Application of a SNP molecular marker associated with iridovirus disease resistance in Macrobrachium rosenbergii

Abstract

The present invention discloses an application of a SNP molecular marker related to the resistance of Macrobrachium rosenbergii to iridovirus disease, and relates to the field of biotechnology. The SNP molecular marker is located at the 69688355th site from the 5' end on chromosome 2 of the Macrobrachium rosenbergii genome, which is G or T, and the GT genotype Macrobrachium rosenbergii has strong resistance to iridovirus disease; or is located at the 16939259th site from the 5' end on chromosome 52 of the Macrobrachium rosenbergii genome, which is A or C, and the AC genotype Macrobrachium rosenbergii has strong resistance to iridovirus disease. The SNP molecular marker of the present invention is closely related to the resistance of Macrobrachium rosenbergii to iridovirus disease, so the SNP molecular marker of the present invention can be used to detect relevant indicators of Macrobrachium rosenbergii, or the genetic improvement of Macrobrachium rosenbergii can be carried out through this SNP molecular marker.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an application of a SNP molecular marker associated with the iridovirus disease resistance of Macrobrachium rosenbergii. Background Art

[0002] Macrobrachium rosenbergii ( Macrobrachium rosenbergii ) belongs to the order Decapoda, family Palaemonidae, genus Macrobrachium ( Macrobrachium Macrobrachium rosenbergii (Macrobrachium rosenbergii), a key freshwater aquaculture species in my country, is widely popular in the aquatic consumer market due to its excellent meat quality and high economic value. However, in recent years, outbreaks of iridovirus disease in Macrobrachium rosenbergii aquaculture, driven by high-density and intensive farming practices, have posed a serious threat to the industry.

[0003] Iridovirus disease, caused by Decapoda Iridovirus 1 (DIV1), is a highly contagious disease. Affected Macrobrachium rosenbergii exhibits a variety of clinical symptoms, including loss of appetite, sluggish movement, weak swimming, slow swimming, and lying on the side. The most characteristic "whitehead" phenomenon is the appearance of a distinct white spot within the carapace at the base of the frontal hilt. As the disease worsens, the affected shrimp's body color gradually turns reddish, their gills become red and congested, their hepatopancreas atrophies, and their jejunum and stomach become empty, ultimately leading to mass mortality. These symptoms not only severely impact the shrimp's growth rate and health, but also lead to large-scale mortality, resulting in significant economic losses for farmers.

[0004] SNPs (single nucleotide polymorphisms) are one of the most common forms of genetic variation, revealing genetic differences between individuals and providing an important foundation for the study of genetic traits. Genome-wide association studies (GWAS), as an advanced genetic tool, can identify the complex relationships between genes that influence specific phenotypes (such as disease resistance) by exploiting linkage disequilibrium between SNPs.

[0005] GWAS have achieved remarkable results in the genetic breeding of disease resistance in plants and livestock. By identifying molecular markers associated with key traits (such as disease resistance) and applying them to marker-assisted selection (MAS) and genome-wide selection (GS), scientists have successfully bred varieties with superior traits. Compared to traditional breeding methods, these techniques not only accelerate the process of homozygosity of trait-related alleles but also significantly improve breeding efficiency and genetic selection progress, providing strong support for the sustainable development of agricultural production.

[0006] The use of molecular information to assist breeding for disease resistance in plants and livestock has been widely used. However, the application of GWAS in disease resistance breeding in aquatic animals, particularly for iridovirus resistance in Macrobrachium rosenbergii, is still in its infancy. Although numerous studies have been published in recent years on genetic variation and disease resistance in Macrobrachium rosenbergii, detailed studies of single-nucleotide polymorphisms (SNPs) associated with iridovirus resistance have been lacking. Furthermore, disease resistance, as a typical quantitative trait, is often influenced by multiple genes and environmental factors, and its genetic mechanisms are complex, making it difficult to effectively assess through simple phenotypic observations. Traditional resistance assessment criteria are typically based on survival / death status, a binary classification approach that may not fully reflect inter-individual differences in disease resistance. Summary of the Invention

[0007] To address the shortcomings of the existing technology, the present invention provides a method for using SNP molecular markers associated with iridovirus resistance in Macrobrachium rosenbergii. Using survival time as a criterion for resistance, the present invention measures individual survival time after infection to assess iridovirus resistance, thereby improving the accuracy of identifying disease-resistance gene loci. By identifying and validating these key SNPs, new possibilities and directions will be provided for disease-resistant breeding of Macrobrachium rosenbergii and the sustainable development of the industry.

[0008] In one aspect, the present invention provides a SNP molecular marker associated with iridovirus disease resistance in Macrobrachium rosenbergii, wherein the SNP molecular marker comprises at least one of the following SNP molecular markers:

[0009] The first type, wherein the nucleotide sequence containing the SNP molecular marker is shown in SEQ ID No. 1, wherein the SNP molecular marker is located at position 300 from the 5' end of SEQ ID No. 1, corresponding to position 69688355 from the 5' end of chromosome 2 of the Macrobrachium rosenbergii genome, and is G or T;

[0010] The second type is a nucleotide sequence containing the SNP molecular marker as shown in SEQ ID No. 2, wherein the SNP molecular marker is located at the 300th position from the 5' end of SEQ ID No. 2, corresponding to the 16939259th position from the 5' end of chromosome 52 of the Macrobrachium rosenbergii genome, and is A or C.

[0011] Among them, the sequence shown in SEQ ID No.1 is:

[0012] CTGGAAATAGATGGATCGGTAAGCTGTCTTAGGAGATGGAAATCTACCTGATAAAGAGCTTACAAACGTAAAAACAACAGGTAAAGATCTAAGAAGAGGAAAGTGAGTCTAAGTAACAAAAGAATAAAGAAAAAAAATTTCATAGACCAGTCATGAAAATAAAAATAGCTGTATTGAATAATAAAAAGCTATGAAAAACAGGCGTTAATGAAGCCCTTTTTGTTGATTAATGTCAATATTCTTCTCTTTCACGCGCTAAATATTGCGAATAAATTCTTTACAGATTAACTGTAGATTTTKATATTTATCTAAGTTTTGCTGAAAGGATGGACTTGTATGCTAAATAATGAAGCAGTGCAATATTCAGCGAAGGTATAACGTTATATCTAAGACTAAGCATTGTTCGTAGTATGTTGCATTTTTTCAGTCTGTACTCACCACCGTCAGGCTCAATGAAGAAAGGCGAGGTATCTTTTTAACTAGACATATGTTATCACCTTAAAGGCAACACAAACAACTTAACACTTGGATGGGATTTCAACTGTATCATCAGTAGAAAAGATTGTTCAAAAATAATTCTTACCTAATATTTTTCAGAC, where K is G or T.

[0013] The sequence shown in SEQ ID No.2 is:

[0014] , where M is A or C.

[0015] For the first type, when the SNP molecular markers in the sequence shown in SEQ ID No. 1 on the two chromosomes are G and T respectively, it is called the GT genotype, and the GT genotype Macrobrachium rosenbergii has strong resistance to iridescent virus disease (taking the survival time of Macrobrachium rosenbergii after infection with Decapoda iridescent virus 1 as an indicator, individuals with long survival time are judged as individuals with strong resistance to iridescent virus disease, and individuals with short survival time are judged as individuals with weak resistance to iridescent virus disease); when the SNP molecular markers in the sequence shown in SEQ ID No. 1 on the two chromosomes are G, G or T, T respectively, it is called the GG or TT genotype, and the GG or TT genotype Macrobrachium rosenbergii has weak resistance to iridescent virus disease; for the second type, when the SNP molecular markers in the sequence shown in SEQ ID No. 2 on the two chromosomes are A and C respectively, it is called the AC genotype, and the AC genotype Macrobrachium rosenbergii has strong resistance to iridescent virus disease; when the SNP molecular markers in the sequence shown in SEQ ID No. 2 on the two chromosomes are A and A respectively, it is called the AA genotype, and the AA genotype Macrobrachium rosenbergii has weak resistance to iridescent virus disease.

[0016] On the other hand, the present invention provides the use of the SNP molecular marker in determining the resistance of Macrobrachium rosenbergii to iridovirus disease.

[0017] In another aspect, the present invention provides a method for determining the resistance of Macrobrachium rosenbergii to iridovirus disease, the method comprising: determining the SNP molecular marker of Macrobrachium rosenbergii, and determining the iridovirus disease resistance trait of Macrobrachium rosenbergii based on the SNP molecular marker:

[0018] If the SNP molecular marker is the first type, the iridovirus disease resistance trait of the Macrobrachium rosenbergii is ranked from strong to weak based on the genotype of the 300th site from the 5' end of the SEQ ID No. 1: GT genotype, GG genotype or TT genotype;

[0019] If the SNP molecular marker is the second type, the iridovirus disease resistance trait of the Macrobrachium rosenbergii is ranked from strong to weak based on the genotype of the 300th site from the 5' end on the SEQ ID No. 2: AC genotype, AA genotype.

[0020] Finally, the present invention provides a method for genetic improvement of Macrobrachium rosenbergii, wherein the genetic improvement is the genetic improvement of the shrimp iridovirus disease resistance trait, the method comprising: determining the above-mentioned SNP molecular markers of seed shrimp in the core group of Macrobrachium rosenbergii, and making corresponding selections based on the SNP molecular markers:

[0021] If the SNP molecular marker is the first type, then in the core population of Macrobrachium rosenbergii, the seed shrimp individuals with the GT genotype at the 300th position from the 5' end on the SEQ ID No. 1 are selected, and the seed shrimp individuals with the GG or TT genotype at the position are eliminated;

[0022] If the SNP molecular marker is the second type, then in the core group of Macrobrachium rosenbergii, the seed shrimp individuals with the AC genotype at the 300th position from the 5' end on SEQ ID No. 2 are selected, and the seed shrimp individuals with the AA genotype at the position are eliminated.

[0023] Due to the adoption of the above technical solution, the embodiments of the present invention have at least the following beneficial effects: the SNP molecular marker of the present invention is closely related to the resistance of Macrobrachium rosenbergii to iridovirus disease, and therefore the SNP molecular marker of the present invention can be used to detect relevant indicators of Macrobrachium rosenbergii, or the genetic improvement of Macrobrachium rosenbergii can be carried out through this SNP molecular marker. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a statistical analysis chart based on the survival time of Macrobrachium rosenbergii infected with iridovirus in an embodiment of the present invention.

[0025] Figure 2 This is the Manhattan plot of the genome-wide association analysis in an embodiment of the present invention.

[0026] Figure 3 This is a box plot of the survival time of different mutation groups at site 69688355 of chromosome 2 after infection with iridescent virus in the examples of the present invention; where **** indicates p<0.0001.

[0027] Figure 4 This is a box plot of the survival time of different mutation groups at site 16939259 of chromosome 52 after infection with iridescent virus in the example of the present invention; where **** indicates p<0.0001. DETAILED DESCRIPTION

[0028] The following is a clear and complete description of the concept of the present invention and the technical effects produced, so as to fully explain the purpose, scheme and effects of the present invention.

[0029] Example 1: Identification of SNP molecular markers associated with iridovirus disease resistance in Macrobrachium rosenbergii

[0030] 1) A large-scale challenge experiment with Macrobrachium rosenbergii decapod iridovirus 1 was conducted. The shrimp weighed 1.5 ± 0.2 g and the survival time of each shrimp was recorded from the time of virus injection until the onset of disease and death. At the end of the experiment, a total of 435 dead Macrobrachium rosenbergii samples were collected, with survival times ranging from 42 to 134 hours. Statistical analysis of survival time traits was performed, such as Figure 1 As shown, the results are approximately normally distributed, belonging to typical quantitative traits, and meet the basic requirements of association analysis.

[0031] 2) Sample DNA was extracted using a magnetic bead method, and DNA concentration was measured using a Qubit fluorescence quantifier. DNA integrity was assessed using 1% agarose gel electrophoresis. Samples that passed quality control were used for library construction and quality control. These samples were then sent to Huazhi Biotechnology Co., Ltd. for sequencing using a Macrobrachium rosenbergii liquid phase array. Genotyping was performed using GATK software, and missing genotypes were filled in using Beagle. The genotyping file was quality-controlled and filtered using Plink to obtain the final genotyping results.

[0032] 3) After quality control of the sequencing data and alignment to the reference genome, variant detection was performed using GATK. SNP data were filtered using VCFtools for site deletion rate and minimum allele frequency to obtain the final typing results. The disease resistance phenotype was formatted as survival time (quantitative trait). Genome-wide association analysis was performed using rMVP software, combining phenotypes and genotypes, with a threshold of -log. 10(0.05 / N)=6.265 (N is the number of SNP sites used for analysis), p The sites with values ​​reaching the threshold are significantly associated. All sites exceeding the threshold are annotated using SnpEff software. Manhattan plots are created using the ggplot2 package. Figure 2 shown.

[0033] The results showed that 15 SNP sites among all SNPs met the requirements. Through Blast analysis and alignment, based on physical information and linkage region gene annotation, two SNPs that may be associated with iridovirus disease resistance in Macrobrachium rosenbergii were preliminarily identified. They were located at the 300th position from the 5' end of SEQ ID No.1 and SEQ ID No.2, respectively. The 300th position from the 5' end of SEQ ID No.1 corresponds to the 69688355th position from the 5' end of chromosome 2 of the Macrobrachium rosenbergii genome, which is G (guanine) or T (thymine); the 300th position from the 5' end of SEQ ID No.2 corresponds to the 16939259th position from the 5' end of chromosome 52 of the Macrobrachium rosenbergii genome, which is A (adenine) or C (cytosine).

[0034] Example 2: Verification of the effects of SNP chr2:69688355 and SNP chr52:16939259 on the resistance of Macrobrachium rosenbergii to iridovirus disease

[0035] The two SNP molecular markers associated with resistance to iridovirus disease in Macrobrachium rosenbergii identified in this example are located at position 300 from the 5' end on SEQ ID No. 1 and SEQ ID No. 2. SEQ ID NO. 1 corresponds to position 69688355 on chromosome 2 of the Macrobrachium rosenbergii genome, where the reference genome has a genotype of G and a mutant of T. SEQ ID NO. 2 corresponds to position 16939259 on chromosome 52 of the Macrobrachium rosenbergii genome, where the reference genome has a genotype of A and a mutant of C.

[0036] The genotype of the SNP molecular marker site located at SEQ ID NO.1 was correlated with the survival time of Macrobrachium rosenbergii after infection with iridovirus. The statistical results are as follows: Figure 3 The results showed that the survival time of Macrobrachium rosenbergii genotype GT was the longest, and there was a very significant difference in survival time between Macrobrachium rosenbergii genotype GT and GG or TT genotypes; there was no difference in survival time between GG or TT genotypes.

[0037] The genotype of the SNP molecular marker site located at SEQ ID NO.2 was correlated with the survival time of Macrobrachium rosenbergii after infection with iridovirus. The statistical results are as follows: Figure 4The results showed that the AC genotype of Macrobrachium rosenbergii had the longest survival time, and there was a very significant difference in survival time between the AC genotype and the AA genotype.

[0038] In summary, the molecular markers provided by the present invention can efficiently and accurately identify the survival time of the identified Macrobrachium rosenbergii after infection with iridovirus, and then judge the resistance of Macrobrachium rosenbergii to iridovirus disease. It has significant application value in the breeding of Macrobrachium rosenbergii and provides a reliable reference for the breeding of Macrobrachium rosenbergii.

[0039] The above description is merely a preferred embodiment of the present invention. The present invention is not limited to the above-described embodiments. Any method that achieves the technical effects of the present invention by the same or equivalent means shall fall within the scope of protection of the present invention. Within the scope of protection of the present invention, various modifications and variations of the technical solutions and / or implementation methods are possible.

Claims

1. Use of a SNP molecular marker associated with iridovirus disease resistance in Macrobrachium rosenbergii in determining iridovirus disease resistance in Macrobrachium rosenbergii, characterized in that: The SNP molecular markers include at least one of the following SNP molecular markers: The first type is a nucleotide sequence containing the SNP molecular marker as shown in SEQ ID No. 1, wherein the SNP molecular marker is located at the 300th position from the 5' end of SEQ ID No. 1 and is G or T; The second type is a nucleotide sequence containing the SNP molecular marker as shown in SEQ ID No. 2, wherein the SNP molecular marker is located at the 300th position from the 5' end of SEQ ID No. 2 and is A or C.

2. The use according to claim 1, characterized in that When applied, if the SNP molecular marker is the first type, the trait of resistance to iridovirus disease of Macrobrachium rosenbergii is manifested as: the GT genotype Macrobrachium rosenbergii has the longest survival time, and there is an extremely significant difference in survival time between the GT genotype Macrobrachium rosenbergii and the GG or TT genotype Macrobrachium rosenbergii; there is no difference in survival time between the GG or TT genotype Macrobrachium rosenbergii.

3. The use according to claim 1, characterized in that When applied, if the SNP molecular marker is the second type, the iridovirus disease resistance trait of the Macrobrachium rosenbergii is ranked from strong to weak based on the genotype of the 300th site from the 5' end on the SEQ ID No. 2: AC genotype, AA genotype.

4. A method for determining the resistance of Macrobrachium rosenbergii to iridovirus disease, characterized in that: include: Determine the SNP molecular marker of the Macrobrachium rosenbergii, and determine the iridovirus disease resistance trait of the Macrobrachium rosenbergii based on the SNP molecular marker: If the SNP molecular marker is the first type, that is, the nucleotide sequence containing the SNP molecular marker is as shown in SEQ ID No.1, and the SNP molecular marker is located at the 300th position from the 5' end of SEQ ID No.1, which is G or T; then the iridovirus disease resistance trait of the Macrobrachium rosenbergii is as follows: the GT genotype Macrobrachium rosenbergii has the longest survival time, and there is a very significant difference in survival time between the GT genotype Macrobrachium rosenbergii and the GG or TT genotype Macrobrachium rosenbergii; there is no difference in survival time between the GG or TT genotype Macrobrachium rosenbergii; If the SNP molecular marker is the second type, that is, the nucleotide sequence containing the SNP molecular marker is shown in SEQ ID No. 2, and the SNP molecular marker is located at the 300th position from the 5' end of SEQ ID No. 2 and is A or C; then the iridovirus disease resistance trait of the Macrobrachium rosenbergii is ranked from strong to weak based on the genotype at the 300th position from the 5' end of SEQ ID No. 2 as follows: AC genotype, AA genotype.

5. Use of a SNP molecular marker associated with iridovirus disease resistance in Macrobrachium rosenbergii in breeding for iridovirus disease resistance, characterized in that: The SNP molecular markers include at least one of the following SNP molecular markers: The first type is a nucleotide sequence containing the SNP molecular marker as shown in SEQ ID No. 1, wherein the SNP molecular marker is located at the 300th position from the 5' end of SEQ ID No. 1 and is G or T; The second type is a nucleotide sequence containing the SNP molecular marker as shown in SEQ ID No. 2, wherein the SNP molecular marker is located at the 300th position from the 5' end of SEQ ID No. 2 and is A or C.

6. The use according to claim 5, characterized in that When used, if the SNP molecular marker is the first type, the shrimp individuals with the GT genotype at the 300th position from the 5' end on the SEQ ID No. 1 are selected, and the shrimp individuals with the GG or TT genotype at the position are eliminated.

7. The use according to claim 5, characterized in that When used, if the SNP molecular marker is the second type, the shrimp individuals with AC genotype at the 300th position from the 5' end on SEQ ID No. 2 are selected, and the shrimp individuals with AA genotype at the position are eliminated.

8. A method for genetic improvement of Macrobrachium rosenbergii, characterized in that: include: Determine the SNP molecular markers of the seed shrimp in the core group of Macrobrachium rosenbergii, and make corresponding selections based on the SNP molecular markers: If the SNP molecular marker is the first type, that is, the nucleotide sequence containing the SNP molecular marker is as shown in SEQ ID No.1, and the SNP molecular marker is located at the 300th position from the 5' end of SEQ ID No.1 and is G or T; then, in the core population of Macrobrachium rosenbergii, the seed shrimp individuals with the GT genotype at the 300th position from the 5' end of SEQ ID No.1 are selected, and the seed shrimp individuals with the GG or TT genotype at the same position are eliminated; If the SNP molecular marker is the second type, that is, the nucleotide sequence containing the SNP molecular marker is shown in SEQ ID No. 2, and the SNP molecular marker is located at the 300th position from the 5' end on SEQ ID No. 2, and is A or C; then, in the core group of Macrobrachium rosenbergii, the seed shrimp individuals with the AC genotype at the 300th position from the 5' end on SEQ ID No. 2 are selected, and the seed shrimp individuals with the AA genotype at this position are eliminated.

Images