection system, and method for identifying beef and mutton sources based on LAMP-CRISPR-Cas system) uses the highly specific Cytb gene as a target, screening for highly specific and sensitive crRNA and LAMP amplification primer pairs, establishing a rapid on-site nucleic acid detection technology for sheep and beef-derived components. However, none of the above methods can distinguish whether the detected substance is specifically derived from cattle, buffalo, or yak. ​​Cattle, buffalo, and yaks belong to the same family Bovidae but to different genera or subgenera, and their genome sequences are highly similar. Finding specific target sequences that can be used for differentiation is a key challenge in technology development.

[0009] In summary, to address the shortcomings of existing technologies and practical testing needs, a method for simultaneous identification of components derived from cattle, buffalo, and yak is established that is highly sensitive, specific, easy to operate, and does not rely on expensive instruments. This provides a new technical means for the authenticity identification of meat products and food safety supervision. Summary of the Invention

[0010] To address the numerous shortcomings of existing technologies, particularly their poor stability in the detection of highly processed samples, high dependence on database models for detection results, cumbersome operation procedures, high requirements for instruments and equipment, and long detection times, as well as their low specificity and high risk of false positives, current methods are insufficient to effectively meet the application needs of local grassroots laboratories or production lines for convenient, rapid, highly specific, and easy-to-operate detection technologies. This invention designs a set of sequence combinations for the rapid detection of animal-derived components from cattle, buffalo, and yaks, using mitochondrial gene sequences as templates. These three sequence combinations include RPA amplification primer pairs, crRNA, and ssDNA. The RPA amplification primer pairs are used to achieve isothermal rapid amplification of target sequences specific to the target species. Then, the crRNA specifically guides the Cas12a enzyme to perform cis-cleave of the target sequence and trans-cleave of the ssDNA, triggering the detachment of fluorescent and quenching groups on the ssDNA and the release of fluorescence. This achieves rapid and accurate detection of animal-derived components based on changes in fluorescence signal.

[0011] This invention provides a sequence combination for identifying components of cattle, buffalo, and yak origin based on RPA-CRISPR / Cas12a, characterized in that: it includes cattle RPA primer pairs and cattle crRNA, buffalo RPA primer pairs and buffalo crRNA, yak RPA primer pairs and yak crRNA, and an ssDNA fluorescent reporter probe; the RPA primer pairs include an RPA forward primer and an RPA reverse primer; wherein,

[0012] The forward primer sequence for the yellow cattle RPA is SEQ ID NO.1: TACAACCTGTTCATAACTCTTGATCTAATGTCTT;

[0013] The reverse primer sequence for the scalper RPA is SEQ ID NO.2: TAGAATAATTTTTGGGTTTAGGGTTAGGAGTAGTAG;

[0014] The bovine crRNA sequence is SEQ ID NO.3: AAUUUCUACUAUUGUAGAUCCGUGUAAAGGAAGGCGAGAUAU;

[0015] The forward primer sequence for buffalo RPA is SEQ ID NO.4: CAATGGACCGTAATAAAATTATTTAACCCAGTAG;

[0016] The reverse primer sequence for buffalo RPA is SEQ ID NO.5: GAATTAAGACGGTTATGATAGGCATTATGTTTC;

[0017] The buffalo crRNA sequence is SEQ ID NO.6: AAUUUCUACUAUUGUAGAUUACUAUUCAUAGCUAACUCCACC;

[0018] The forward primer sequence for yak RPA is SEQ ID NO.7: CCACTATTTTATTAACCATTATACTAGGAACCAT;

[0019] The reverse primer sequence for yak RPA is SEQ ID NO.8: GTAGATGATTAGGTTTAGTAATGTTATAGTAGGG;

[0020] The yak crRNA sequence is SEQ ID NO.9: AAUUUCUACUAUUGUAGAUAUCCUACUGACAUGACAAAAACU;

[0021] The ssDNA fluorescent reporter probe sequence is: TTATTATT.

[0022] The crRNA is modified with at least one of OMe or thiomodification at its 5' and 3' ends; the ssDNA fluorescent reporter probe is modified with a FAM fluorescent group at its 5' end and a BHQ1 quenching group at its 3' end.

[0023] Preferably, the crRNA has one thiomodification at the 5' end, one OMe modification and two thiomodifications at the 3' end.

[0024] This invention also provides a detection kit for identifying components of cattle, buffalo, and yak origin based on RPA-CRISPR / Cas12a, characterized in that: it comprises the sequence combination for identifying components of cattle, buffalo, and yak origin based on RPA-CRISPR / Cas12a, recombinase, single-stranded DNA binding protein, strand displacement DNA polymerase, rehydration buffer, MgOAC solution, Cas12a enzyme, HOLMES Buffer solution, and ddH2O.

[0025] Among them, the Cas12a enzyme is one of LbCas12a, Lb5Cas12a, FnCas12a, and AsCas12a.

[0026] Preferably, the Cas12a enzyme is Lb5Cas12a.

[0027] This invention also provides a detection kit based on RPA-CRISPR / Cas12a for identifying components of cattle, buffalo, and yak origin, and its application in identifying components of cattle, buffalo, and yak origin in food.

[0028] This invention also provides a method for identifying components of cattle, buffalo, and yak origin in food based on RPA-CRISPR / Cas12a, characterized by comprising the following steps:

[0029] a. Extracting DNA from the sample: Use an extraction kit to extract genomic DNA from the sample;

[0030] b. Using genomic DNA as template DNA, perform RPA amplification reaction using the detection kit described above to obtain RPA amplification products;

[0031] c. Using the aforementioned detection kit, the RPA amplification product was subjected to a CRISPR / Cas12a reaction for fluorescence detection.

[0032] in:

[0033] Step b: The total volume of the reaction system used for RPA amplification is 50 μL, including rehydration buffer, RPA forward primer, RPA reverse primer, DNA template and ddH2O. After mixing, place it into a tube containing recombinase, single-stranded DNA binding protein and strand displacement DNA polymerase lyophilized powder, add MgOAc solution, vortex to mix, centrifuge briefly and incubate at 37~39 ℃ for 15~20 min;

[0034] Step c: The total volume of the CRISPR / Cas12a reaction system is 20 μL, including HOLMES Buffer, Lb5Cas12a, crRNA, ssDNA fluorescent reporter probe, ddH2O, and RPA amplification product. Incubate at 37~39 ℃ for 20~30 min and perform real-time fluorescence detection.

[0035] The present invention also provides a detection method based on RPA-CRISPR / Cas12a for identifying components of cattle, buffalo, and yak origin in food, and its application in identifying components of cattle, buffalo, and yak origin in food.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] 1. The method of this invention is based on species-specific DNA sequences for species identification, has higher thermal stability, is not easily affected by pigments and matrices, and can stably achieve the detection and analysis of animal origin.

[0038] 2. The method of the present invention operates at a constant temperature of 37°C throughout the process, which is time-saving, convenient to operate, requires no high-temperature thermal cycling and precise temperature control, has low energy consumption and low instrument cost, and is suitable for promotion and application in low-resource areas.

[0039] 3. The technology of this invention is based on RPA-CrisprCas12a technology to detect animal-derived components. The RPA-specific amplification and crRNA-specific secondary recognition guidance mechanism solve the problems of non-specific amplification and high false positive rate of isothermal amplification. Attached Figure Description

[0040] Figure 1 The image shows the test results for the yak-derived detection combination (Group 1).

[0041] Figure 2 The image shows the test results for the yak-derived detection combination (Group 2).

[0042] Figure 3 The image shows the test results for the yak-derived detection combination (Group 3).

[0043] Figure 4 The image shows the test results for the yak-derived detection combination (group 4).

[0044] Figure 5 The image shows the test results for the buffalo-derived detection combination (Group 1).

[0045] Figure 6 The image shows the test results for the buffalo-derived detection combination (Group 2).

[0046] Figure 7 The image shows the test results for the buffalo-derived detection combination (Group 3).

[0047] Figure 8 The image shows the test results for the bovine-derived genetic testing combination (Group 1).

[0048] Figure 9 The image shows the test results of the bovine-derived genetic testing combination (Group 2).

[0049] Figure 10 The image shows the test results of the bovine-derived genetic testing combination (Group 3).

[0050] Figure 11 Fluorescence detection curves for different Cas12a enzyme and crRNA concentration gradients;

[0051] Figure 12 Fluorescence detection curves for different ssDNA concentration gradients;

[0052] Figure 13 This is a diagram showing the species-specific test results of the bovine-derived nucleic acid combination in this invention;

[0053] Figure 14 The figure shows the sensitivity test results of the bovine-derived nucleic acid combination in this invention.

[0054] Figure 15This is a graph showing the cross-specificity test results of the bovine-derived nucleic acid combination in high-background samples in this invention;

[0055] Figure 16 This is a graph showing the species-specific test results of the buffalo-derived nucleic acid combination in this invention;

[0056] Figure 17 This is a graph showing the sensitivity test results of the buffalo-derived nucleic acid combination in this invention;

[0057] Figure 18 This is a graph showing the cross-specificity test results of the buffalo-derived nucleic acid combination in high-background samples in this invention;

[0058] Figure 19 This is a figure showing the species-specific test results of the nucleic acid combination of yak-derived components in this invention;

[0059] Figure 20 This is a graph showing the sensitivity test results of the yak-derived nucleic acid combination in this invention;

[0060] Figure 21 This is a graph showing the cross-specificity test results of the yak-derived nucleic acid combination in high-background samples in this invention;

[0061] Figure 22 The image shows the positive test results for bovine-derived nucleic acid combinations.

[0062] Figure 23 The image shows the results of a bovine-derived nucleic acid combination test for bovine specificity. Detailed Implementation

[0063] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from the spirit and substance of the present invention shall fall within the scope of the present invention.

[0064] Example 1: A method for detecting components of cattle, buffalo, and yak origin based on RPA-CRISPR / Cas12a according to the present invention.

[0065] The detection method includes the following steps:

[0066] 1. Sample DNA extraction:

[0067] Genomic DNA was extracted from the sample using the Tiangen DNA Extraction Kit. The extraction method was in accordance with the kit's instructions, or other recognized DNA extraction methods or commercial DNA extraction kits with the same efficacy were used. After DNA extraction, the sample was stored for later use.

[0068] 2. RPA isothermal amplification:

[0069] Using the sample DNA extracted in step (1) as a template, RPA amplification was performed using corresponding RPA primers for cattle, buffalo, and yak to rapidly obtain species-specific target gene sequences. The reaction system consisted of 50 μL, including: 1 tube of lyophilized reaction powder (containing recombinase, single-stranded DNA binding protein, and strand displacement DNA polymerase), 29.5 µL of rehydration buffer, 2.5 µL of 10 µM RPA forward primer (adding cattle RPA forward primer SEQ ID NO.1, buffalo RPA forward primer SEQ ID NO.4, or yak RPA forward primer SEQ ID NO.7), 2.5 µL of 10 µM RPA reverse primer (corresponding to the forward primer, adding cattle RPA reverse primer SEQ ID NO.2, buffalo RPA reverse primer SEQ ID NO.5, or yak RPA reverse primer SEQ ID NO.8), 10 µL of ddH2O, 3 µL of DNA template, and 280 mM MgOAc. 2.5µL, incubate at 37~39℃ for 15~20min.

[0070] 3. CRISPRCas12a reaction:

[0071] The RPA amplification products obtained in step (2) were subjected to a second-stage CrisprCas12a reaction. The reaction system was 20 μL, including 2 µL of 10×HOLMES Buffer, 0.1 µL of 10 µM Cas12a enzyme (Lb5Cas12a), 0.1 µL of 10 µM crRNA (corresponding to the RPA primers above, add bovine crRNA SEQ ID NO.3, buffalo crRNA SEQ ID NO.6, or yak crRNA SEQ ID NO.9), 1 µL of 10 µM ssDNA, 2 µL of the corresponding RPA amplification product, and ddH2O to make up to 20 µL. The prepared CrisprCas12a system was incubated at 37~39℃ for 20~30 min. The fluorescence value of the reaction tube during incubation was read using a fluorescence reading device (such as a fluorescence reader or a constant temperature fluorescence amplification instrument). The Cas12a enzyme can also be selected from one of LbCas12a, Lb5Cas12a, FnCas12a, and AsCas12a.

[0072] Example 2: This invention relates to the screening of RPA primer pairs and crRNA for detecting components of cattle, buffalo, and yak origin based on RPA-CRISPR / Cas12a, as well as the optimization of the reaction system.

[0073] 1. Screening of RPA primer pairs and crRNA for detecting components of cattle, buffalo, and yak origin based on RPA-CRISPR / Cas12a.

[0074] Using the mitochondrial genomes of common cattle / yellow cattle, buffalo, and yak as templates, sequence alignment was performed to screen long sequences that are highly conserved within species and contain multiple variable regions between species as candidate targets. RPA isothermal amplification primers and specific crRNAs were designed for each candidate region. The detection effect of the RPA-crRNA combination was evaluated using closely related species. Finally, a detection system with both high specificity and high sensitivity was selected, and the sequences corresponding to the RPA primers and crRNAs were determined as the final target gene sequences. Four yak-derived detection combinations (see Table 1 for details), three buffalo-derived detection combinations (see Table 2 for details), and three common cattle / yellow cattle-derived detection combinations (see Table 3 for details) were compared and tested.

[0075] Table 1. Information on Yak-Derived Detection Combinations

[0076]

[0077] Table 2 Information on Buffalo-derived Detection Combinations

[0078]

[0079] Table 3 Information on the combination of bovine-derived test results

[0080]

[0081] The above-mentioned source combinations were used to test and evaluate the performance of three bovine-derived components: common cattle / yellow cattle, buffalo, and yak. ​​RPA amplification primers from each group were used to perform isothermal rapid amplification on yellow cattle, buffalo, yak, and blank control samples, respectively. The amplification system consisted of one tube of lyophilized reaction powder (containing recombinase, single-stranded DNA binding protein, and strand displacement DNA polymerase), 29.5 µL of rehydration buffer, 2.5 µL of 10 µM RPA forward primer, 2.5 µL of 10 µM RPA reverse primer, 10 µL of ddH2O, 3 µL of sample DNA template, and 2.5 µL of 280 mM MgOAc. The RPA amplification products were then subjected to a second-stage CRISPR-Cas12a reaction. The reaction system was as follows: 2 µL of 10×HOLMES Buffer, 0.1 µL of 10 µM Cas12a enzyme, 0.1 µL of 10 µM crRNA (crRNA from the same group as the RPA primers), 1 µL of 10 µM ssDNA, 2 µL of RPA amplification product, and ddH2O to a final volume of 20 µL. Fluorescence values ​​for each reaction tube are shown in the test results for each combination. See details below. Figures 1-10 .

[0082] Depend on Figure 1It can be seen that group 1 (SEQ ID NO. 10-12, and ssDNA) in the yak-derived detection kit also showed significant changes in fluorescence signal in cattle samples, indicating the presence of non-specific fluorescence detection signals. This suggests that group 1 (SEQ ID NO. 10-12, and ssDNA) of the yak-derived detection kit cannot be used for the accurate detection of yak-derived components. Similarly, from Figure 2 , Figure 3 It is evident that the yak-derived combinations of group 2 (SEQ ID NO.12-14, and ssDNA) and group 3 (SEQ ID NO.15-17, and ssDNA) cannot be used for the accurate detection of yak-derived components. Group 2 (SEQ ID NO.12-14, and ssDNA) showed poor detection of yak components, with fluorescence signal changes not significantly different from those of buffalo and blank controls, and even weaker than those of cattle. While group 3 (SEQ ID NO.15-17, and ssDNA) showed significant fluorescence signal changes in yak samples, it also showed significant fluorescence detection signals in cattle, failing to achieve accurate detection of yak-derived components. In contrast, the combination of yak-derived components... Figure 4 It can be seen that group 4 (SEQ ID NO.7-9 and ssDNA01) has the best performance, showing obvious changes in fluorescence signal in yak samples, while no obvious changes in fluorescence signal in cattle, buffalo, and blank control samples, indicating that it has a good identification effect on yak-derived components.

[0083] Depend on Figure 5 , Figure 6 It can be seen that groups 1 (ssDNA, SEQ ID NO.18-20) and 2 (ssDNA, SEQ ID NO.21-23) in the buffalo-derived detection combination also showed significant changes in fluorescence signals in yak samples, indicating the presence of obvious non-specific fluorescence detection signals. This suggests that groups 1 (ssDNA, SEQ ID NO.18-20) and 2 (ssDNA, SEQ ID NO.21-23) cannot be used for the accurate detection of buffalo-derived components. In contrast, [the following text appears to be incomplete and requires further context: "by..."] Figure 7 It can be seen that group 3 (ssDNA01, SEQ ID NO.4-6) showed the best detection effect, with obvious changes in fluorescence signal in buffalo samples, while no change in fluorescence signal in cattle, yak and blank control samples, indicating that it has a good identification effect in buffalo-derived components.

[0084] Depend on Figure 8It can be seen that group 1 (ssDNA, SEQ ID NO. 24-26) in the bovine-derived detection combination performed poorly in bovine samples, with large differences in fluorescence signals between parallel bovine samples, indicating poor repeatability in bovine-derived detection and unsuitability for accurate and stable detection of bovine-derived components; Figure 9 It can be seen that group 2 (ssDNA, SEQ ID NO.24, 25, 27) also showed significant changes in fluorescence signal in buffalo and yak samples, indicating that it produced weak non-specific fluorescence detection signals in these samples. This suggests that group 2 (ssDNA, SEQ ID NO.24, 25, 27) cannot be used for the accurate detection of bovine-derived components. In contrast, [the following text appears to be incomplete and requires further context]. Figure 10 It can be seen that group 3 (ssDNA01, SEQ ID NO.1-3) performed best among the three bovine-derived components, showing obvious changes in fluorescence detection signals in the yellow cattle sample, while no significant changes in fluorescence detection signals were observed in the buffalo, yak, and blank control samples. This indicates that group 3 (ssDNA01, SEQ ID NO.1-3) has a good identification effect in the identification of bovine-derived components.

[0085] 2. This invention optimizes the reaction system for detecting components derived from cattle, buffalo, and yak based on RPA-CRISPR / Cas12a.

[0086] To ensure the efficient execution of the RPA-CRISPR / Cas12a-based reaction, the amounts (concentrations) of Cas12a enzyme, crRNA, and ssDNA in the reaction system were compared and optimized.

[0087] Genomic DNA was extracted from meat product samples according to Example 1 and subjected to RPA isothermal amplification. The amounts of Cas12a enzyme, crRNA, and ssDNA added to the CRISPRCas12a reaction system were compared and tested.

[0088] (1) Comparison test of the amount of Cas12a enzyme and crRNA added

[0089] Cas12a enzyme and crRNA are the core components in the CRISPRCas12a system for achieving specific recognition and cleavage. To optimize detection performance, five concentration gradients for Cas12a enzyme and crRNA were systematically evaluated (Table 4) to determine their optimal working concentrations.

[0090] Table 4. Concentration parameters of key components Cas12a and crRNA

[0091]

[0092] The test results for Cas12a enzyme and crRNA at different concentration gradients are shown in the figure. Figure 11 The results show that the intensity and rate of change of the fluorescence signal in the detection system rapidly increased with the increase of the amount of Cas12a enzyme and crRNA added, indicating that the specific recognition and cleavage efficiency in the detection system significantly improved with the increase of the added amount. However, when the added amounts of Cas12a enzyme and crRNA reached 0.25 µL (125 nmol / L) and 0.5 µL (250 nmol / L) respectively, the specific recognition and cleavage efficiency of the reaction system reached its highest point. The recognition and cleavage of the target sequence was basically completed at the beginning of fluorescence signal acquisition, which may have made it impossible to observe the fluorescence growth process of specific recognition and cleavage in the early stage of the reaction. Therefore, for detecting the fluorescence signal intensity and reaction efficiency of the reaction system, the added amounts of Cas12a enzyme and crRNA are more suitable for the RPA-CRISPR / Cas12a-based detection system at 0.1 µL (50 nmol / L) and 0.25 µL (125 nmol / L), with the best results achieved at 0.1 µL (50 nmol / L).

[0093] (2) Comparison test of ssDNA addition amount

[0094] ssDNA is a key component in the CRISPRCas12a system for achieving trans-cleavage and releasing fluorescent signals. To optimize detection performance, four concentration gradients for the amount of ssDNA added were set up for systematic evaluation (Table 5) to determine its optimal working concentration.

[0095] Table 5. Concentration parameters of key component ssDNA

[0096]

[0097] The test results for ssDNA at different concentration gradients are shown in [the image]. Figure 12 The results show that the fluorescence signal intensity of the detection system gradually increases with the increase of ssDNA addition, indicating that increasing the ssDNA addition can effectively improve the fluorescence signal amplification efficiency in the RPA-CRISPR / Cas12a detection system. While the low concentration group (0.1 µL, 50 nmol / L) showed a significant change in fluorescence signal compared to the blank control, the intensity of the change was weak, limiting the detection sensitivity. The medium concentration group (0.5 µL, 250 nmol / L) and the high concentration group (1 µL, 500 nmol / L) showed more significant fluorescence signal enhancement, demonstrating excellent fluorescence signal response and making them more suitable for constructing a high-sensitivity fluorescence detection system. Therefore, 0.5 µL (250 nmol / L) to 1 µL (500 nmol / L) is the suitable concentration range for ssDNA in the RPA-CRISPR / Cas12a detection system, with 1 µL (500 nmol / L) being the optimal concentration.

[0098] Example 3: The present invention uses RPA-CRISPR / Cas12a to detect bovine-derived component sequence combinations.

[0099] 1. This invention provides a specificity test for detecting bovine-derived component sequence combinations based on RPA-CRISPR / Cas12a.

[0100] 1.1 DNA Extraction

[0101] Meat samples were collected from eight common animals: cattle, buffalo, yaks, pigs, chickens, ducks, sheep, and goats. Genomic DNA was extracted using the Tiangen DNA Extraction Kit for species-specific testing of nucleic acid combinations.

[0102] 1.2 RPA Amplification

[0103] The DNA samples from the eight animals extracted in 2.1 were subjected to RPA isothermal amplification. The primer sequences for forward and reverse RPA amplification were SEQ ID NO.1 and SEQ ID NO.2, respectively. The amplification system and reaction conditions were as described in Part 2 of Example 1.

[0104] 1.3 CrisprCas12a reaction

[0105] The RPA amplification products from the eight animals obtained in 1.2 were subjected to a second-stage CrisprCas12a reaction. The crRNA was SEQ ID NO.3, and the ssDNA sequence was “TTATTATT”. The reaction system was performed according to the specific procedures in Part 3 of Example 1. The samples were then incubated at 37°C for approximately 20-30 minutes using a constant-temperature fluorescence amplification instrument, with fluorescence signals collected every 30 seconds. The final detection results are shown in [Figure 1]. Figure 13 .

[0106] Depend on Figure 13 It was found that among the eight animal species, only the cattle sample showed a significant increase in fluorescence signal, while no significant fluorescence signal was observed in the buffalo, yak, pig, chicken, duck, sheep, and goat samples. The fluorescence signal intensity was no different from that of the blank sample. This indicates that the nucleic acid combination for detecting cattle-derived components achieved effective detection of specific target fragments only in the cattle sample, while it was not detected in other species. This also shows that the nucleic acid combination for detecting cattle-derived components has good species specificity among multiple species.

[0107] 2. Sensitivity testing of bovine-derived component sequence combinations based on RPA-CRISPR / Cas12a in this invention.

[0108] 2.1 DNA Extraction

[0109] Genomic DNA was extracted from bovine tissue using the Tiangen DNA Extraction Kit. The extracted bovine genomic DNA was then serially diluted to four concentration gradients (1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, and 0.001 ng / μL) using TE buffer to evaluate the detection sensitivity of the nucleic acid combination for bovine-derived components.

[0110] 2.2 RPA Amplification

[0111] Using the four concentration gradient DNA samples diluted in 2.1 as templates, RPA isothermal amplification was performed. The forward and reverse RPA amplification primer sequences are SEQ ID NO.1 and SEQ ID NO.2, respectively. The amplification system and reaction conditions are as described in Part 2 of Example 1.

[0112] 2.3 CrisprCas12a reaction

[0113] RPA amplification products from the four concentration gradient samples in section 2.2 were subjected to CRISPRCas12a reactions. The reaction system followed the specific procedures described in Part 3 of Example 1, where the crRNA was SEQ ID NO.3 and the ssDNA sequence was “TTATTATT”. The samples were then incubated at 37°C for approximately 20-30 minutes using an isothermal fluorescence amplification instrument, with fluorescence signals collected every 30 seconds. The final detection results are shown below. Figure 14 .

[0114] Depend on Figure 14 It can be seen that significant fluorescence signal growth was observed in samples at four concentration gradients: 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, and 0.001 ng / μL. This indicates that the nucleic acid combination effectively detected bovine-derived target genes in all four concentration gradient samples. This demonstrates that the detection sensitivity of the bovine-derived nucleic acid combination based on this invention can reach 0.001 ng / μL, making it a highly sensitive detection method that can effectively detect low concentrations of bovine-derived components.

[0115] 3. This invention improves the cross-specificity and detection sensitivity of bovine-derived component sequence combinations in a high-background mixed system based on RPA-CRISPR / Cas12a.

[0116] 3.1 Sample DNA Extraction and Preparation

[0117] We selected common market animal species such as cattle, yaks, buffalo, pigs, chickens, ducks, sheep, and goats. Then, we used the Tiangen DNA extraction kit to extract genomic DNA from these eight animals. First, we mixed equal amounts of genomic DNA from seven non-cattle-derived animals and adjusted the total concentration to about 10 ng / µL to prepare a non-cattle-derived mixed DNA sample to simulate the detection interference background of high abundance of non-target species. Then, we added different amounts of cattle genomic DNA to the non-cattle-derived mixed DNA sample, so that the cattle-derived DNA accounted for 10%, 1%, 0.1%, 0.01%, and 0% of the total DNA content of the mixed sample.

[0118] 3.2 RPA Amplification

[0119] The five gradient DNA mixtures prepared in 3.1 were subjected to RPA isothermal amplification. The forward and reverse RPA amplification primer sequences were SEQ ID NO.1 and SEQ ID NO.2, respectively. The amplification system and reaction conditions were as described in Part 2 of Example 1.

[0120] 3.3 CrisprCas12a reaction

[0121] The RPA amplification products of the five gradient samples obtained in 3.2 were subjected to a second-stage CrisprCas12a reaction. The reaction system was performed according to the specific procedures in Part 3 of Example 1, where the crRNA was SEQ ID NO.3 and the ssDNA sequence was “TTATTATT”. The reaction was incubated at 37 degrees Celsius for approximately 20-30 minutes using a constant-temperature fluorescence amplification instrument, with fluorescence signals collected every 30 seconds. The final detection results for the five gradient samples are shown below. Figure 15 .

[0122] Depend on Figure 15 It can be seen that among these five gradient samples, significant fluorescence signal growth was observed in four gradient samples with bovine DNA content of 10%, 1%, 0.1%, and 0.01%, while no significant fluorescence signal was observed in the mixed sample containing no bovine DNA. This indicates that even under complex matrix background conditions with high concentrations and multiple non-target species DNA, the bovine nucleic acid combination effectively detected bovine target fragments in gradient samples with bovine DNA content of 10%, 1%, 0.1%, and 0.01%. This demonstrates that the bovine nucleic acid combination described in this invention maintains high sensitivity and specificity in complex matrix samples with high background DNA from multiple species, and is suitable for the accurate identification of bovine components in complex samples.

[0123] Example 4: The present invention provides a test for detecting buffalo-derived component sequence combinations based on RPA-CRISPR / Cas12a.

[0124] 1. This invention provides a specificity test for detecting buffalo-derived component sequence combinations based on RPA-CRISPR / Cas12a.

[0125] 1.1 DNA Extraction

[0126] Tissue samples were collected from eight common animals: cattle, buffalo, yaks, pigs, chickens, ducks, sheep, and goats. Genomic DNA was extracted using the Tiangen DNA Extraction Kit for species-specific testing of nucleic acid combinations.

[0127] 1.2 RPA Amplification

[0128] DNA samples from the eight animals extracted in 1.1 were subjected to RPA isothermal amplification. The forward and reverse RPA amplification primer sequences were SEQ ID NO.4 and SEQ ID NO.5, respectively. The amplification system and reaction conditions were as described in Part 2 of Example 1.

[0129] 1.3 CrisprCas12a reaction

[0130] The RPA amplification products from the eight animals obtained in section 1.2 were subjected to CRISPRCas12a reactions. The reaction system was performed according to the specific procedures in Part 3 of Example 1, where the crRNA was SEQ ID NO.6 and the ssDNA sequence was “TTATTATT”. The mixture was then incubated at 37°C for approximately 20-30 minutes using a constant-temperature fluorescence amplification instrument, with fluorescence signals collected every 30 seconds. The final detection results are shown in […]. Figure 16 .

[0131] Depend on Figure 16 It was found that among the eight animal species, only the buffalo sample showed a significant increase in fluorescence signal, while no significant fluorescence signal was observed in the samples of cattle, yaks, pigs, chickens, ducks, sheep, and goats. The fluorescence signal intensity was no different from that of the blank sample, indicating that the nucleic acid combination for detecting buffalo-derived components only achieved effective detection of specific target sequences in buffalo samples, and was not detected in other species. This demonstrates that the nucleic acid combination for detecting buffalo-derived components has good species specificity across multiple species.

[0132] 2. Sensitivity testing of buffalo-derived component sequence combinations based on RPA-CRISPR / Cas12a in this invention.

[0133] 2.1 DNA Extraction

[0134] Genomic DNA was extracted from buffalo tissue using the Tiangen DNA Extraction Kit. The extracted buffalo genomic DNA was then serially diluted to four concentration gradients (1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, and 0.001 ng / μL) using TE buffer to evaluate the detection sensitivity of the nucleic acid combination for buffalo-derived components.

[0135] 2.2 RPA Amplification

[0136] The DNA samples with the four concentration gradients obtained in 2.1 were subjected to RPA isothermal amplification. The primer sequences for forward and reverse RPA amplification were SEQ ID NO.4 and SEQ ID NO.5, respectively. The amplification system and reaction conditions were as described in Part 2 of Example 1.

[0137] 2.3 CrisprCas12a reaction

[0138] RPA amplification products from the four concentration gradient samples in section 2.2 were subjected to a CRISPRCas12a reaction. The reaction system followed the specific procedures outlined in Part 3 of Example 1, where the crRNA was SEQ ID NO. 6 and the ssDNA sequence was “TTATTATT”. The mixture was then incubated at 37°C for approximately 20-30 minutes using a constant-temperature fluorescence amplification instrument, with fluorescence signals collected every 30 seconds. The final detection results are shown below. Figure 17 .

[0139] Depend on Figure 17 It can be seen that significant increases in fluorescence signals were observed in samples at four concentration gradients: 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, and 0.001 ng / μL. This indicates that the nucleic acid combination effectively detected buffalo-derived target genes in all four concentration gradients. It also demonstrates that the detection sensitivity of the buffalo-derived nucleic acid combination based on this invention can reach 0.001 ng / μL, making it a highly sensitive detection method that can effectively detect low concentrations of buffalo-derived components.

[0140] 3. This invention improves the cross-specificity and detection sensitivity of buffalo-derived component sequence combinations in high-background mixed systems based on RPA-CRISPR / Cas12a.

[0141] 3.1 Sample DNA Extraction and Preparation

[0142] Meat samples from several common animals, including buffalo, cattle, yaks, pigs, chickens, ducks, sheep, and goats, were selected. Genomic DNA was extracted from each species using the Tiangen DNA Extraction Kit. The genomic DNA from the seven non-buffalo-derived animals was first mixed in equal amounts, and the total concentration was adjusted to approximately 10 ng / µL to prepare a non-buffalo-derived mixed DNA sample to simulate the detection interference background of high abundance of non-target species. Then, different amounts of buffalo genomic DNA were added to the non-buffalo-derived mixed DNA sample, so that the buffalo-derived DNA accounted for 10%, 1%, 0.1%, 0.01%, and 0% of the total DNA content of the sample, respectively.

[0143] 3.2 RPA Amplification

[0144] The five DNA samples with different concentration gradients prepared in 3.1 were subjected to RPA isothermal amplification. The forward and reverse RPA amplification primer sequences were SEQ ID NO.4 and SEQ ID NO.5, respectively. The amplification system and reaction conditions were as described in Part 2 of Example 1.

[0145] 3.3 CrisprCas12a reaction

[0146] RPA products from the five concentration gradient samples in section 3.2 were subjected to CRISPRCas12a reactions. The reaction system followed the specific procedures described in Part 3 of Example 1, where the crRNA was SEQ ID NO.6 and the ssDNA sequence was “TTATTATT”. The samples were then incubated at 37°C for approximately 20-30 minutes using a constant-temperature fluorescence amplification instrument, with fluorescence signals collected every 30 seconds. The final detection results are shown below. Figure 18 .

[0147] Depend on Figure 18 It can be seen that, among the five gradient samples, significant fluorescence signal growth was observed in four gradient samples with buffalo-derived DNA content of 10%, 1%, 0.1%, and 0.01%, while no significant fluorescence signal change was observed in the gradient sample without buffalo-derived DNA (0% content). This indicates that even in complex matrix samples with high concentrations of DNA from multiple non-target species, accurate detection of buffalo-derived components can still be effectively achieved. This demonstrates that the buffalo-derived nucleic acid combination described in this invention maintains high sensitivity and specificity in complex matrix samples with high background DNA from multiple species, and is suitable for the accurate identification of buffalo-derived components in complex samples.

[0148] Example 5: The present invention utilizes RPA-CRISPR / Cas12a to detect sequence combinations of yak-derived components.

[0149] 1. This invention provides a specificity test for detecting yak-derived component sequence combinations based on RPA-CRISPR / Cas12a.

[0150] 1.1 DNA Extraction

[0151] Tissue samples were collected from eight common animals: cattle, buffalo, yaks, pigs, chickens, ducks, sheep, and goats. Genomic DNA was extracted using the Tiangen DNA Extraction Kit for species-specific testing of nucleic acid combinations.

[0152] 1.2 RPA Amplification

[0153] DNA samples from the eight animals extracted in 1.1 were subjected to RPA isothermal amplification. The primer sequences for forward and reverse RPA amplification were SEQ ID NO.7 and SEQ ID NO.8, respectively. The amplification system and reaction conditions were as described in Part 2 of Example 1.

[0154] 1.3 CrisprCas12a reaction

[0155] RPA amplification products from the eight animal species described in section 1.2 were subjected to CRISPRCas12a reactions. The reaction system followed the specific procedures outlined in Part 3 of Example 1, where the crRNA was SEQ ID NO.9 and the ssDNA sequence was “TTATTATT”. The mixtures were then incubated at 37°C for approximately 20-30 minutes using a constant-temperature fluorescence amplification instrument, with fluorescence signals collected every 30 seconds. The final detection results are shown below. Figure 19 .

[0156] Depend on Figure 19 It was found that among the eight animal species, only the yak sample showed a significant increase in fluorescence signal, while no significant changes in fluorescence signal were observed in the samples of cattle, buffalo, pigs, chickens, ducks, sheep, and goats. The fluorescence signal intensity was no different from that of the blank sample. This indicates that the nucleic acid combination for detecting yak-derived components only achieved effective detection of specific target sequences in the yak sample, and was not detected in other species. This also shows that the nucleic acid combination for detecting yak-derived components has good species specificity among multiple species.

[0157] 2. Sensitivity testing of yak-derived component sequence combinations based on RPA-CRISPR / Cas12a in this invention.

[0158] 2.1 DNA Extraction

[0159] Genomic DNA was extracted from yak tissue using the Tiangen DNA Extraction Kit. The extracted genomic DNA was then diluted to concentration gradients of 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, and 0.001 ng / μL using a gradient dilution method to evaluate the sensitivity of nucleic acid combinations for detecting yak-derived components.

[0160] 2.2 RPA Amplification

[0161] The four concentration gradient DNA samples diluted in 2.1 were subjected to RPA isothermal amplification. The forward and reverse RPA amplification primer sequences were SEQ ID NO.7 and SEQ ID NO.8, respectively. The amplification system and reaction conditions were as described in Part 2 of Example 1.

[0162] 2.3 CrisprCas12a reaction

[0163] RPA amplification products from the four concentration gradient samples in section 2.2 were subjected to CRISPR-Cas12a reactions. The reaction system followed the specific procedures described in Part 3 of Example 1, where the crRNA was SEQ ID NO.9 and the ssDNA sequence was “TTATTATT”. The samples were then incubated at 37°C for approximately 20-30 minutes using a constant-temperature fluorescence amplification instrument, with fluorescence signals collected every 30 seconds. The final detection results are shown in [Figure 1]. Figure 20 .

[0164] Depend on Figure 20 It can be seen that significant fluorescence signal growth was observed in samples at four concentration gradients: 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, and 0.001 ng / μL. This indicates that the nucleic acid combination effectively detected yak-derived target genes in all four concentration gradient samples. This demonstrates that the detection sensitivity of the yak-derived nucleic acid combination based on this invention can reach 0.001 ng / μL, making it a highly sensitive detection method that can effectively detect low concentrations of yak-derived components.

[0165] 3. This invention improves the cross-specificity and detection sensitivity of yak-derived component sequence combinations in a high-background mixed system based on RPA-CRISPR / Cas12a.

[0166] 3.1 Sample DNA Extraction and Preparation

[0167] Genomic DNA was extracted from yaks, as well as cattle, buffalo, pigs, chickens, ducks, sheep, and goats using the Tiangen DNA Extraction Kit. The genomic DNA from these seven non-yak-derived animals was first mixed in equal amounts, with the total concentration adjusted to approximately 10 ng / µL, to prepare a non-yak-derived mixed DNA sample to simulate the interference background of high abundance of non-target species. Then, different amounts of yak genomic DNA were added to this mixed DNA sample, resulting in yak-derived DNA accounting for 10%, 1%, 0.1%, 0.01%, and 0% of the total DNA content of the sample.

[0168] 3.2 RPA Amplification

[0169] The five DNA samples with different concentration gradients prepared in 3.1 were subjected to RPA isothermal amplification. The forward and reverse RPA amplification primer sequences were SEQ ID NO.7 and SEQ ID NO.8, respectively. The amplification system and reaction conditions were as described in Part 2 of Example 1.

[0170] 3.3 CrisprCas12a reaction

[0171] The RPA products from the five concentration gradient samples in section 3.2 were subjected to a second-stage CrisprCas12a reaction. The reaction system followed the specific procedures described in Part 3 of Example 1, where the crRNA was SEQ ID NO.9 and the ssDNA sequence was “TTATTATT”. The samples were then incubated at 37°C for approximately 20-30 minutes using a constant-temperature fluorescence amplification instrument, with fluorescence signals collected every 30 seconds. The final detection results are shown in […]. Figure 21 .

[0172] Depend on Figure 21 It can be seen that among the five concentration gradient samples, significant fluorescence signal growth was observed in four gradient samples with yak-derived DNA content of 10%, 1%, 0.1%, and 0.01%, while no significant fluorescence signal change was observed in the gradient sample without yak-derived DNA (i.e., 0% concentration). This indicates that even in complex matrix samples with high concentrations and multiple non-target species DNA, accurate detection of yak-derived components can still be effectively achieved. This demonstrates that the yak-derived nucleic acid combination described in this invention can maintain high sensitivity and high specificity in complex matrix samples with high background DNA from multiple species, and is suitable for the accurate identification of yak-derived components in complex samples.

[0173] Example 6: Application of the present invention based on RPA-CRISPR / Cas12a sequence combination in detecting bovine, buffalo, and yak-derived components in commercially available samples.

[0174] 1. This invention is based on RPA-CRISPR / Cas12a sequence combination detection of cattle, buffalo, and yak-derived components in commercially available samples.

[0175] 1.1 Sample DNA Extraction

[0176] Ten meat products were purchased from the market, and genomic DNA was extracted from each of the ten samples using the Tiangen DNA Extraction Kit.

[0177] 1.2 RPA Amplification

[0178] The DNA from the 10 samples extracted in 1.1 was subjected to RPA isothermal amplification. The amplification system and reaction conditions were as described in Part 2 of Example 1. The primer sequences for forward and reverse RPA amplification for detecting cattle origin were SEQ ID NO.1 and SEQ ID NO.2; the primer sequences for forward and reverse RPA amplification for detecting buffalo origin were SEQ ID NO.4 and SEQ ID NO.5; and the primer sequences for forward and reverse RPA amplification for detecting yak origin were SEQ ID NO.7 and SEQ ID NO.8.

[0179] 1.3 CrisprCas12a reaction

[0180] The RPA products of the 10 samples in 1.2 were subjected to CRISPRCas12a reactions, and the reaction system was operated according to the specific procedures in Part 3 of Example 1. The crRNA for detecting the cattle origin was SEQ ID NO.3, and the ssDNA sequence was “TTATTATT”; the crRNA for detecting the buffalo origin was SEQ ID NO.6, and the ssDNA sequence was “TTATTATT”; and the crRNA for detecting the yak origin was SEQ ID NO.9, and the ssDNA sequence was “TTATTATT”. Then, the three origin detection systems of cattle, buffalo, and yak were incubated at 37°C for about 20-30 minutes using an isothermal fluorescence amplification instrument, and the fluorescence signal was collected every 30 seconds. The final results of the cattle, buffalo, and yak origin detection of the 10 samples are shown in Table 6.

[0181] 2. qPCR detection verification

[0182] Simultaneously, real-time fluorescence PCR was used to detect the cattle, buffalo, and yak-derived components in the DNA of 10 samples. The detection standard adopted was GB / T 38164-2019 "Detection Methods for Common Livestock and Poultry Animal-Derived Components - Real-Time Fluorescence PCR". The detection reaction system (20 μL) consisted of: 10 μL FastStart Essential DNA Probes Master, 0.6 μL probe (10 μM), 0.7 μL each of upstream and downstream primers (10 μM), 3 μL ddH2O, and 5 μL sample DNA. The reaction program was: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 10 s; 60℃ annealing and extension for 30 s, for 40 cycles. The final results of the cattle, buffalo, and yak-derived components in the 10 samples are shown in Table 6.

[0183] The results show that the two methods yielded consistent results for the animal origin detection of the 10 samples. The nucleic acid combination and method described in this invention are completely consistent with the results of real-time fluorescence PCR for the identification of components of cattle, buffalo, and yak origin, indicating that the three nucleic acid combinations and methods in this invention can be effectively used for the accurate identification of components of cattle, buffalo, and yak origin.

[0184] Table 6. Detection results of chicken-derived components in commercially available samples

[0185]

[0186] Example 1: Comparison of the sequence combination of this invention based on RPA-CRISPR / Cas12a for identifying components of cattle, buffalo, and yak origin with other rapid detection nucleic acid combinations of bovine origin.

[0187] To test the characteristics of the three bovine nucleic acid combinations developed in this invention, bovine rapid detection nucleic acid combinations in relevant research literature on rapid food detection based on CRISPR-Cas12a were used as controls to test and evaluate the bovine nucleic acid combinations in this invention. The reference bovine nucleic acid combination used for comparison was obtained from the literature "RPA-Cas12a-FS: A frontline nucleic acid rapid detection system for food safety based on CRISPR-Cas12a combined with recombinase polymerase amplification". The sequence information of the RPA amplification primer pair, crRNA and ssDNA of the nucleic acid combination used for detection is shown in the table below. The target species of this nucleic acid combination is the mitochondrial gene sequence of Bos taurus, with the reference sequence number AF492351.1. Detailed sequence information is shown in Table 7.

[0188] Table 7. Information on Bovine Reference Nucleic Acid Detection Combination Sequences

[0189]

[0190] The above nucleic acid combinations were used to test and compare the components of common bovine / yellow cattle origin. These combinations were also applied to detect and verify common bovine samples found in the market. Rapid amplification of RPA-Beef-F (SEQ ID NO.28) and RPA-Beef-R (SEQ ID NO.29) was performed using the RPA isothermal amplification primers described in the literature (the isothermal amplification system and reaction procedure are described in the relevant literature). The target RPA amplification products were then detected and analyzed using Cas12a enzyme, Lb_crRNA-Beef-1 (SEQ ID NO.30), and ssDNA (the reaction system and reaction procedure are described in the relevant literature). Origin detection tests were performed using common bovine / yellow cattle samples (ddH2O was used as a blank control). The test results are shown in […]. Figure 22 Simultaneously, tests were conducted on three common cattle sources: common cattle / yellow cattle, water buffalo, and yak (ddH2O was used as a blank control). The test results are shown below. Figure 23 .Depend on Figure 22 It can be seen that the reference bovine nucleic acid combination in the literature can accurately detect bovine / yellow cattle components in positive samples of ordinary cattle / yellow cattle, while Figure 23 The results also showed that although the reference bovine nucleic acid combination in the literature achieved accurate detection in cattle samples, it also showed obvious changes in fluorescence signal in yak samples, i.e., obvious non-specific fluorescence detection signal. This indicates that the reference nucleic acid combination in the literature cannot achieve accurate detection of bovine components in yak samples. The presence of yak components may affect the accurate identification of ordinary cattle / cattle components, leading to the risk of misjudgment.

Claims

1. A sequence combination based on RPA-CRISPR / Cas12a for identifying components of cattle, buffalo, and yak origin, characterized in that: It includes bovine RPA primer pairs and bovine crRNA, buffalo RPA primer pairs and buffalo crRNA, yak RPA primer pairs and yak crRNA, and an ssDNA fluorescent reporter probe; the RPA primer pairs include RPA forward primers and RPA reverse primers; among them, The forward primer sequence for the yellow cattle RPA is SEQ ID No. 1: TACAACCTGTTCATAACTCTTGATCTAATGTCTT; The reverse primer sequence for the yellow cattle RPA is SEQ ID No. 2: TAGAATATTTTTGGGTTTAGGGTTAGGAGTAGTAG; The bovine crRNA sequence is SEQ ID No. 3: AAUUUCUACUAUUGUAGAUCCGUGUAAAGGAAGGCGAGAUAU; The forward primer sequence for buffalo RPA is SEQ ID No. 4: CAATGGACCGTAATAAAATTATTTAACCCAGTAG; The reverse primer sequence for buffalo RPA is SEQ ID No. 5: GAATTAAGACGGTTATGATAGGCATTATGTTTC; The buffalo crRNA sequence is SEQ ID No. 6: AAUUUCUACUAUUGUAGAUUACUAUUCAUAGCUAACUCCACC; The forward primer sequence for yak RPA is SEQ ID No. 7: CCACTATTTTATTAACCATTATACTAGGAACCAT; The reverse primer sequence for yak RPA is SEQ ID No. 8: GTAGATGATTAGGTTTAGTAATGTTATAGTAGGG; The yak crRNA sequence is SEQ ID No. 9: AAUUUCUACUAUUGUAGAUAUCCUACUGACAUGACAAAAACU; The ssDNA fluorescent reporter probe sequence is: TTATTATT.

2. The sequence combination for identifying components of cattle, buffalo, and yak origin based on RPA-CRISPR / Cas12a according to claim 1, characterized in that: The 5' and 3' ends of the crRNA are modified with at least one of OMe or thiomodification; the ssDNA fluorescent reporter probe is modified with a FAM fluorescent group at the 5' end and a BHQ1 quenching group at the 3' end.

3. The sequence combination for identifying components of cattle, buffalo, and yak origin based on RPA-CRISPR / Cas12a according to claim 2, characterized in that: The crRNA has one thiomodification at the 5' end, one OMe modification and two thiomodifications at the 3' end.

4. A detection kit for identifying components of cattle, buffalo, and yak origin based on RPA-CRISPR / Cas12a, characterized in that: It includes the sequence combination for identifying components of cattle, buffalo, and yak origin based on RPA-CRISPR / Cas12a as described in any one of claims 1-3, recombinase, single-stranded DNA binding protein, strand displacement DNA polymerase, rehydration buffer, MgOAC solution, Cas12a enzyme, HOLMES Buffer solution, and ddH2O.

5. The detection kit for identifying components of cattle, buffalo, and yak origin based on RPA-CRISPR / Cas12a according to claim 4, characterized in that: The Cas12a enzyme is one of LbCas12a, Lb5Cas12a, FnCas12a, and AsCas12a.

6. The detection kit for identifying components of cattle, buffalo, and yak origin based on RPA-CRISPR / Cas12a according to claim 5, characterized in that: The Cas12a enzyme is Lb5Cas12a.

7. The application of the detection kit based on RPA-CRISPR / Cas12a for identifying components of cattle, buffalo, and yak origin according to any one of claims 4-6 in identifying components of cattle, buffalo, and yak origin in food.

8. A detection method based on RPA-CRISPR / Cas12a for identifying components of cattle, buffalo, and yak origin in food, characterized in that: It includes the following steps: a. Extracting DNA from the sample: Use an extraction kit to extract genomic DNA from the sample; b. Using genomic DNA as template DNA, perform RPA amplification reaction using the detection kit described in any one of claims 4-6 to obtain RPA amplification products; c. Using the detection kit described in any one of claims 4-6, take the RPA amplification product and perform a CRISPR / Cas12a reaction to perform a fluorescence detection reaction.

9. The detection method for identifying components of cattle, buffalo, and yak origin in food based on RPA-CRISPR / Cas12a according to claim 8, characterized in that: Step b: The total volume of the reaction system used for RPA amplification is 50 μL, including rehydration buffer, RPA forward primer, RPA reverse primer, DNA template and ddH2O. After mixing, place it into a tube containing recombinase, single-stranded DNA binding protein and strand displacement DNA polymerase lyophilized powder, add MgOAc solution, vortex to mix, centrifuge briefly and incubate at 37~39 ℃ for 15~20 min; Step c: The total volume of the CRISPR / Cas12a reaction system is 20 μL, including HOLMES Buffer, Lb5Cas12a, crRNA, ssDNA fluorescent reporter probe, ddH2O, and RPA amplification product. Incubate at 37~39 ℃ for 20~30 min and perform real-time fluorescence detection.

10. The application of the detection method for identifying components of cattle, buffalo, and yak origin in food based on RPA-CRISPR / Cas12a as described in claim 8 or 9 in the identification of components of cattle, buffalo, and yak origin in food.

Images