A Pixian Doubanjiang (fermented broad bean paste) and its preparation method, and Monascus purpureus M5.

Abstract

The present application relates to the field of microbial fermented food, and specifically discloses a Pixian bean paste and a preparation method thereof, and purple Monascus M5 (Monascus purpureus M5). The strain is preserved by the China Center for Type Culture Collection, and the preservation number is CCTCC NO: M20241379. The purple Monascus M5 has excellent salt tolerance and can remain active in an environment with a salt content of 10-12%. The Pixian bean paste obtained by fermenting bean paste and a mixture of sweet bean paste and pepper embryos with purple Monascus M5 has a better color due to the high red pigment production of purple Monascus M5; on the other hand, since purple Monascus M5 belongs to Monascus, the obtained product can have the health care effects of dehumidification, blood circulation, and lipid reduction. At the same time, the fermentation flavor and amino acid content of Pixian bean paste can be further increased, thereby improving the quality of Pixian bean paste.

Description

Technical Field

[0001] The present application relates to the field of microbial fermented food, and more specifically, to a Pixian bean paste and a preparation method thereof, and Monascus purpureus M5. Background Art

[0002] Pixian Doubanjiang is an indispensable condiment in Sichuan cuisine. It is rich in flavor and rich in flavor substances. It is known as the "soul of Sichuan cuisine" and is also a Chinese geographical indication product. Pixian Doubanjiang is one of the top condiments in China. It is unique in material selection and craftsmanship. It has a mellow aroma without adding any spices. The color is oily. It relies on fine processing technology and excellent raw materials to achieve the standard of excellent color, aroma and taste. Pixian Doubanjiang has the characteristics of strong spicy taste, bright red and oily, large chili pieces, and sweet aftertaste.

[0003] The reason why Pixian bean paste has a unique flavor is that the microorganisms rich in it can produce many flavor substances during the fermentation process, but the number of microorganisms in nature is huge and the types are numerous. The types of microorganisms bred in different regions and climates also have different properties. Pixian bean paste contains a lot of salt during the fermentation process, which requires the microorganisms to have good salt tolerance and can survive and ferment normally in an environment with a salt content of 10-12%. At the same time, the main source of the red color of the existing Pixian bean paste is pepper. During the fermentation process, the color of the pepper will be affected by many factors, which will affect the grade of the resulting product. In addition, Pixian bean paste is rich in protein and vitamins, which can delay arteriosclerosis, lower cholesterol, promote intestinal peristalsis, and increase appetite. With people's pursuit of healthy life, the health benefits of Pixian bean paste also need to be developed. Summary of the invention

[0004] In order to solve the above technical problems, the present application provides a Pixian bean paste and a preparation method thereof, and purple Monascus M5 (Monascus purpureus M5).

[0005] This application adopts the following technical solutions: In a first aspect, the present application provides a Pixian bean paste, which is obtained by fermenting broad beans with Monascus purpureus M5; The Monascus purpureus M5 is deposited by the China Center for Type Culture Collection with the deposit number of CCTCC NO: M20241379, the deposit date of June 26, 2024, and the deposit address of Wuhan University, Wuhan, China.

[0006] In a second aspect, the present application provides a method for preparing Pixian bean paste using Monascus purpureus M5, comprising: (1) The spores of the purple Monascus M5 are inoculated into a broad bean paste medium, and fermented at 25-35° C. for 4-7 days to obtain a purple Monascus M5 fermentation liquid, wherein the number of spores in the purple Monascus M5 fermentation liquid is 1×10 10 -1×10 12 Pieces / mL; (2) mixing edible salt and water, and adding the purple Monascus M5 fermentation liquid to obtain a purple Monascus M5 bacterial suspension; (3) mixing the purple Monascus M5 bacterial suspension, edible salt, water and bean curd, stirring evenly and fermenting at 32-40° C. for 150-200 days to obtain sweet bean curd; (4) Mixing the sweet peppers with pepper embryos, adding the purple Monascus M5 bacterial suspension and mixing evenly, fermenting at room temperature for 150-200 days, and then adding edible salt and water to obtain Pixian bean paste.

[0007] Furthermore, in the above step (3), the amount of bean curd, edible salt, water, and purple Monascus M5 suspension is 1000:510:1650:70-140 according to the weight ratio of dry broad beans corresponding to the pretreated broad beans used to prepare bean curd: edible salt: water: purple Monascus M5 suspension.

[0008] Furthermore, in the above step (4), the weight ratio of the sweet pepper peel: pepper embryo: purple Monascus M5 bacterial suspension is 30:70:5-7.

[0009] In the third aspect, the present application provides a purple Monascus M5 (Monascus purpureus M5), which is preserved by the China Center for Type Culture Collection, with the preservation number CCTCC NO: M20241379, the preservation date is June 26, 2024, and the preservation address is: Wuhan University, Wuhan, China.

[0010] Furthermore, the ITS sequence of the above-mentioned Monascus purpurogenum M5 is shown in SEQ ID NO.1:.

[0011] In a fourth aspect, the present application provides a red yeast rice fermentation agent, wherein the red yeast rice fermentation agent contains the above-mentioned Monascus purpureus M5.

[0012] In a fifth aspect, the present application provides a use of the above-mentioned Monascus purpureus M5 in the preparation of fermented food.

[0013] Furthermore, the fermented food includes any one of bean paste, soy sauce, vinegar, wine and bread.

[0014] In a sixth aspect, the present application provides a fermented food, which is obtained by fermentation using the above-mentioned Monascus purpureus M5.

[0015] In summary, this application has the following beneficial effects: This application screened single colonies with typical morphological characteristics of Monascus from red yeast rice samples from farmers in Fujian, further streaked and cultured, and obtained 8 purified strains. After repeated screening, strain M5 that can produce high yields of red yeast pigment and extracellular lovastatin was obtained. By sequencing the PCR amplification products of the strain, performing BLAST comparison analysis on the spliced ​​sequencing results and the NCBI database and constructing an evolutionary tree, it was determined that strain M5 was purple Monascus M5 (Monascus purpureus M5).

[0016] Compared with the existing purple Monascus and other strains screened, this purple Monascus M5 (Monascus purpureus M5) can produce high levels of red pigment and extracellular lovastatin. This suggests that the purple Monascus M5 (Monascus purpureus M5) can be applied to some fermented products, such as bean paste, soy sauce, vinegar, wine and bread, etc. The extracellular pigment produced has a certain antibacterial effect and can effectively improve the color of the fermented products; the extracellular lovastatin produced by it has the biological activity of lowering blood lipids and preventing atherosclerosis, which helps to enhance the nutritional value and health effects of such fermented products.

[0017] The present application provides a Pixian bean paste obtained by fermenting broad beans with purple Monascus M5 (Monascus purpureus M5). The purple Monascus M5 has good salt tolerance and can remain active in an environment with a salt content of 10-12%. It ferments a mixture of broad beans and sweet broad beans and pepper embryos. On the one hand, due to the high red pigment production of purple Monascus M5, the obtained Pixian bean paste has a better color; on the other hand, since purple Monascus M5 belongs to Monascus, it can make the Pixian bean paste have the health care effects of dehumidification, blood circulation, and lipid reduction. At the same time, the fermentation flavor and amino acid content of Pixian bean paste can be further increased, and the quality of Pixian bean paste can be improved, especially the color, aroma and taste indicators all meet the special index requirements for Pixian bean paste in GB / T20560-2006 "Geographical Indication Product Pixian Douban". BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The colony morphology of Monascus purpurogenus M5 provided in Example 2 of the present application; Figure 2 The microscopic morphology of Monascus purpurogenus M5 provided in Example 2 of the present application; Figure 3Phylogenetic tree analysis diagram of Monascus purpurogenus M5 provided in Example 2 of the present application. Specific embodiments The embodiments of the present invention will be described in detail below in conjunction with the examples, but those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. The specific conditions not specified in the examples are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0019] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention. Example

[0020] Example 1 This example provides the screening process of purple Monascus strains (1) Preparation of culture medium The screening medium is a PDA solid medium, and the specific preparation method is: weigh 200.0g of potatoes, peel and cut into pieces, add distilled water, boil for 20-30min, filter with double-layer gauze, add 20.0g of glucose and 15.0-20.0g of agar, and dilute to 1000mL with distilled water. Sterilize at 121℃ for 15min.

[0021] (2) Enrichment and purification Under sterile conditions, 5 g of Fujian farmer's red yeast rice sample and sterilized glass beads were added to a conical flask containing 45 mL of 0.85% NaCl, and the mixture was shaken on a constant temperature oscillator for 10 minutes. The mixture was then filtered through a glass funnel filled with sterile cotton to obtain a 10-1 dilution. After 10-fold gradient dilution, an appropriate amount of the dilutions of different concentrations were spread on a PDA solid culture medium, and cultured in a 30°C incubator for 3 to 5 days. Single colonies with typical morphological characteristics of Monascus were picked, and further streaked for 3 to 5 times to obtain 15 purified strains (numbered M1 to M8), which were finally inoculated into slant test tubes and stored in a 4°C refrigerator.

[0022] (3) Screening The purified strain was spotted on a PDA plate and cultured at 30°C for 6 days. The growth status of each strain was observed and screened, and finally the strain M5 of the present application was obtained.

[0023] Example 2 This example provides the identification process of the strain (1) Bacterial morphological characteristics After the strain M5 was cultured on a PDA plate at 30°C for 6 days, Figure 1As shown, the colonies are relatively flat, localized in growth, velvety, flocculent in the middle, dry and opaque on the surface, with wrinkles, initially milky white, then pink, and then orange-red.

[0024] (2) Microscopic observation characteristics The strain M5 was placed under a microscope for observation. Figure 2 As shown, microscopic observation showed that the hyphae had septa, many branches, spherical thecothecia, ellipsoidal ascospores, and purple crystals on the surface and inside of the hyphae.

[0025] (3) Gene sequence analysis The genomic DNA of the strain was extracted using the 2×T5 Direct PCR Kit (Plant). The specific steps are as follows: add 50 μL Lysis Buffer A to a 2 mL centrifuge tube, scrape a small amount of non-spore-producing mycelium on the PDA medium with an inoculation loop and place it in a centrifuge tube, incubate at 95°C for 30 min, centrifuge at 1000 g for 1 min, and take the supernatant as the template for the reaction system. The ITS fragment of the DNA was PCR amplified using the universal primers ITS1: 5'-TCCGTAGGTGAACCTGCGG-3' and ITS4: 5'-TCCTCCGCTTATTGATATGC-3'. The PCR amplification reaction system: 2×T5 Direct PCR Mix (Plant) 12.5 μL, template DNA 1 μL, ITS1 and ITS4 1 μL each, and sterile ultrapure water 9.5 μL. PCR amplification reaction conditions: 98℃3min; 98℃10s, 60℃10s, 72℃10s, 30× cycles; 72℃5min; 4℃ storage. The PCR amplification products were sequenced, and the spliced ​​sequencing results were compared with the NCBI database by BLAST. Phylogenetic analysis was performed using MEGA7.0 software, and the molecular evolutionary tree was constructed using the NJ (neighbor-joining method). The evolutionary tree branches were self-checked 1000 times by the bootstrap method (Bootstrap values).

[0026] The ITS rDNA sequence of strain M5 is shown in SEQ ID NO.1: CTTCCGTAGGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCCCTTCGTGGGAC CCAACCTCCCACCCGTGATTATTGTACCTCCTGTTGCTTCGGCGCGGCCCCCTGGGGCCC GCCGGAGACATCTTCTCGAACGCTGCTTTGAAAAGGATTGCTGTCTGAGTAAACATAC CAAATCGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCA GCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGC ACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTGCCCCTCA AGCGCGGCTTGTGTGTTGGGCCGCCGTCCCCTGCGCCTCCGGGCAACGGGGACGGGCC CGAAAGGCAGTGGCGGCGCCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCT CAGTAGGTCGGGCCGGGGCCTTTGCCCTCTCCAACCTTTTTTTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAGGCGGAGGAA.

[0027] The ITS rDNA sequence of strain M5 was 583 bp in length. The BLAST analysis and phylogenetic tree ( Figure 3 ) analysis showed that it was clustered in the same branch with Monascus purpureus (PQ113607.1), Monascus anka (AF458473.1) and Monascuspilosus (AY498582.1), and the homology was 100%, 99% and 99% respectively. Combined with the colony morphology and microscopic morphology, strain M5 was determined to be Monascus purpureus M5.

[0028] Example 3 Determination of extracellular pigments and extracellular lovastatin produced by Monascus purpurogenus (1) Culture medium preparation A culture medium simulating soybean paste was used, and its formula was as follows: 100 g broad beans, 20 g flour, 1 L distilled water was added and boiled for 10 min, and the mixture was aseptically filtered into a conical flask.

[0029] (2) Fermentation of purple Monascus The screened purple Monascus (M1-M8) was inoculated into an agar slant medium and cultured at 28°C for 4 days. The mature slant spores were made into a suspension, inoculated into a flat bottle solid culture medium, and cultured at 28°C for 10 days to obtain a spore liquid of purple Monascus.

[0030] The spore liquid of purple Monascus was 10 6 The spores were inoculated into the simulated fermented mash medium and fermented at 30°C for 5 days to obtain the fermentation broth (among which, the spores of Monascus purpurogenus M5 were 1×10 12 / mL).

[0031] The color value of the extracellular pigment and the content of extracellular lovastatin in the fermentation broth were determined. The content of extracellular lovastatin was determined by HPLC; the method for determining the color value of the extracellular pigment was as follows: The method of GB1886.19-2015 "Food Additive Red Yeast Rice" is adopted: the fermentation liquid of purple Monascus is taken, and the bacteria and impurities are removed by centrifugation or filtration to obtain an extracellular pigment solution. The extracellular pigment solution is diluted with ethanol to an appropriate concentration, and the color value of the red component is measured at a wavelength of 505nm. According to the characteristics that the yellow component and the orange component in the Monascus pigment have absorption peaks at 410nm and 465nm respectively, the absorbance values ​​are also measured at 410nm and 465nm respectively. The color value = (OD 410 +OD 465 +OD 505 )×dilution factor / sample mass (g).

[0032] The results are shown in Table 1: Table 1. Results of determination of extracellular pigments and extracellular lovastatin As can be seen from Table 1, the color value of the extracellular pigment and the concentration of lovastatin of M3 and M5 in the strains screened in the present application are higher than those of other strains.

[0033] Example 4 This embodiment provides a fermented bean curd liquid containing purple Monascus M5, and the preparation method thereof comprises: (1) Prepare broad bean paste medium according to the recipe: 100 g broad beans, 15 g flour, add 1 L distilled water and boil for 10 min.

[0034] (2) The spore liquid of Monascus purpurogenum M5 was obtained by the method of Example 3.

[0035] (3) The spore liquid of Monascus purpurogenus M5 was diluted to 10 5 The spores were inoculated into broad bean paste medium and fermented at 25 °C for 7 days to obtain fermented bean paste liquid, in which the number of spores was 1×10 11Pieces / mL.

[0036] Example 5 This embodiment provides a fermented bean curd liquid containing purple Monascus M5, and the preparation method thereof comprises: (1) Prepare broad bean paste medium according to the recipe: 100 g broad beans, 30 g flour, add 1 L distilled water and boil for 10 min.

[0037] (2) The spore liquid of Monascus purpurogenum M5 was obtained by the method of Example 3.

[0038] (3) The spore liquid of Monascus purpurogenus M5 was diluted to 10 7 The spores were inoculated into broad bean paste medium and fermented at 35 °C for 4 days to obtain the fermented bean paste liquid, in which the spore count was 1×10 10 Pieces / mL.

[0039] Example 6 This embodiment provides a Pixian bean paste, which is fermented by using purple Monascus M5, and the specific steps are as follows: S1: Broad bean pretreatment Screen out peeled dry broad beans without diseases and insect pests, blanch them in 90-98° C. hot water for 2-6 minutes at a mass ratio of peeled dry broad beans to water of 1:6, and then cool the blanched broad beans to 35° C. with cold water to obtain pretreated broad bean petals; S2: Koji making The pre-treated broad bean paste is mixed with wheat flour and koji extract to obtain a mixture I, and the temperature of the mixture I is controlled at 37°C. The relative humidity was 84% ​​and the koji was made for 48 hours to obtain bean curd; The amount of the pre-treated broad bean, wheat flour and koji extract is such that the mass ratio of dry broad beans used to prepare the pre-treated broad bean: wheat flour: koji extract is 1000:100:0.1; S3: Preparation of Monascus purpurogenum M5 bacterial suspension Edible salt and water were mixed evenly to obtain a mixed solution, and then the purple Monascus M5 fermentation solution (the number of spores was 1×10 12 / mL), and then let it stand for 15min to obtain a purple Monascus M5 bacterial suspension.

[0040] The amount of edible salt, glucose and water in the above-mentioned mixed solution is based on a mass ratio of edible salt to water of 6:100; S4: Making sweet potatoes Put the bean curd into a fermentation container, add edible salt, water, and purple Monascus M5 bacterial suspension (Example 3) in sequence, stir evenly and ferment at 32-40° C. for 180 days to obtain sweet bean curd; The dosage of the above-mentioned bean curd, edible salt, water, and purple Monascus M5 bacterial suspension is 1000:510:1200:100 according to the dry broad beans corresponding to the pretreated broad beans used to prepare the bean curd: edible salt: water: purple Monascus M5 bacterial suspension; S5: Pepper pretreatment The removed chili peppers are cleaned with water and then crushed (with salt or brine) to obtain chili sauce; The maximum diameter of the chili pieces in the obtained chili sauce is 40 mm, and the salt content of the crushed chili sauce is 15-18%; S6: Pixian Doubanjiang semi-finished product fermentation The purple Monascus M5 bacterial suspension obtained in S3, the sweet bean sprouts obtained in S4, and the pepper embryos obtained in S5 are mixed evenly, and then fermented at room temperature for 180 days to obtain a semi-finished Pixian bean sprout; The mixing ratio of sweet petals, pepper embryos and purple Monascus M5 bacterial suspension is calculated according to the mass ratio, and the sweet petals: pepper embryos: purple Monascus M5 bacterial suspension is 30:70:6.

[0041] S7: Pixian Doubanjiang finished product Edible salt and water are added to the semi-finished Pixian bean paste obtained in S6, and the mixture is stirred and mixed to obtain a finished Pixian bean paste. The amount of edible salt and water added is calculated based on the total acid ≤2.0%, amino acid nitrogen ≥0.18%, edible salt (calculated as sodium chloride) 15-22%, and water ≤60% in the finished Pixian bean paste.

[0042] Example 7 The difference between this embodiment and embodiment 6 is that: S4: Making sweet petals: The dosage of the above-mentioned bean curd, edible salt, water, and purple Monascus M5 bacterial suspension is 1000:510:1200:70 according to the dry broad beans corresponding to the pretreated broad beans used to prepare the bean curd: edible salt: water: purple Monascus M5 bacterial suspension.

[0043] Example 8 The difference between this embodiment and embodiment 6 is that: S4: Making sweet petals: The dosage of the above-mentioned bean curd, edible salt, water, and purple Monascus M5 bacterial suspension is 1000:510:1200:140 according to the dry broad beans corresponding to the pretreated broad beans used to prepare the bean curd: edible salt: water: purple Monascus M5 bacterial suspension.

[0044] Example 9 The difference between this embodiment and embodiment 6 is that: S6: Pixian Doubanjiang semi-finished product fermentation The mixing ratio of sweet petals, pepper embryos and purple Monascus M5 bacterial suspension is calculated according to the mass ratio, and the sweet petals: pepper embryos: purple Monascus M5 bacterial suspension is 30:70:5.

[0045] Example 10 The difference between this embodiment and embodiment 6 is that: S6: Pixian Doubanjiang semi-finished product fermentation The mixing ratio of sweet petals, pepper embryos and purple Monascus M5 bacterial suspension is calculated according to the mass ratio, and the sweet petals: pepper embryos: purple Monascus M5 bacterial suspension is 30:70:7.

[0046] Comparative Example 1 During the fermentation of Pixian bean paste, no purple Monascus M5 bacterial suspension was added, and the rest was the same as in Example 6.

[0047] Comparative Example 2 During the fermentation of Pixian bean paste, the purple Monascus M5 bacterial suspension is added only in the S4 sweet bean paste making sub-step, and the purple Monascus M5 bacterial suspension is not added in the S6 Pixian bean paste semi-finished product fermentation step. The rest is the same as Example 6.

[0048] Comparative Example 3 During the fermentation of Pixian bean paste, the purple Monascus M5 bacterial suspension is not added in the S4 sweet bean paste making sub-step, and the purple Monascus M5 bacterial suspension is only added in the S6 Pixian bean paste semi-finished product fermentation step. The rest is the same as Example 6.

[0049] The Pixian bean paste obtained in Example 6 of the present application and Comparative Examples 1-3 were evaluated respectively, and the evaluation results are shown in Table 1: Table 1. Evaluation results of Pixian bean paste As shown in Table 1, compared with Comparative Example 1, the Pixian Doubanjiang provided in Example 6 of the present application has a more ruddy color, better aroma and taste, and a significantly improved content of amino acid nitrogen, because the purple Monascus M5 suspension is added in both the sweet petal preparation step and the semi-finished product fermentation step. In particular, the aroma and taste indicators meet the special index requirements for Pixian Doubanjiang in GB / T20560-2006 "Geographical Indication Product Pixian Doubanjiang". However, in Comparative Examples 2 and 3, since the purple Monascus M5 suspension is added only in the sweet petal preparation step or the semi-finished product fermentation step, the color, flavor and amino acid nitrogen content are all weaker than those in Example 6.

[0050] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application.

Claims

1. A Pixian bean paste, characterized in that: The Pixian bean paste is obtained by fermenting broad beans with Monascus purpureus M5. The Monascus purpureus M5 is deposited by China Center for Type Culture Collection with the deposit number of CCTCC NO: M20241379, the deposit date of June 26, 2024, and the deposit address of Wuhan University, Wuhan, China.

2. A method for preparing Pixian bean paste using Monascus purpureus M5, characterized in that: It includes: (1) Inoculate the spores of the purple Monascus M5 as claimed in claim 1 into a broad bean paste fermented mash culture medium, and ferment at 25-35° C. for 4-7 days to obtain a purple Monascus M5 fermentation liquid, wherein the number of spores in the purple Monascus M5 fermentation liquid is 1×10 10 -1×10 12 Pieces / mL; (2) After mixing edible salt and water, add the purple Monascus M5 fermentation liquid to obtain a purple Monascus M5 bacterial suspension; (3) Mixing the purple Monascus M5 suspension, edible salt, water and bean curd, stirring evenly, and fermenting at 32-40° C. for 150-200 days to obtain sweet bean curd; (4) Mixing the sweet peppers with pepper embryos, adding the purple Monascus M5 bacterial suspension and mixing evenly, fermenting at room temperature for 150-200 days, and then adding edible salt and water to obtain Pixian bean paste.

3. The method for preparing Pixian bean paste using Monascus purpureus M5 according to claim 2, characterized in that: In the step (3), the amount of bean curd, edible salt, water, and purple Monascus M5 suspension is 1000:510:1200:70-140 according to the weight ratio of dry broad beans corresponding to the pretreated broad beans used to prepare the bean curd: edible salt: water: purple Monascus M5 suspension.

4. The method for preparing Pixian bean paste using Monascus purpureus M5 according to claim 2, characterized in that: In the step (4), the weight ratio of the sweet pepper peel: pepper embryo: purple Monascus M5 bacterial suspension is 30:70:5-7.

5. A purple Monascus M5 (Monascus purpureus M5), characterized in that: It is preserved by the China Center for Type Culture Collection, the preservation number is CCTCC NO: M20241379, the preservation date is June 26, 2024, and the preservation address is: Wuhan University, Wuhan, China.

6. The Monascus purpureus M5 according to claim 5, characterized in that The ITS sequence of the purple Monascus M5 is shown in SEQ ID NO.

1.

7. A red yeast rice fermentation agent, characterized in that: The red yeast rice fermentation agent contains the purple red yeast rice M5 (Monascus purpureus M5) as claimed in claim 5 or 6.

8. Use of the Monascus purpureus M5 according to claim 5 in preparing fermented food.

9. The use according to claim 8, characterized in that: The fermented food comprises any one of bean paste, soy sauce, vinegar, wine and bread.

10. A fermented food, characterized in that: The fermented food is obtained by fermenting the Monascus purpureus M5 as claimed in claim 5 or 6.

Images