Kit, application and method for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method

Abstract

The present invention discloses a kit, application and method for rapid detection of Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a one-step method. The Mycoplasma gallisepticum visualization detection kit of the present invention is based on hmpG1, a new nucleic acid detection target of Mycoplasma gallisepticum. The sample to be tested is first cracked with a lysis buffer to release genomic DNA, and then an ERA-CRISPR / Cas12a one-pot reaction is carried out in a constant temperature water bath or a metal bath. Under the mediation of a crRNA guide sequence, the Lb Cas12a enzyme combines with crRNA and target DNA to form a ternary complex, which activates the trans-cleavage activity of Cas12a. The ssDNA fluorescent probe in the reaction system can be arbitrarily cut to release the fluorescent group on the probe. Then, the fluorescent signal is detected with an ultraviolet lamp, or a colloidal gold test strip is used to detect whether the FAM and Biotin groups are cut off to determine the result. The ERA-CRISPR / Cas12a one-pot technology for rapid detection of Mycoplasma gallisepticum uses ERA amplification and CRISPR / Cas12a to specifically identify and cleave the Mycoplasma gallisepticum DNA target. It has high specificity and a detection sensitivity as low as 1.73 pg / μL, and can be used for rapid on-site detection of Mycoplasma gallisepticum in clinical samples.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a kit, application, and method for rapid detection of Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a one-step method. Background Art

[0002] Mycoplasma galliscepticum (MG), also known as Mycoplasma gallisepticum or Mycoplasma gallisepticum, is the most pathogenic and economically damaging avian mycoplasma in poultry. The disease it causes is commonly known as chronic respiratory disease. MG infection causes chronic respiratory symptoms accompanied by catarrhal inflammation of the mucosa and can also lead to severe air sac inflammation. Clinically, MG often co-infection with pathogens such as MS, Newcastle disease virus (NDV), infectious bronchitis virus (IBV), Haemophilus paragallinarum, or Escherichia coli can cause severe respiratory disease. Clinical manifestations include coughing, runny nose, tearing, dyspnea, or open mouth breathing, with crackles audible in severe cases. MG infection can lead to decreased egg production and quality in laying hens, reduced hatchability of hatching eggs, slowed growth and development in broiler chickens, and poor feed utilization. MG can also be vertically transmitted to the next generation of chicks through hatching eggs.

[0003] Current standards for detecting Mycoplasma gallisepticum are based on serological testing, pathogen detection, and PCR testing (e.g., NYT 553-2002, Diagnostic Techniques for Avian Mycoplasma Disease, NYT 553-2015, PCR Detection Methods for Avian Mycoplasma, and the OIE Manual of Standards for Diagnostic Tests and Vaccines—Avian Mycoplasma). Serological and conventional pathogen detection methods are cumbersome and time-consuming, failing to meet the disease prevention and control requirements of rapid on-site detection of Mycoplasma gallisepticum, timely control of transmission routes, and elimination of contamination sources. PCR methods, on the other hand, suffer from relatively low sensitivity, require a PCR instrument, and must be performed in a laboratory, resulting in relatively long testing times. Isothermal amplification techniques, such as LAMP and RPA (or ERA, which has independent intellectual property rights in China), offer advantages such as high sensitivity, short detection times, and the absence of expensive instrumentation. A constant temperature water bath or metal bath is sufficient, making them ideal for rapid on-site detection. However, their high sensitivity also leads to nonspecific amplification, particularly in LAMP. The CRIPSR / cas12a system is based on the targeted recognition and cleavage capabilities of the cas12a protein. The Cas12a family is a class of nucleases mediated by a single crRNA that can specifically recognize and cleave double-stranded DNA targets with a PAM sequence. After cas12a forms a ternary complex with crRNA and target double-stranded DNA, it activates the "trans-cleavage activity" against ssDNA in the reaction system, and can non-specifically cleave the reporter ssDNA in the system. However, when used alone for molecular diagnosis, a high amount of target DNA is required. Combining ERA isothermal amplification technology with CRIPSR / cas12a technology overcomes the shortcomings of these two methods and retains the advantages of ERA technology, such as high sensitivity, short detection time, and the absence of expensive instruments. It also has the advantages of CRIPSR / cas12a technology, such as good specificity.

[0004] The selection of a specific DNA target is the key to establishing a reliable method for detecting Mycoplasma gallisepticum nucleic acid DNA. The Mycoplasma gallisepticum detection target hmpG1 of the present invention is a new diagnostic marker screened by the present invention. This gene is only present in Mycoplasma gallisepticum.

[0005] Based on the above reasons, the present invention combines ERA isothermal amplification technology with CRIPSR / Cas12a technology based on the newly screened and identified target hmpG1, establishing a one-pot ERA-CRISPR / Cas12a technology for rapid and accurate on-site detection of Mycoplasma gallisepticum in clinical samples. The detection results can be reported visually by detecting the fluorescent signal of the reaction or using a test strip. Compared with existing methods for detecting Mycoplasma gallisepticum, this method has the advantages of high sensitivity, strong specificity, rapidity, no need for expensive equipment, and can be used for rapid on-site testing. Summary of the Invention

[0006] In view of this, the present invention provides a kit, application and method for rapid detection of Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a one-step method.

[0007] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0008] A kit for rapid detection of Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a one-step method, including sample lysis buffer, reaction buffer, ERA primers, crRNA guide sequence, Cas12a enzyme, ssDNA fluorescent probe, and colloidal gold test strips;

[0009] The nucleotide sequence of the ERA primer is:

[0010] F:5'-TTTTATTAGCATAATCTCCACCTGAGCATGA-3',

[0011] R:5'-GTAAGATATAACCAAGCCCTTTTAGTGAATC-3';

[0012] The crRNA guide sequence is:

[0013] 5'-UAAUUUCUACUAAGUGUAGAUCAAUUGUUUAUUUGAACCCAAUC-3'.

[0014] Preferably, the ssDNA fluorescent probe is a single-stranded nucleotide sequence labeled with FAM or FITC at the 5' end and BHQ1 or Biotin at the 3' end.

[0015] Preferably, the nucleotide sequence of the ssDNA fluorescent probe is ssDNA-FQ: 5'-FAM-TTTTTT-BHQ1-3' or 5'-FITC-TTTTTT-BHQ1-3', and ssDNA-FB: 5'-FAM-TTTTTT-BIO-3' or 5'-FITC-TTTTTT-BIO-3'.

[0016] Preferably, the positive control plasmid carrying Mycoplasma gallisepticum specific target DNA and the negative control Escherichia coli DH5a genomic DNA are also included.

[0017] Application of a one-step rapid detection kit for Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a in the visual detection of Mycoplasma gallisepticum.

[0018] The method for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method comprises the following steps:

[0019] S1. Place the sample cotton swab in lysis buffer to release the mycoplasma genomic DNA in the sample to be tested;

[0020] S2. Add the lysed Mycoplasma genomic DNA and the reaction system to a new reaction tube, and then place the reaction tube in a constant temperature water bath or a constant temperature metal bath to react, so that ERA isothermal amplification and CRISPR cleavage reactions are carried out simultaneously in the same reaction system, with ERA amplification and CRISPR cleavage occurring simultaneously;

[0021] S3. When using the ssDNA-FQ fluorescent probe, place the reaction tube in a constant temperature water bath or a constant temperature metal bath after the reaction is completed, use a handheld ultraviolet lamp to detect the fluorescent signal, and determine the test result based on the presence or absence of the fluorescent signal; when using the ssDNA-FB fluorescent probe, place the reaction tube in a constant temperature water bath or a constant temperature metal bath after the reaction is completed, insert the test strip into the reaction tube, and determine the result by observing whether a band appears at the detection line on the test strip within 5-10 minutes.

[0022] Preferably, in step S2, the reaction system is: 1.0 μM each of F / R primers, 10 μL of dissolving agent, 1.0 μL of activator, 2.5 μL of 10×Reaction buffer, 400 nM LbCas12a enzyme, 250 nM crRNA, 100 nM ssDNA, 2.0 μL of DNA template, ddH2O is added to 25 μL, mixed and reacted at 37 ° C for 40 minutes.

[0023] Preferably, in step S2, the reaction tube is placed in a 37° C. water bath or metal bath for 40 minutes, and the result is observed under a handheld ultraviolet lamp; or a test strip is inserted into the reaction tube, and the test result can be observed with the naked eye within 10 minutes.

[0024] Compared with the prior art, the present invention has achieved the following technical effects:

[0025] The kit for visual detection of Mycoplasma gallisepticum of the present invention first performs ERA amplification on the sample to be tested, and then, under the mediation of the crRNA guide sequence, guides the CRISPR / Cas12a system to recognize, bind and cleave the ERA amplification product to the target double-stranded DNA, activates the non-specific nuclease function, and then arbitrarily cuts the ssDNA fluorescent probe in the system to obtain the cleavage product, and finally determines the result by detecting the fluorescent group under cleavage or the fluorescent signal emitted by it.

[0026] The ERA-CRISPR / Cas12a technology for detecting Mycoplasma gallisepticum, developed by the present invention, achieves dual specificity through ERA amplification and crRNA recognition, achieving high specificity and sensitivity as low as 1.73 pg / μL. This allows for earlier detection of Mycoplasma gallisepticum infection in chickens, facilitating prevention and control. The kit of the present invention is characterized by its low cost, ease of use, reduced time consumption, high sensitivity, and strong specificity, while requiring no expensive equipment. The detection reaction is performed in a constant-temperature water bath or metal bath, effectively eliminating the need for large laboratory instruments. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a flow chart of the present invention for visual detection of Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a system;

[0028] Figure 2 This is a graph showing the specificity test results of Mycoplasma gallisepticum ERA detection according to the present invention;

[0029] Figure 3 This is a crRNA screening diagram of the Mycoplasma gallisepticum hmpG1 gene of the present invention;

[0030] Figure 4 3. This is a graph showing the sensitivity test results of the ERA-CRISPR / Cas12a one-step method for detecting Mycoplasma gallisepticum of the present invention;

[0031] Figure 5 This is a graph showing the specificity analysis results of the ERA-CRISPR / Cas12a one-step method for detecting Mycoplasma gallisepticum;

[0032] Figure 6 The positive control results of the ERA-CRISPR / Cas12a one-step method for detecting Mycoplasma gallisepticum of the present invention are shown in (A) the results are observed under ultraviolet light; (B) the detection results are displayed using a test strip for color development. DETAILED DESCRIPTION

[0033] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0034] The present invention discloses a kit for rapid detection of Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a one-step method, comprising a sample lysis buffer, a reaction buffer, an ERA primer, a crRNA guide sequence, a Cas12a enzyme, an ssDNA fluorescent probe, and a colloidal gold test strip;

[0035] The nucleotide sequences of the ERA primers are:

[0036] F:5'-TTTTATTAGCATAATCTCCACCTGAGCATGA-3',

[0037] R:5'-GTAAGATATAACCAAGCCCTTTTAGTGAATC-3';

[0038] The crRNA guide sequence is:

[0039] 5'-UAAUUUCUACUAAGUGUAGAUCAAUUGUUUAUUUGAACCCAAUC-3'.

[0040] The ssDNA fluorescent probe is a single-stranded nucleotide sequence labeled with FAM or FITC at the 5' end and BHQ1 or Biotin at the 3' end.

[0041] The nucleotide sequences of the ssDNA fluorescent probes are ssDNA-FQ: 5'-FAM-TTTTTT-BHQ1-3' or 5'-FITC-TTTTTT-BHQ1-3', and ssDNA-FB: 5'-FAM-TTTTTT-BIO-3' or 5'-FITC-TTTTTT-BIO-3'.

[0042] Also included are a positive control plasmid carrying a Mycoplasma gallisepticum-specific target DNA, and a negative control, Escherichia coli DH5a genomic DNA.

[0043] Application of a one-step rapid detection kit for Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a in the visual detection of Mycoplasma gallisepticum.

[0044] The method for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method comprises the following steps:

[0045] S1. Place the sample cotton swab in lysis buffer to release the mycoplasma genomic DNA in the sample to be tested;

[0046] S2. Add the lysed Mycoplasma genomic DNA and the reaction system to a new reaction tube, and then place the reaction tube in a constant temperature water bath or a constant temperature metal bath to react, so that ERA isothermal amplification and CRISPR cleavage reactions are carried out simultaneously in the same reaction system, with ERA amplification and CRISPR cleavage occurring simultaneously;

[0047] S3. When using the ssDNA-FQ fluorescent probe, place the reaction tube in a constant temperature water bath or a constant temperature metal bath after the reaction is completed, use a handheld ultraviolet lamp to detect the fluorescent signal, and determine the test result based on the presence or absence of the fluorescent signal; when using the ssDNA-FB fluorescent probe, place the reaction tube in a constant temperature water bath or a constant temperature metal bath after the reaction is completed, insert the test strip into the reaction tube, and determine the result by observing whether a band appears at the detection line on the test strip within 5-10 minutes.

[0048] In step S2, the reaction system is: 1.0 μM each of F / R primers, 10 μL of solvent, 1.0 μL of activator, 2.5 μL of 10× reaction buffer, 400 nM LbCas12a enzyme, 250 nM crRNA, 100 nM ssDNA, 2.0 μL of DNA template, ddH2O is added to 25 μL, mixed and reacted at 37°C for 40 minutes.

[0049] In step S2, the reaction tube can be placed in a constant temperature reaction and fluorescence signal detection system at the same time; or the reaction can be carried out in a 37°C water bath or metal bath for 40 minutes, and then the results can be observed under a handheld ultraviolet lamp; or a test strip can be inserted into the reaction tube and the test results can be observed with the naked eye within 10 minutes.

[0050] Results of the ERA primer screening experiment for Mycoplasma gallisepticum: Figure 2 shown.

[0051] Mycoplasma gallisepticum hmpG1 gene crRNA screening: Figure 3 shown.

[0052] Sensitivity test results of ERA-CRISPR / Cas12a one-step detection of Mycoplasma gallisepticum: Figure 4 As shown, A is the fluorescence signal detected on the real-time fluorescence PCR instrument; B is the observation result under ultraviolet light. The concentration of the extracted Mycoplasma gallisepticum genome was measured to be 173 ng / μL. 3 , 10 4 , 10 5 Three different concentrations of genomic DNA extracted from Mycoplasma gallisepticum were used as templates for detection using the ERA-CRISPR / Cas12a one-step assay. The results showed that the minimum detection limit for Mycoplasma gallisepticum using the ERA-CRISPR one-step assay based on the hmpG1 target gene was 1.73 pg / μL.

[0053] A plasmid carrying the Mycoplasma gallisepticum-specific target DNA and Escherichia coli DH5a genomic DNA served as a negative control.

[0054] The present invention provides a method for visually detecting Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a system, the process is as follows Figure 1 As shown, the sample to be tested is first lysed with lysis buffer to release genomic DNA, then all the reaction systems are added to a new EP tube, and then the ERA-CRISPR / Cas12a one-pot reaction is carried out in a constant temperature water bath or a constant temperature metal bath. The system recognizes and binds to the ERA amplification product and cuts the target double-stranded DNA, and activates the non-specific nuclease function. Finally, a handheld UV lamp or colloidal gold test strip is used to develop the color and report the test results.

[0055] Example 1:

[0056] ERA primer design, screening and amplification system determination:

[0057] The DNA sequence (5’-ttgatgagaagcttaaatattcttacgaaaacgtgagattatggaactgcaatcacagaattcggtgcaaattttgttttggcgtttttaatcatgtttgttttcatgattattcgtagtaaaaagatcgaaaacaaattagtcatcagttcattttttgtttttgtcgtttttattagcataatctccacctgagcatgagcaagagttttaatgaactcatttccaattgtttatttgaacccaatcaatgtaatatttgatgcaattgtgcagatggttaatttacaaaactctagtactagtcatttaaccgattcactaaaagggcttggttatatcttaccaatgcagttagttggaattttgagtggttttgtttgcttttatatcttttatatcttgataacaaaaagtaaacaaacatatatcaaagcagttgcttttaatcagatcttatttaaaaccgataatcaaaaaacggtttattttgcttttaaagattttatttttatcttaatttatacagcagttatttcgatgattagtttgataaatcctgtcgcttcaggattaagacgaatcgactatctaatagttagtatgatcgttttattcgtaatcatttatttatcatcgttttttgaattctatacgtttgatatcttattgtcgtttgcttttgcaatcttttcaacattctttttattaattgaccagaatagcgacaaacaaacgattaaaactgagctaaaaaacacctgattgcattttttaatttcattaattattaccttggtaattgcaatagttcttgcaatcatcgtttatcaaatttttatccaaggacaacaccgtgttacaatctaa-3’) of the hmpG1 gene (locus tag: HFMG94VAA_3141) in the genome of Mycoplasma gallisepticum strain VA94_7994-1-7P (CP003506.1). A series of primer pairs that meet the ERA primer design principles were obtained with the assistance of PrimerExplorerV5 software.Synthesized by Beijing Qingke Biotechnology (PAGE purified); after a series of preliminary tests and screening. The primer screening results are as follows:

[0058] F:5'-TTTTATTAGCATAATCTCCACCTGAGCATGA-3',

[0059] B:5'-GTAAGATATAACCAAGCCCTTTTAGTGAATC-3';

[0060] The amplified fragment size was 176 bp;

[0061] After determining the optimal primer set, the reaction system including primer concentration, amplification temperature, and amplification time was optimized.

[0062] The optimized ERA amplification system was as follows: 10 μL of solvent, 1.0 μL of activator, 1.5 μL of F (10 μM), 1.5 μL of R (10 μM), 2.0 μL of sample DNA, and ddH2O was added to 25.0 μL.

[0063] Example 2:

[0064] crRNA screening:

[0065] Based on the 176 bp DNA sequence amplified by ERA, 6 possible Cas12a cleavage PAM sites (5'-TTN-3') and their 3' end 20-23 bp fragments were selected as targets for potential crRNA guide sequences. A plasmid carrying a T7 promoter and a Cas12a DRDNA fragment (constructed in the applicant's laboratory) was used as a template and the crRNA was cloned using HiScribe. TM RNA was obtained by reverse transcription using the T7 Rapid and Efficient RNA Synthesis Kit (NEB) and then Each crRNA was purified using an RNA purification kit (NEB).

[0066] The designed crRNAs were verified and screened using the ERA-CRIPSR / Cas12a one-step method. The crRNA sequences that can be used in the ERA-CRIPSR / Cas12a one-step detection system are:

[0067] 5'-UAAUUUCUACUAAGUGUAGAUCAAUUGUUUAUUUGAACCCAAUC-3'.

[0068] Example 3:

[0069] Specificity and sensitivity determination of the ERA-CRISPR / Cas12a method:

[0070] 1. Methods

[0071] (1) Based on the previously optimized ERA reaction system based on the hmpG1 target gene, the reaction temperature, Cas12a and crRNA concentrations of ERA-CRISPR / Cas12a for detecting Mycoplasma gallisepticum were further optimized, as well as the stability of the reaction detected by collecting fluorescence signals or colorimetric analysis of test strips.

[0072] (2) The extracted genomic DNA of Mycoplasma gallisepticum, Mycoplasma synoviae, Haemophilus paragallinarum, avian pathogenic Escherichia coli, Salmonella, Staphylococcus aureus and Riemerella anatipestifer were used as templates, and the specificity of the detection system was analyzed by the ERA-CRISPR / Cas12a one-step method. When the fluorescent probe used was ssDNA-FQ, the FAM fluorescence channel was selected using a fluorescent quantitative PCR instrument to collect the fluorescence signal. The reaction temperature was set to 37°C, and the fluorescence signal was measured once every 1 minute, for a total of 40 times for 40 minutes, and then the detection result was determined by the fluorescence signal curve; or after the reaction was completed, the measured PCR tube was placed under ultraviolet light for observation. The positive reaction tube should show a green fluorescence reaction, while the negative reaction tube and the blank control group should not show obvious fluorescence.

[0073] (3) The concentration of the extracted Mycoplasma gallisepticum genome was measured to be 173 ng / μL. Genomic DNA extracted from Mycoplasma gallisepticum at three different concentrations, 103, 104, and 105, was used as the detection template. The sensitivity of the ERA-CRISPR / Cas12a one-step detection system was then determined.

[0074] 2. Results

[0075] 1. Specificity analysis of the detection system:

[0076] The specificity of the established ERA-CRISPR / Cas12a one-step detection method for Mycoplasma gallisepticum was analyzed using the extracted genomic DNA of Mycoplasma gallisepticum, Mycoplasma synoviae, Haemophilus paragallinarum, avian pathogenic Escherichia coli, Salmonella, Staphylococcus aureus and Riemerella anatipestifer as detection templates. The results showed that only when the genomic DNA of Mycoplasma gallisepticum was used as the detection template did the real-time fluorescence detection show an amplification curve, and no obvious fluorescence signal appeared when the genomic DNA of the other six bacteria was used as a template. The reaction tube was placed under ultraviolet light for observation, and only the reaction tube with the genomic DNA of Mycoplasma gallisepticum as the template showed obvious green fluorescence, and no fluorescence reaction appeared in the other groups. Therefore, the established ERA-CRISPR / Cas12a one-step detection system for Mycoplasma gallisepticum has good specificity, such as Figure 5 As shown in FIG, A is the fluorescence signal curve on the real-time fluorescence PCR instrument; B is the observation result under 365nm ultraviolet light.

[0077] Example 4:

[0078] A kit for visual detection of Mycoplasma gallisepticum:

[0079] A kit for visually detecting Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a integrated detection system, including all reagents such as sample lysis buffer, reaction buffer, ERA primers, crRNA guide sequence, ssDNA fluorescent probe, dNTPs, a plasmid carrying Mycoplasma gallisepticum-specific target DNA as a positive control, and Escherichia coli DH5a genomic DNA as a negative control.

[0080] ERA primers:

[0081] F:5'-TTTTATTAGCATAATCTCCACCTGAGCATGA-3',

[0082] R:5'-GTAAGATATAACCAAGCCCTTTTAGTGAATC-3';

[0083] crRNA guide sequence:

[0084] 5'-UAAUUUCUACUAAGUGUAGAUCAAUUGUUUAUUUGAACCCAAUC-3';

[0085] ssDNA fluorescent probe:

[0086] 5'-FAM-TTTTTT-BHQ1-3', this fluorescent probe is used to detect the presence of Mycoplasma gallisepticum in the target system under the excitation of blue-green light or with the naked eye.

[0087] A method for visually detecting Mycoplasma gallisepticum using a kit comprises the following steps:

[0088] (1) Place the sample cotton swab in lysis buffer to release the mycoplasma genomic DNA in the sample to be tested;

[0089] (2) Add the above-mentioned lysed mycoplasma genomic DNA and reaction system (including reaction buffer, ERA primer, LbCas12a enzyme, crRNA and ssDNA fluorescent probe and dNTPs, etc.) to a new reaction tube, and then place the reaction tube in a constant temperature water bath or a constant temperature metal bath to react, so that ERA isothermal amplification and CRISPR cleavage reaction are carried out simultaneously in one reaction system;

[0090] (3) When using the ssDNA-FQ fluorescent probe, place the reaction tube in a 37°C water bath for 40 minutes, and then observe the results under a handheld ultraviolet lamp. If the reaction product has no fluorescence brightness under ultraviolet light or no brightness when observed with the naked eye, it means that Mycoplasma gallisepticum is not detected in the sample to be tested; if the reaction product has fluorescence brightness under ultraviolet light or brightness when observed with the naked eye, it means that Mycoplasma gallisepticum is detected in the sample to be tested.

[0091] When using the ssDNA-FB fluorescent probe, during on-site testing, after the reaction tube is placed in a 37-degree water bath or metal bath for 40 minutes, the test strip is inserted into the reaction system. Within 5-10 minutes, the result is determined based on whether the required bands appear at the test line and control line on the test strip: if bands appear at both the test line and the control line, or only at the test line, the test result is positive; if bands appear only at the control line, the test result is negative; if there are no bands at both the test line and the control line, the test reaction is invalid and needs to be repeated. The test results of the positive control are shown as follows: Figure 6 As shown, (A) observe the results under ultraviolet light; (B) use test strips to display the test results.

[0092] The above description is merely a preferred embodiment of the present invention and does not limit the technical scope of the present invention. Therefore, any minor modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention, as well as other detection techniques or detection kits for Mycoplasma gallisepticum based on the novel nucleic acid detection marker hmpG1 of the present invention, are within the scope of protection of the present invention.

Claims

1. A kit for rapid detection of Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a one-step method, characterized in that: Includes sample lysis buffer, reaction buffer, ERA primer, crRNA guide sequence, Cas12a enzyme, ssDNA fluorescent probe and colloidal gold test strip; The nucleotide sequence of the ERA primer is: F:5'-TTTTATTAGCATAATCTCCACCTGAGCATGA-3', R:5'-GTAAGATATAACCAAGCCCTTTTAGTGAATC-3'; The crRNA guide sequence is: 5'-UAAUUUCUACUAAGUGUAGAUCAAUUGUUUAUUUGAACCCAAUC-3'.

2. The kit for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method according to claim 1, characterized in that The ssDNA fluorescent probe is a single-stranded nucleotide sequence with a 5' end labeled with FAM or FITC and a 3' end labeled with BHQ1 or Biotin.

3. The kit for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method according to claim 1, characterized in that The nucleotide sequence of the ssDNA fluorescent probe is ssDNA-FQ: 5'-FAM-TTTTTT-BHQ1-3' or 5'-FITC-TTTTTT-BHQ1-3', and ssDNA-FB: 5'-FAM-TTTTTT-BIO-3' or 5'-FITC-TTTTTT-BIO-3'.

4. The kit for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method according to claim 1, characterized in that Also included are a positive control plasmid carrying a Mycoplasma gallisepticum-specific target DNA, and a negative control, Escherichia coli DH5a genomic DNA.

5. Use of the kit for rapid detection of Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a one-step method according to any one of claims 1 to 4 in visual detection of Mycoplasma gallisepticum for non-diagnostic and therapeutic purposes.

6. A method for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a for non-diagnostic and therapeutic purposes, characterized in that: The steps include: S1. Place the sample cotton swab in lysis buffer to release the mycoplasma genomic DNA in the sample to be tested; S2. Add the lysed Mycoplasma genomic DNA and the reaction system to a new reaction tube, and then place the reaction tube in a constant temperature water bath or a constant temperature metal bath to react, so that ERA isothermal amplification and CRISPR cleavage reactions are carried out simultaneously in the same reaction system, with ERA amplification and CRISPR cleavage occurring simultaneously; S3. When using the ssDNA-FQ fluorescent probe, place the reaction tube in a constant temperature water bath or a constant temperature metal bath after the reaction is completed, use a handheld ultraviolet lamp to detect the fluorescent signal, and determine the test result based on the presence or absence of the fluorescent signal; when using the ssDNA-FB fluorescent probe, place the reaction tube in a constant temperature water bath or a constant temperature metal bath after the reaction is completed, insert the test strip into the reaction tube, and determine the result by observing whether a band appears at the detection line on the test strip within 5-10 minutes.

7. The method for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method according to claim 6, characterized in that In step S2, the reaction system is: 1.0 μM each of F / R primers, 10 μL of solvent, 1.0 μL of activator, 2.5 μL of 10× reaction buffer, 400 nM LbCas12a enzyme, 250 nM crRNA, 100 nM ssDNA, 2.0 μL of DNA template, and ddH2O is added to 25 μL. After mixing, the mixture is reacted at 37°C for 40 minutes.

8. The method for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method according to claim 6, characterized in that In step S2, the reaction tube is placed in a 37° C. water bath or metal bath for 40 minutes, and the results are observed under a handheld UV lamp; or a test strip is inserted into the reaction tube, and the test results can be observed with the naked eye within 10 minutes.

Images