W specific gene, specific primer pair, kit and detection method for identifying male and female of Asiatic corn borer in various insect states

Abstract

The invention discloses a W specific gene, a specific primer pair, a kit and a detection method for identifying male and female of Asiatic corn borer in various insect states. And the nucleotide sequence of the specific gene of W is shown as SEQ ID NO: 1. The invention also provides a specific primer pair for detecting the specific gene of W. The invention also provides a PCR detection method for rapidly identifying male and female of the Asiatic corn borer in each insect state, which comprises the following steps: extracting gDNA of the Asiatic corn borer, carrying out PCR amplification, and carrying out agarose gel electrophoresis on a PCR amplification product; the clone fragment of the W specific gene of the female worm has a corresponding band in an agarose gel electrophoretogram, and the male worm has no corresponding band. The method is suitable for male and female identification of Asiatic corn borers in each growth and development stage, and is short in detection time, simple to operate, low in cost and suitable for large-scale detection. The method is high in accuracy, and non-insect taxonomy professionals can identify male and female insect bodies of Asiatic corn borers in various growth and development stages through the method.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and in particular relates to a W-specific gene, a specific primer pair, a kit and a detection method for identifying the sexes of various stages of Asian corn borer. Background Art

[0002] The Asian corn borer is a major pest of corn, which harms the heart leaves, stems, cobs, filaments and bracts of corn plants, causing the damaged parts to lose their functions, affecting pollination, destroying the transport of water and nutrients in the plant, and reducing grain yield. At the same time, it also indirectly brings various diseases, seriously affecting the safe cultivation and production of corn in my country.

[0003] Basic research on insect physiology and biochemistry usually requires sex identification, and modern pest control methods also require sex identification of research subjects.

[0004] At present, there are morphological and molecular identification methods for the identification of the sex of the Asian corn borer. Morphological identification is the diamond-shaped black spot between the two hairs on the ventral midline of the 9th abdominal segment of male larvae above the fourth instar. It is difficult to see with the naked eye under a low-power microscope. There is no such feature in larvae below the fourth instar. There is no obvious distinguishing mark and method for larvae. The molecular identification method uses the dosage difference of the Z gene in male and female individuals to extract genomic DNA from larvae and eggs below the fifth instar and perform quantitative PCR on the Z gene to identify the sex. However, the existing quantitative PCR operation is relatively cumbersome and not suitable for batch identification of the sex of Asian corn borers. It is also costly.

[0005] The sex of the Asian corn borer is determined by the ZZ / ZW sex determination system, and the W chromosome is specific to female individuals. By utilizing this feature of W-specific genes, it is possible to develop male and female molecular markers for all stages of the Asian corn borer. However, no reliable W-specific genes for the Asian corn borer have been reported so far. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a W-specific gene, a specific primer pair, a kit and a detection method for identifying the male and female of each insect stage of Asian corn borer.

[0007] The objective of the present invention is achieved through the following technical solutions: A W-specific gene for identifying the sex of each stage of Asian corn borer, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0008] The present invention also provides a specific primer pair for detecting a W-specific gene for identifying males and females of various stages of the Asian corn borer, and the nucleotide sequence is as follows: Ofur03G001590-F: AGAGTGCTACCACCTCCGAT, SEQ ID NO: 2; Ofur03G001590-R: CAGTGCGACCTCCTTCCAAT, SEQ ID NO: 3.

[0009] The present invention also provides a kit for identifying the sex of Asian corn borer in various insect stages, and the kit comprises genetic sex-specific primers.

[0010] The present invention also provides a PCR detection method for rapidly identifying the male and female of each stage of the Asian corn borer using a W-specific gene for identifying the male and female of each stage of the Asian corn borer, comprising the following steps: 1) Extraction of gDNA from Asian corn borer; 2) Perform PCR amplification; 3) Perform agarose gel electrophoresis on the PCR amplification products; 4) The sex of Asian corn borer was identified by agarose gel electrophoresis. The cloned fragment of the W-specific gene of the female insect had a corresponding band in the agarose gel electrophoresis, while the male insect had no corresponding band.

[0011] Furthermore, in step 2), the PCR amplification reaction system includes Premix Taq TM , Ostrinia furnacalis gDNA, ddH2O and a pair of specific primers; The specific primers are as follows: Ofur03G001590-F: AGAGTGCTACCACCTCCGAT, SEQ ID NO: 2; Ofur03G001590-R:CAGTGCGACCTCCTTCCAAT, SEQ ID NO:3.

[0012] Furthermore, the PCR amplification reaction conditions in step 2) are: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 10 sec, annealing at 60°C for 10 sec, extension at 72°C for 10 min, for 28 cycles; final extension at 72°C for 5 min; and storage at 4°C.

[0013] Furthermore, in the step 3), the agarose gel electrophoresis is performed using 1% agarose gel electrophoresis at a voltage of 120 V for 20 min.

[0014] The beneficial effects of the present invention are as follows: 1. The method of the present invention breaks through the limitations of the existing morphological identification methods and is suitable for the identification of the sexes of the Asian corn borer at various growth and development stages. 2. Compared with the existing quantitative PCR detection technology, the method of the present invention has the advantages of short detection time, simple operation and low cost, and is suitable for large-scale detection. 3. The method of the present invention has high accuracy, and personnel who are not majoring in insect taxonomy can also identify the sexes of the Asian corn borer at various growth and development stages through the method of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the agarose gel electrophoresis of the PCR amplification product of gDNA of Asian corn borer. DETAILED DESCRIPTION

[0016] The present invention is described in detail below with reference to the accompanying drawings.

[0017] By assembling the W chromosome of Asian corn borer and conducting bioinformatics analysis, a W-specific gene was identified, named Ofur03G001590. Specific primers were designed using NCBI (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome). Using ordinary PCR methods, the male and female of Asian corn borer of all insect stages can be identified. Example

[0018] 1. Experimental process 1. Extraction of gDNA from Ostrinia furnacalis 1) Select seven females (3 adults, 3 larvae and 1 pupa) and seven males (3 adults, 3 larvae and 1 pupa) of Ostrinia furnacalis. Add 200ul of CTAB mixture to each Asian corn borer, grind thoroughly and then add 800ul of CTAB mixture.

[0019] 2) Place the tube in a water bath at 65°C for 30 minutes, inverting it every 10 minutes. Centrifuge at 25°C, 12,000 rpm for 10 minutes.

[0020] 3) Take the supernatant and transfer it to a new centrifuge tube. Add a mixture of chloroform and isoamyl alcohol (volume ratio 24:1) with an equal volume (1 ml) of CTAB. Oscillate 100 times (5 minutes on a horizontal oscillator). Centrifuge at room temperature (25°C) and 12,000 rpm for 10 minutes.

[0021] 4) Take the supernatant, add 1 ml of chloroform-isoamyl alcohol mixture (volume ratio 24:1), centrifuge at room temperature 25°C, 12000 rpm, for 10 min, and take the supernatant (you can take up to 600 ul to avoid balancing the centrifuge).

[0022] 5) Add 1 ml of isopropanol to the supernatant of step 4), gently invert to mix, and let stand at -80℃ for 10 min or -20℃ for 1 h.

[0023] 6) Centrifuge at room temperature (25°C) and 12,000 rpm for 10 min and discard the supernatant.

[0024] 7) Add 1 ml of 70% ethanol (pre-cooled at -20°C) to the precipitate to precipitate the DNA. Centrifuge at 25°C, 12,000 rpm for 10 min. Repeat once.

[0025] 8) Invert onto filter paper to dry, add 20ul ddH2O to dissolve, and store at -20℃.

[0026] 2. PCR amplification According to the DNA sequence of Ofur03G001590, specific primers were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The nucleotide sequence of the specific primers (5'->3') is: Ofur03G001590-F: AGAGTGCTACCACCTCCGAT, SEQ ID NO: 2; Ofur03G001590-R:CAGTGCGACCTCCTTCCAAT, SEQ ID NO:3.

[0027] Using the above gDNA as a template, a PCR reaction system was constructed as shown in Table 1.

[0028]

[0029] The PCR reaction program is shown in Table 2.

[0030]

[0031] Use 1% agarose gel, run electrophoresis at 120V for 22 minutes, observe the electrophoresis bands on a gel imaging system, and send the PCR products to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The agarose gel electrophoresis pattern can be used to preliminarily determine whether the length of the amplified band is correct. If it is correct, further sequencing is performed to compare and observe the sequence of the amplified band.

[0032] 2. Test results After PCR amplification, Figure 1As shown in the figure, M is DL2000 DNA Maker, and the lengths of the bands from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp; 1-7 are the PCR products of Ofur03G001590 of female Asian corn borer; 8-14 are the PCR products of Ofur03G001590 of male. The cloned fragment of the W-specific gene of female has corresponding bands in the agarose gel electrophoresis diagram, but no corresponding bands are found in male. It can be seen that the target fragment of the Ofur03G001590 gene is only detected in females, and no corresponding fragment is cloned in males.

[0033] The above results prove that by performing PCR amplification on a single Asian corn borer using the specific primers provided by the present invention and subjecting the PCR amplification product to agarose gel electrophoresis, the male and female Asian corn borer can be identified, that is, the corresponding fragment of the Ofur03G001590 gene can be amplified from the female DNA sample, while no corresponding fragment is amplified from the male.

[0034] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. A W-specific gene for identifying the sex of each stage of the Asian corn borer, characterized in that: The nucleotide sequence is shown in SEQ ID NO:

1.

2. A specific primer pair for detecting the W-specific gene for identifying the male and female of each insect stage of the Asian corn borer according to claim 1, characterized in that: The nucleotide sequence is as follows: Ofur03G001590-F: AGAGTGCTACCACCTCCGAT, SEQ ID NO: 2; Ofur03G001590-R:CAGTGCGACCTCCTTCCAAT, SEQ ID NO:

3.

3. A kit for identifying the sex of Asian corn borer in different stages, characterized in that: The kit comprises the genetic sex-specific primers according to claim 2.

4. A PCR detection method for rapidly identifying the male and female of each stage of the Asian corn borer using the W-specific gene for identifying the male and female of each stage of the Asian corn borer according to claim 1, characterized in that The steps include: 1) Extraction of gDNA from Asian corn borer; 2) Perform PCR amplification; 3) Perform agarose gel electrophoresis on the PCR amplification products; 4) The sex of Asian corn borer was identified by agarose gel electrophoresis. The cloned fragment of the W-specific gene of the female insect had a corresponding band in the agarose gel electrophoresis, while the male insect had no corresponding band.

5. The PCR detection method according to claim 4, characterized in that: In step 2), the PCR amplification reaction system includes Premix Taq TM , Ostrinia furnacalis gDNA, ddH2O and a pair of specific primers; The specific primers are as follows: Ofur03G001590-F: AGAGTGCTACCACCTCCGAT, SEQ ID NO: 2; Ofur03G001590-R:CAGTGCGACCTCCTTCCAAT, SEQ ID NO:

3.

6. The PCR detection method according to claim 4, characterized in that: The PCR amplification reaction conditions in step 2) are: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 10 sec, annealing at 60°C for 10 sec, extension at 72°C for 10 min, for 28 cycles; final extension at 72°C for 5 min; and storage at 4°C.

7. The PCR detection method according to claim 4, characterized in that: In the step 3), the agarose gel electrophoresis is performed using 1% agarose gel electrophoresis at a voltage of 120 V for 20 min.

Images