SNP (Single Nucleotide Polymorphism) marker related to wheat grain shape and application thereof

Abstract

The invention relates to the technical field of gene engineering, and discloses an SNP (Single Nucleotide Polymorphism) marker related to a wheat grain shape and application thereof. The SNP locus provided by the invention is located at the 687135095th bp of a wheat 1B chromosome, and has G / A polymorphism. Through phenotypic difference analysis and an exon capture technology, it is determined that the SNP is closely related to the grain type, and a specific KASP primer combination is developed and used for rapidly and accurately identifying the grain type of wheat. The technology has important significance in accelerating high-yield breeding of wheat, not only improves the selection efficiency and shortens the breeding period, but also contributes to quickly identifying and cultivating wheat varieties with ideal grain shapes. The KASP primer combination provides an effective tool for molecular marker-assisted selection, and can improve yield-related characters, thereby improving the overall yield and quality of crops.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to a SNP marker associated with wheat grain type and application thereof. Background Art

[0002] wheat( Triticum aestivum L.) is one of the most widely planted food crops in the world, and its high yield plays an important role in food security. Wheat grain shape refers to the shape, size and structural characteristics of wheat grains. It includes the length, width and thickness of the grain. Grain shape not only affects the yield and quality of wheat, but also its performance during processing. Wheat grain shape is one of the important indicators for evaluating and improving wheat, and is of great significance to food production and the food industry. With the increasing global demand for food safety and nutrition, optimizing wheat grain shape has become an important direction of breeding research.

[0003] Exome sequencing is a technical method that uses sequence capture technology to capture and enrich the DNA in the exon region of the whole genome, and then uses high-throughput sequencing technology to detect genetic mutations related to protein functional variation. Compared with whole genome sequencing, exome sequencing is more economical and efficient, especially when studying known genetic variations such as SNPs and InDels.

[0004] KASP (Kompetitive Allele Specific PCR) is a molecular marker method based on SNP loci. It is widely popular in the field of genotyping due to its high stability, accuracy and cost-effectiveness. KASP technology is particularly suitable for high-throughput analysis, especially when the number of samples is large and there are few available SNP loci. The application of KASP not only significantly speeds up the speed and efficiency of genotyping, but also effectively reduces costs. Therefore, it has shown broad application prospects in agricultural breeding, genetic research, molecular diagnosis and other fields. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP marker related to wheat grain type and application thereof.

[0006] To achieve the purpose of the present invention, in a first aspect, the present invention provides a SNP marker associated with wheat grain type, wherein the marker contains a nucleotide sequence with a polymorphism of G / A at 687135095 bp of wheat chromosome 1B.

[0007] The above physical positions are based on the wheat genome version IWGSC 2.1.

[0008] Furthermore, the plants with the genotype of the polymorphic site contained in the marker being AA have higher thousand-grain weight, grain length, grain width and grain thickness than the plants with the genotype being GG.

[0009] In a second aspect, the present invention provides a KASP primer combination for amplifying the marker, comprising forward primer 1 (ACCTCTTTTTTCGACAGAG) as shown in SEQ ID NO: 1, forward primer 2 (ACCTCTTTTTTCGACAGAA) as shown in SEQ ID NO: 2, and reverse primer (TCTGCCAAAGTTCCTCTGGA) as shown in SEQ ID NO: 3.

[0010] Furthermore, the 5′ ends of the forward primer 1 and the forward primer 2 in the KASP primer combination may also be connected to a fluorescent marker sequence, such as FAM (GAAGGTGACCAAGTTCATGCT) or HEX (GAAGGTCGGAGTCAACGGATT).

[0011] In a specific embodiment of the present invention, the KASP primer combination is as follows: 687135095-F1: 5'-GAAGGTGACCAAGTTCATGCTACCTCTTTTTTCGACAGAG-3'; (SEQ IDNO: 4) 687135095-F2: 5'-GAAGGTCGGAGTCAACGGATTACCTCTTTTTTCGACAGAA-3'; (SEQ IDNO: 5) 687135095-R: 5'-TCTGCCAAAGTTCCCTGGA-3' (SEQ ID NO: 3).

[0012] In a third aspect, the present invention also provides a detection reagent or a kit containing the primer combination.

[0013] In a fourth aspect, the present invention provides a method for identifying plant grain type, comprising: using the DNA of the plant sample to be tested as a template, using the KASP primer combination or the detection reagent or kit to perform PCR amplification, and judging the grain type of the plant sample to be tested according to the amplification result.

[0014] Preferably, based on a total system of 10 μL, the system used for PCR amplification includes: 4-6 μL of 2×KASP Mix, 0.12-0.16 μL of primer mixture, 25-35 ng of DNA template, and the remainder is water.

[0015] The primer mixture, calculated in 100 μL, includes: 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 28-32 μL, and the remainder is water.

[0016] Preferably, the reaction program adopted for PCR amplification is: 95°C 8-12min; 95°C 15-25s, 61°C 60s, 8-12 cycles, with the annealing temperature decreasing by 0.5°C-0.7°C in each cycle; 95°C 15-25s, 55°C 35-45s, 32-36 cycles; 25°C 10-20min.

[0017] Furthermore, judging the thousand-grain weight of the plant sample to be tested according to the amplification result includes: analyzing the genotype of the polymorphic site contained in the marker in the amplification product, and the plant with genotype AA has higher thousand-grain weight, grain length, grain width and grain thickness than the plant with genotype GG.

[0018] Furthermore, the plant is wheat.

[0019] In a fifth aspect, the present invention provides any of the following applications of the marker, the marker combination, or the detection reagent or kit: (1) Used for identification, breeding and improvement of wheat grain types; (2) Used for early prediction of wheat grain traits; (3) Used in wheat molecular marker-assisted breeding; (4) Used for screening or cultivating high-yield plants.

[0020] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: (I) The present invention successfully identified a SNP site closely related to plant grain shape through phenotypic difference analysis and exon capture sequencing technology. The polymorphism detection of this site can accurately and quickly evaluate the grain shape characteristics of plants.

[0021] (II) Using KASP technology, the SNP sites and corresponding primer combinations provided by the present invention not only improve the efficiency of plant variety selection, but also help shorten the breeding cycle and accelerate the cultivation of high-quality plant varieties. These markers have good genetic stability and high resolution, are suitable for high-throughput detection, and have significant application value in the field of plant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a SNP site map of the exon of the TraesCS1B02G479200 gene obtained by analyzing the exon capture sequencing technology provided in Example 1 of the present invention.

[0023] Figure 2 It is a statistical diagram of grain shape traits of different genotypes at locus 687135095 of chromosome 1B provided in Example 2 of the present invention.

[0024] Figure 3It is the typing result of the wheat genotype at the 687135095 site of chromosome 1B provided in Example 2 of the present invention; wherein AA represents 687135095-A, GG represents 687135095-G, and CK represents a no-template control, that is, ultrapure water is used instead of sample DNA.

[0025] Figure 4 This is the sequencing peak diagram of different genotypes of the 687135095 site of chromosome 1B provided in Example 2 of the present invention. DETAILED DESCRIPTION

[0026] The present invention aims to provide a SNP marker related to plant grain type and application thereof.

[0027] The present invention adopts the following technical solution: The invention provides a SNP molecular marker related to plant grain type. The marker contains a nucleotide sequence of G / A polymorphism at the 687135095 bp position of wheat 1B chromosome.

[0028] Furthermore, the genotype of the polymorphic site contained in the marker is AA, and the plant has a higher thousand-grain weight, grain length, grain width and grain thickness than the plant with the genotype of GG.

[0029] The present invention also provides a KASP primer combination for amplifying the marker, comprising a forward primer 1 (ACCTCTTTTTTCGACAGAG) as shown in SEQ ID NO: 1, a forward primer 2 (ACCTCTTTTTTCGACAGAA) as shown in SEQ ID NO: 2, and a reverse primer (TCTGCCAAAGTTCCTCTGGA) as shown in SEQ ID NO: 3.

[0030] Furthermore, the 5′ ends of the forward primer 1 and the forward primer 2 in the KASP primer combination may also be connected to a fluorescent marker sequence, such as FAM (GAAGGTGACCAAGTTCATGCT) or HEX (GAAGGTCGGAGTCAACGGATT).

[0031] In a specific embodiment of the present invention, the KASP primer combination is as follows: 687135095-F1: 5'-GAAGGTGACCAAGTTCATGCTACCTCTTTTTTCGACAGAG-3'; (SEQ IDNO: 4) 687135095-F2: 5'-GAAGGTCGGAGTCAACGGATTACCTCTTTTTTCGACAGAA-3'; (SEQ IDNO: 5) 687135095-R: 5'-TCTGCCAAAGTTCCCTGGA-3' (SEQ ID NO: 3).

[0032] The present invention also provides a detection reagent or a kit containing the primer combination.

[0033] The present invention also provides a method for identifying plant grain type, comprising: using the DNA of the plant sample to be tested as a template, using the KASP primer combination or the detection reagent or kit to perform PCR amplification, and judging the grain type of the plant sample to be tested according to the amplification result.

[0034] Preferably, based on a total system of 10 μL, the system used for PCR amplification includes: 4-6 μL of 2×KASP Mix, 0.12-0.16 μL of primer mixture, 25-35 ng of DNA template, and the remainder is water.

[0035] The primer mixture, calculated in 100 μL, includes: 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 28-32 μL, and the remainder is water.

[0036] Preferably, the reaction program adopted for PCR amplification is: 95°C 8-12min; 95°C 15-25s, 61°C 60s, 8-12 cycles, with the annealing temperature decreasing by 0.5°C-0.7°C in each cycle; 95°C 15-25s, 55°C 35-45s, 32-36 cycles; 25°C 10-20min.

[0037] Furthermore, judging the grain type of the plant sample to be tested according to the amplification result includes: analyzing the genotype of the polymorphic site contained in the marker in the amplification product, and the plant with genotype AA has higher thousand-grain weight, grain length, grain width and grain thickness than the plant with genotype GG.

[0038] Furthermore, the plant is wheat.

[0039] In a fifth aspect, the present invention provides any of the following applications of the marker, the marker combination, or the detection reagent or kit: (1) Used for identification, breeding and improvement of wheat grain types; (2) Used for early prediction of wheat grain traits; (3) Used in wheat molecular marker-assisted breeding; (4) Used for screening or cultivating high-yield plants.

[0040] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0041] The wheat varieties (lines) involved in the following examples were all provided by Researcher Zhang Xueyong of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. The wheat was sown in Xinxiang, Henan Province, harvested after physiological maturity, naturally dried and used for subsequent analysis.

[0042] It should be noted that, as a professional agricultural research institution, the applicant has long preserved relevant germplasm materials, and the relevant wheat varieties are publicly available on the market or in existing germplasm banks.

[0043] Example 1 Acquisition of SNP markers related to plant grain shape and design of KASP primers 1. 152 exon capture sequencing The whole exome sequencing process mainly includes the following four steps: 1) Sample testing: Before DNA sequencing, the quality and quantity of the sample DNA must be ensured by agarose gel electrophoresis and nanodrop detection. The DNA concentration must be no less than 20ng / ul and the total amount must be no less than 800ng to ensure the accuracy and repeatability of sequencing.

[0044] 2) Library construction: Use Covaris fragmentor to randomly break genomic DNA into 180-280bp fragments. Then, use Agilent SureSelect kit to complete DNA end repair, phosphorylation, and poly A tailing. Liquid phase hybridization is used to enrich the exon region, and biotin-labeled probes are used for specific hybridization with libraries with specific indexes, followed by PCR amplification. Finally, the amplified library is quality tested to ensure that the quality of the library meets the standards before sequencing.

[0045] 3) Library inspection: After the library is constructed, Qubit 2.0 is used for preliminary quantification. Then, the Agilent 2100 bioanalyzer detects the inserted fragments to ensure that the size is appropriate. After passing the test, the effective concentration of the library is accurately quantified to 3nmol / L by Q-PCR to ensure the quality and accuracy of the sequencing library.

[0046] 4) Sequencing: After the library is qualified, PE150 sequencing is performed using the Illumina HiSeq platform according to the effective concentration of the library and data requirements. PE150 is double-end sequencing, with 150bp reads at each end. High-throughput sequencing is performed using the insert fragments of the small fragment library to facilitate subsequent sequence comparison and analysis, and improve the accuracy and reliability of the data.

[0047] 2. Obtain different wheat grain shapes and develop SNP molecular markers To screen for key genes affecting wheat grain shape, we first measured grain shape-related traits in 152 wheat varieties to assess their phenotypic variation. This basic data collection is the first step in understanding the genetic background of grain shape. The results are shown in Table 1, laying the foundation for further genetic analysis and breeding research.

[0048] Based on the 152 grain phenotype data obtained in step 2, combined with the results of exon capture sequencing analysis, the contribution of SNP sites of important genes to grain shape was explored. A SNP site was screened in the exon of TraesCS1B02G479200 gene on chromosome 1B of the wheat genome. The SNP variation of this site significantly increased the thousand-grain weight, grain length, grain width and grain thickness, and a significant site affecting wheat grain shape was identified (1B: 687135095bp) (part of the results are shown in Figure 1 ), and named the site: 687135095.

[0049] Based on the above sequence differences and the KASP principle, a primer set for PCR amplification to obtain the wheat molecular marker was further developed and designed. The specific design is as follows: 687135095-F1: 5'-GAAGGTGACCAAGTTCATGCTACCTCTTTTTTCGACAGAG-3' (the 5' end "GAAGGTGACCAAGTTCATGCT" part of the sequence is the FAM tag sequence) 687135095-F2: 5'-GAAGGTCGGAGTCAACGGATTACCTCTTTTTTCGACAGAA-3', (the 5' end "GAAGGTCGGAGTCAACGGATT" part of the sequence is the HEX tag sequence) 687135095-R: 5'- TCTGCCAAAGTTCCTCTGGA -3'; When 687135095-F1 and 687135095-R are used as a primer pair combination, it is used to amplify the sequence of the base G at the 687135095 position of chromosome 1B in the wheat molecular marker; When 687135095-F2 and 687135095-R are used as a primer pair combination, they are used to amplify the sequence with base A at position 687135095 of chromosome 1B in the wheat molecular marker.

[0050] Example 2 Application of SNP markers in identifying wheat grain types 1. Based on the primer pair design of Example 1, the present invention detected the genotypes of 152 wheat materials (20 GG / 20 AA), and identified the correlation between genotype and grain phenotype. The specific process is as follows: First, genomic DNA of each wheat variety was extracted; Then, according to the primers designed in Example 1, the above extracted DNA was used as a template to perform PCR (using Quant Studio1 fluorescent quantitative PCR instrument) detection and analysis on different wheat samples.

[0051] During specific PCR amplification, the 10 μL amplification system was designed as follows: KASP Mix (2×), 5 μL; HiGeno 2× Probe Mix (supplied at 2× concentration), containing Taq DNA polymerase, universal fluorescent reporter probe, dNTPs, buffer, MgCl2, and reference dye ROX.

[0052] Primer Mix, 0.14 μL; DNA, 30 ng; Add ddH2O to 10 μL.

[0053] Wherein, the Primer Mix, per 100 μL: 687135095-F1, 100 μM, 12 μL; 687135095-F2, 100 μM, 12 μL; 687135095-R, 100 μM, 30 μL; ddH2O, 46 μL.

[0054] The PCR reaction program (which can be adjusted appropriately according to the amplification results) is: 95℃ for 10 min; 95℃ for 20 s, 61℃ for 60 s (10 cycles, decreasing by 0.6℃ each cycle); 95℃ for 20 s, 55℃ for 40 s, 34 cycles; 25℃ for 15 min.

[0055] 2. Use the genomic DNA of each wheat variety extracted in step 1 to perform conventional PCR and sequencing to verify the accuracy of KASP genotyping.

[0056] First, specific primers were designed for amplification at 687135095 bp of wheat chromosome 1B (the reference sequence was Chinese spring wheat). The primer sequences were: CF: 5'-GTGATGACCTTTCACCTTTGTGACT-3' CR: 5'-GTGTTGTGTTGCAGTATGCTTGCA-3' Six wheat varieties with GG / AA genotypes according to KASP genotyping results were randomly selected, amplified using a common PCR instrument, and sequenced after electrophoresis detection to verify the reliability of the genotyping results.

[0057] During specific PCR amplification, the 25 μL amplification system was designed as follows: Bio-Gold 2×EasyTaq® PCR SuperMix for PAGE (+dye), 10 μL; Primers CF / CR, 1 μL each; primer concentration was 10 μM; DNA, 60 ng; Add ddH2O to 25 μL.

[0058] The PCR reaction program (which can be adjusted appropriately according to the amplification results) is: 94℃ 5min; 94℃ 30s, 58℃ 30s, 72℃ 40s (35 cycles); 72℃ 10min; end at 16℃.

[0059] The statistical results of the specific genotype and wheat grain type related traits are shown in Tables 1 to 3 and Figure 1-Figure 4 shown.

[0060] Table 1 Correspondence between different wheat genotypes and their grain shape-related traits

[0061] Table 2 Correspondence between different wheat genotypes and their grain shape-related traits

[0062] Table 3 Correspondence between different wheat genotypes and their grain shape related traits

[0063] From the above experimental results, it can be seen that the average thousand-grain weight of GG genotype wheat is 32.423 g, and the average thousand-grain weight of AA genotype wheat is 49.074 g. The thousand-grain weight of AA genotype wheat is significantly higher than that of GG genotype wheat, an increase of 51.36%; the average grain length of GG genotype wheat is 6.332 mm, and the average grain length of AA genotype wheat is 7.266 mm. The grain length of AA genotype wheat is significantly higher than that of GG genotype wheat, an increase of 14.75%; the average grain thickness of GG genotype wheat is 2.701 mm, and the average grain thickness of AA genotype wheat is 2.878 mm. The grain thickness of AA genotype wheat is significantly higher than that of GG genotype wheat, an increase of 6.55%; the average grain width of GG genotype wheat is 3.043 mm, and the average grain width of AA genotype wheat is 3.688 mm, the grain thickness of AA genotype wheat was significantly higher than that of GG genotype wheat, increasing by 21.24%; all of them were significantly different at the p<0.01 level. That is, the thousand-grain weight, grain length, grain thickness and grain width of GG genotype wheat were significantly lower than those of AA genotype wheat.

[0064] The present invention can accurately determine the grain shape of wheat by detecting specific SNP sites through carefully designed primers. This technology not only provides accurate genotype information for molecular breeding, but also helps to quickly screen wheat varieties with ideal grain shapes. In addition, the technology and theoretical support of the present invention have made significant technical contributions to the development of high-yield wheat varieties, promoting agricultural scientific and technological progress and increasing crop yields.

[0065] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A SNP marker associated with wheat grain type, characterized in that: The marker contains a nucleotide sequence with a polymorphism of G / A at 687135095 bp of wheat chromosome 1B; The above physical positions are based on the wheat genome version IWGSC 2.

1.

2. The marking according to claim 1, characterized in that Compared with plants with a genotype of AA at the polymorphic site contained in the marker and a genotype of GG, the plants have higher thousand-grain weight, grain length, grain width and grain thickness.

3. A KASP primer combination for amplifying the marker according to claim 1 or 2, characterized in that: It includes a forward primer 1 as shown in SEQ ID NO: 1, a forward primer 2 as shown in SEQ ID NO: 2, and a reverse primer as shown in SEQ ID NO:

3.

4. A detection reagent or kit containing the primer combination according to claim 3.

5. A method for identifying plant grain type, characterized in that: include: Using the DNA of the plant sample to be tested as a template, PCR amplification is performed using the KASP primer combination described in claim 3 or the detection reagent or kit described in claim 4, and the grain type of the plant sample to be tested is determined based on the amplification result.

6. The method according to claim 5, characterized in that Based on a total system of 10 μL, the system used for PCR amplification includes: 2×KASP Mix 4~6 μL, primer mixture 0.12~0.16 μL, DNA template 25~35 ng, and the balance is water; The primer mixture, calculated as 100 μL, includes: 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 28-32 μL, and the remainder is water.

7. The method according to claim 6, characterized in that The reaction program used for PCR amplification was: 95°C for 8-12 min; 95°C for 15-25 s, 61°C for 60 s, 8-12 cycles, with the annealing temperature decreasing by 0.5°C-0.7°C in each cycle; 95°C for 15-25 s, 55°C for 35-45 s, 32-36 cycles; 25°C for 10-20 min.

8. The method according to claim 6 or 7, characterized in that: Judging the grain type of the plant sample to be tested according to the amplification result includes: analyzing the genotype of the polymorphic site contained in the marker in the amplification product, and the plant with genotype AA has higher thousand-grain weight, grain length, grain width and grain thickness than the plant with genotype GG.

9. The method according to any one of claims 5 to 8, characterized in that: The plant is wheat.

10. Any of the following uses of the marker according to claim 1 or 2, the KASP primer combination according to claim 3, or the detection reagent or kit according to claim 4: (1) Used for identification, breeding and improvement of wheat grain types; (2) Used for early prediction of wheat grain traits; (3) Used in molecular marker-assisted breeding of wheat.

Images