Saline-alkali tolerant trichoderma koningiopsis and application thereof

Abstract

The invention discloses a strain of salt and alkali tolerant trichoderma koningii GZUAS181022 and application of the strain of salt and alkali tolerant trichoderma koningii GZUAS181022, and relates to the technical field of microorganisms. The saline-alkaline tolerant trichoderma koningii is named as trichoderma koningii GZUAS181022, and is preserved in the Guangdong Microbial Culture Collection Center on July 17, 2024, and the preservation number is GDMCC (China General Microbiological Culture Collection Center) NO: 64875. The salt-alkali tolerant trichoderma koningii GZUAS181022 can still grow vigorously in an alkaline environment with high sodium chloride concentration, and a spore suspension of the salt-alkali tolerant trichoderma koningii GZUAS181022 has a remarkable promoting effect on growth of corn in saline-alkali soil and has potential application value in alkaline soil and salinized soil. The salt-alkali tolerant trichoderma koningii GZUAS181022 has an obvious inhibition effect on botryosphaeria dothidea and aspergillus fumigatus, and has a good prevention and treatment effect on grape canker caused by the botryosphaeria dothidea, and the spore suspension of the salt-alkali tolerant trichoderma koningii GZUAS181022 has obvious effects in promoting plant seed germination and degrading agricultural straws. The salt and alkali tolerant trichoderma koningiopsis GZUAS181022 provided by the invention has a wide market application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 and an application thereof. Background Art

[0002] Trichoderma spp. is safe, healthy, green, environmentally friendly, grows rapidly, is widely distributed, and has good control effects on plant pathogens. It has been widely used in the field of biological control. Studies have shown that Trichoderma has a strong antagonistic effect on plant pathogenic fungi such as Botrytis spp., Fusarium spp., and Aspergillus spp. At the same time, Trichoderma can interact with crops, improve the nutrient absorption capacity of crops, produce plant hormones, and promote the germination and growth of crop seeds. Trichoderma has a rich enzyme system, such as cellulase, filter paper enzyme, amylase, lipase, etc., which plays an important role in the decomposition of organic matter.

[0003] In China, saline-alkali land accounts for about 10% of the country's land area, and the amount is increasing year by year, which seriously restricts the development of agriculture in my country. Traditional soil remediation technology is not only costly, but also easy to cause secondary pollution. Microbial soil remediation technology is considered to be a safe and feasible way, which has the advantages of improving soil physical and chemical properties, increasing soil nutrients, and promoting plant growth. The development of microbial resources adapted to saline-alkali areas has gradually become a hot topic of research.

[0004] Agricultural straw is an important renewable resource, rich in cellulose, hemicellulose, lignin, starch and other substances, and can be used in feed, fertilizer development, industrial manufacturing and other fields. Microbial degradation of straw is recognized as a new technology with great development potential.

[0005] Based on this, the present invention provides a salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 and applications thereof, aiming to solve the above problems. Summary of the invention

[0006] The invention aims to provide a salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 and application thereof.

[0007] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0008] The salt-alkali tolerant Trichoderma koningiopsis of the present invention is named Trichoderma koningiopsis GZUAS181022, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on July 17, 2024, with a deposit number of GDMCCNO: 64875.

[0009] The invention discloses an application of the salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 in inhibiting Botrytis cinerea and Aspergillus fumigatus.

[0010] The invention discloses an application of the spore suspension of the salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 in preventing and treating grape canker caused by Botrytis cinerea.

[0011] The invention discloses an application of the spore suspension of the salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 in promoting the germination of plant seeds.

[0012] Preferably, the spore suspension of the salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 of the present invention is used in promoting the germination of corn, rapeseed, rice, soybean and cucumber seeds.

[0013] The invention discloses an application of the salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 in degrading agricultural straw.

[0014] Preferably, the salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 of the present invention is used in degrading wheat straw and sorghum straw.

[0015] The invention discloses an application of the spore suspension of the salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 in promoting the growth of plants in alkaline soil and salinized soil.

[0016] Preferably, the spore suspension of the salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 of the present invention is used to promote the growth of corn in alkaline soil and salinized soil.

[0017] The preparation method of the spore suspension of the salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 of the present invention is as follows: inoculate the Trichoderma koningiopsis GZUAS181022 into a PDA culture medium, place the culture medium in a constant temperature incubator at 28°C for 5 days, wash the spores with sterile purified water, and dilute the spores to 10 6 CFU / mL is obtained.

[0018] Beneficial effects of the present invention:

[0019] 1. The present invention provides a salt-alkali tolerant Trichoderma koningiopsis GZUSA181022, which can still grow vigorously in a high-salt (sodium chloride concentration of 1.5%) and alkaline (pH of 12) environment. Experiments have confirmed that the spore suspension of Trichoderma koningiopsis GZUSA181022 provided by the present invention can promote the growth of corn in saline-alkali land, and has potential application value in alkaline soil and salinized soil.

[0020] 2. The salt-alkali tolerant Trichoderma koningii GZUSA181022 provided by the present invention has an inhibition rate of 87% on Botrytis cinerea and an inhibition rate of 93% on Aspergillus fumigatus. Experiments have confirmed that the spore suspension of Trichoderma koningii GZUSA181022 provided by the present invention has a good preventive and therapeutic effect on grape canker caused by Botrytis cinerea, and has great application value in the field of biocontrol.

[0021] 3. The spore suspension of the salt-alkali tolerant Trichoderma pseudokoningii GZUSA181022 provided by the present invention can significantly promote the germination of corn, rapeseed, rice, soybean and cucumber seeds, with the germination rates increased by 38.3%, 41.2%, 37.2%, 33.9% and 32.6%, respectively, and the fresh weight increased by 25%, 50%, 28.6%, 40% and 40%, respectively, and has great application value in the field of growth promotion.

[0022] 4. The spore suspension of the salt-alkali tolerant Trichoderma pseudokoningii GZUSA181022 provided by the present invention has 20-day degradation rates of 38.9% and 41.7% for wheat straw and sorghum straw, respectively. The cellulase activity and filter paper enzyme activity of the fermentation product are 1523.3 U / mL and 533.6 U / mL, respectively, which has great application value for the degradation and return of agricultural straw to the field. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Identification of strain GZUAS181022 (a is colony; b is spore; c is conidiophore; d is phylogenetic tree);

[0024] Figure 2The results of the plate confrontation test of Trichoderma pseudokoningii GZUAS181022 (a is Botrytis cinerea; b is the confrontation between Trichoderma pseudokoningii GZUAS181022 and Botrytis cinerea; c is Aspergillus fumigatus; d is the confrontation between Trichoderma pseudokoningii and Aspergillus fumigatus);

[0025] Figure 3 is the colony size under different pH conditions;

[0026] Figure 4 is the colony size under different sodium chloride concentration conditions;

[0027] Figure 5 The growth-promoting effect of Trichoderma koningii GZUAS181022 on different seeds (a is corn seeds; b is rapeseed seeds; c is rice seeds; d is cucumber seeds; e is soybean seeds);

[0028] Figure 6 is the cellulose degradation diagram;

[0029] Figure 7 The degradation effect of Trichoderma koningii GZUAS181022 on straw (a is before straw degradation; b is after straw degradation);

[0030] Figure 8 The control effect of Trichoderma koningii GZUAS181022 on grape leaves (a is test group 0; b is test group 1; c is test group 2; d is test group 3; e is test group 4);

[0031] Fig. 9 These are the results of a corn planting experiment in saline-alkali land (a is the experimental group; b is the control group). DETAILED DESCRIPTION

[0032] The technical solution of the present invention is described in detail below in conjunction with specific embodiments. The following embodiments are only used for explanation and illustration, and do not constitute a limitation on the technical solution of the present invention.

[0033] Example 1

[0034] The salt-alkali tolerant Trichoderma koningiopsis, named Trichoderma koningiopsis GZUAS181022, was deposited in the Guangdong Provincial Microbiological Culture Collection Center on July 17, 2024, with the deposit number GDMCCNO: 64875.

[0035] Example 2

[0036] Co-culture of Trichoderma pseudokoningii GZUAS181022 with Botrytis cinerea or Aspergillus fumigatus in PDA agar medium at 28°C inhibited the growth of Botrytis cinerea or Aspergillus fumigatus.

[0037] Example 3

[0038] Trichoderma pseudokoningii GZUAS181022 was inoculated into PDA medium and cultured in a constant temperature incubator at 28°C for 5 days. The spores were washed with sterile purified water and diluted to 10 6 CFU / mL, put into a spray bottle for later use.

[0039] Select plump, uniform-sized, healthy, pest-free corn, rapeseed, rice, soybean, and cucumber seeds, soak them in 75% ethanol solution for 10 seconds, rinse them with sterile purified water 4 to 5 times, and absorb them dry.

[0040] Spread 2 layers of sterile gauze in the culture dish, take seeds and place them on the gauze respectively, spray the spore suspension until the gauze is moistened, place in a constant temperature incubator at 25℃ away from light, and spray once every 2 days.

[0041] Example 4

[0042] Trichoderma pseudokoningii GZUAS181022 was inoculated into PDA medium and cultured in a constant temperature incubator at 28°C for 5 days. The spores were washed with sterile purified water and diluted to 10 6 CFU / mL, and a spore suspension of Trichoderma koningii GZUAS181022 was prepared.

[0043] The spore suspension was sprayed on wheat straw and sorghum straw, and solid fermented for 20 days at 28°C in a constant temperature incubator to degrade the wheat straw and sorghum straw.

[0044] Example 5

[0045] Trichoderma pseudokoningii GZUAS181022 was inoculated into PDA medium and cultured in a constant temperature incubator at 28°C for 5 days. The spores were washed with sterile purified water and diluted to 10 6 CFU / mL.

[0046] The spore suspension prepared above is inoculated on grape leaves to prevent and treat grape canker caused by Botrytis cinerea.

[0047] Example 6

[0048] Trichoderma pseudokoningii GZUAS181022 was inoculated into PDA medium and cultured in a constant temperature incubator at 28°C for 5 days. The spores were washed with sterile purified water and diluted to 10 6 CFU / mL is reserved.

[0049] Select plump, uniform-sized, healthy, and pest-free corn seeds, soak them in 75% ethanol solution for 10 seconds, rinse them with sterile purified water 4 to 5 times, and dry them. Spread two layers of sterile gauze in a culture dish, place the seeds on the gauze, spray them with clean water, and culture them at 25°C for germination. After the corn seeds germinate, select the seedlings with good and uniform growth for later use.

[0050] The planting plan is to dip the roots in spore liquid, and foliar fertilizer is sprayed every 7 days, with water dripping on the leaves as the standard, to promote the growth of corn in saline-alkali land.

[0051] In order to further verify the reliability of the present invention and screen out the best solution, the inventor conducted a series of experiments, as follows:

[0052] 1. Screening of Trichoderma pseudokoningii

[0053] 1.1 Instruments and reagents

[0054] The main instruments and reagents are shown in Table 1.

[0055] Table 1 Main instruments and reagents

[0056]

[0057] Enrichment medium (g / L): CMC-Na 10, peptone 20, magnesium sulfate 0.1, potassium nitrate 0.2, ferrous sulfate 0.02, dipotassium hydrogen phosphate 0.2, ammonium chloride 0.1, sodium chloride 10, streptomycin 0.2 (added after sterilization), adjust pH to 12±0.3.

[0058] Screening medium: Add 15 g of agar to the enrichment medium.

[0059] Improved PDA agar medium (g / L): potato powder 16, glucose 15, agar 15, adjust the pH to 12±0.3.

[0060] Congo red solution (g / L): 1.

[0061] Sodium chloride solution (g / L): 58.5.

[0062] 1.2 Isolation and screening of strains

[0063] Collect soil at a depth of 5 to 10 cm, weigh 10 g of soil and add it to 90 mL of sterile water, shake for 15 minutes, and let it stand for 30 minutes. Pipette the supernatant into 100 mL of enrichment medium and culture at 28°C and 180 rpm / min for 4 days. Pipette the culture medium and dilute it by 10 6 , 10 7 , 10 8times, spread on the screening medium, and culture at 28℃ for 5 days. Pick a single colony and purify it on the modified PDA agar medium, resuspend the purified strain in 25% glycerol solution, and store it at -80℃.

[0064] The purified strain was inoculated on the screening medium, cultured at 28°C for 2 days, stained with Congo red solution for 15 minutes, eluted with sodium chloride solution 2 to 3 times, and the colony radius and transparent zone radius were measured. A fungus with a fast growth rate and the largest colony radius and transparent zone radius was obtained and named GZUAS181022.

[0065] 1.3 Identification of strain GZUAS181022

[0066] 1.3.1 Colony morphology identification

[0067] The strain was inoculated on PDA agar medium and cultured at 28℃ for 5 days to observe the morphological characteristics of the colonies. The colonies were white and fluffy in the early stage and grew vigorously. In the later stage, green conidia were produced without obvious ring patterns. The conidia were oval or elliptical with smooth walls. The conidiophores directly produced phialides or produced secondary branches. The morphological identification of the colonies can be found in Figure 1 Middle Figures a, b, c.

[0068] 1.3.2 Molecular Biological Identification

[0069] The purified strain was sent to Guangzhou Aiji Biotechnology Co., Ltd. for sequencing, and the DNA sequence was obtained by ITS-rRNA sequencing:

[0070] CCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAAC

[0071] CATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCC

[0072] CCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCC

[0073] CCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCA

[0074] AAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGC

[0075] GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCT

[0076] TTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGC

[0077] GTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGGA

[0078] ACCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCA

[0079] GCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTC

[0080] CACGTCCGTAAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAG

[0081] GAATACCCGCTGAACTTAAGC

[0082] The sequence was uploaded to the NCBI database and compared by BLAST. The results are shown in Table 2. The similarity between strain GZUAS181022 and Trichoderma koningiopsis was 100%. The phylogenetic tree of strain GZUAS181022 was constructed using MEGA X software. Figure 1 Middle Figure d. It was found that strain GZUAS181022 was in the same branch as OR083438.1. Based on the morphological characteristics of strain GZUAS181022 and the results of ITS sequence comparison, strain GZUAS181022 was identified as Trichoderma koningiopsis.

[0083] Table 2 Similarity comparison results of strain GZUAS181022

[0084]

[0085] 2. Plate confrontation test of Trichoderma koningii GZUAS181022

[0086] Trichoderma pseudokoningii GZUAS181022, Botrytis cinerea and Aspergillus fumigatus were activated by streaking on PDA agar medium. Holes were punched on the PDA agar medium with a 4 mm puncher, and the bacterial cakes were picked out from the holes. The culture was cultured in a constant temperature incubator at 28°C for 3 days. The results of the confrontation test were observed, and the inhibition rate was calculated according to the following formula.

[0087]

[0088] The results are as follows Figure 2 As shown, the results of the plate confrontation test showed that the inhibition rate of Trichoderma pseudokoningii GZUAS181022 against Botrytis cinerea was 87%, and the inhibition rate against Aspergillus fumigatus was 93%.

[0089] 3. Alkali resistance test of Trichoderma pseudokoningii GZUAS181022

[0090] PDA agar and liquid culture medium with pH values ​​of 4, 6, 8, 10, 12, and 14 were prepared respectively. The activated Trichoderma koningii GZUAS181022 was inoculated into PDA culture medium with different pH values ​​and cultured in a constant temperature incubator at 28°C for 3 days. The colony radius and IAA content were measured.

[0091] The IAA content determination method is as follows:

[0092] (1) Prepare Salkowski reagent: 15 mL of 0.5 mol / L FeCl 3 , 300mL of concentrated sulfuric acid, and 500mL of distilled water. Mix well before use and store away from light.

[0093] (2) Prepare IAA standard solution: Weigh 10 mg of IAA, dissolve it in a small amount of ethanol, and then dilute to 100 mL with distilled water (concentration: 100 μg / mL).

[0094] (3) Take 8 test tubes and add 2 mL of IAA solution with a concentration gradient of 0, 5.0, 10.0, 15.0, 20.0, and 25.0 μg / mL in sequence. Add 8 mL of Salkowski reagent to each tube and mix well. React in the dark for 30 min and measure the absorbance on a spectrophotometer with the wavelength set at 530 nm.

[0095] (4) Draw an IAA standard curve with IAA concentration as the horizontal axis and absorbance value as the vertical axis.

[0096] (5) Using purified water as the control, take 1 mL of purified water and fermentation broth with different pH values, add 9 mL of Salkowski reagent and mix evenly. React in the dark for 30 min. Repeat 3 times for each group.

[0097] (6) Measure the absorbance value on a spectrophotometer with the wavelength set at 530 nm and the OD 530 .

[0098] (7) Calculate the IAA content at pH values ​​of 4, 6, 8, 10, 12, and 14 according to the standard curve.

[0099] The results showed that the colony radius and IAA content were the largest when the initial pH value was 12, with a radius of 42.9 mm and an IAA content of 31.4 μg / mL. The colony sizes and IAA contents under different pH conditions were Figure 3 , Table 3.

[0100] Table 3 Results of colony size and IAA content determination under different pH conditions

[0101]

[0102] 4. Test on salt tolerance of Trichoderma pseudokoningii GZUAS181022

[0103] PDA agar and liquid culture medium with sodium chloride concentrations of 0.5%, 1.0%, 1.5%, 2.0% and 2.5% were prepared respectively, and the activated Trichoderma koningii GZUAS181022 was inoculated into PDA culture medium with different sodium chloride concentrations, and cultured in a constant temperature incubator at 28°C for 3 days, and the colony radius and IAA content were measured.

[0104] The results showed that Trichoderma koningii GZUAS181022 could still grow vigorously at a sodium chloride concentration of 1.5%, with a colony radius of 31.6 mm and an IAA content of 25.4 μg / mL. The colony size and IAA content under different sodium chloride concentrations were Figure 4 , Table 4.

[0105] Table 4 Results of colony size and IAA content determination under different sodium chloride concentrations

[0106]

[0107] 5. Trichoderma koningii GZUAS181022 promotes seed germination

[0108] After culturing Trichoderma pseudokoningii GZUAS181022 in a constant temperature incubator at 28°C for 5 days, the spores were washed with sterile purified water and diluted to 10 6CFU / mL, put into a spray bottle for later use. Select plump, uniform-sized, healthy, pest-free corn, rapeseed, rice, soybean, and cucumber seeds, soak them in 75% ethanol solution for 10 seconds, rinse with sterile purified water 4 to 5 times, and dry. Spread 2 layers of sterile gauze in a culture dish, take the seeds and place them on the gauze, 30 seeds in each group, and repeat 3 times for each group. Set up a control group and an experimental group, spray the control group with sterile purified water, and spray the experimental group with spore liquid until the gauze is moistened, and spray once every 2 days. Culture in a constant temperature incubator at 25°C away from light, and observe the growth of seeds every day. After 2 days of culture, the germination rate and fresh weight of seeds in each group were counted.

[0109] The growth-promoting effect of Trichoderma pseudokoningii GZUAS181022 on different seeds is shown in Figure 5 ,Table 5. The results show that the germination rates of corn, rapeseed, rice, soybean and cucumber seeds increased by 38.3%, 41.2%, 37.2%, 33.9% and 32.6% respectively, and the fresh weight increased by 25%, 50%, 28.6%, 40% and 40% respectively.

[0110] Table 5 Growth-promoting effect of strain GZUAS181022 on different seeds

[0111]

[0112] 6. Trichoderma koningii GZUAS181022 straw degradation test

[0113] After culturing Trichoderma pseudokoningii GZUAS181022 in a constant temperature incubator at 28°C for 5 days, the spores were washed with sterile purified water and diluted to 10 6 CFU / mL. Wheat straw and sorghum straw were dried and cut into 5 cm small segments. The spore solution was sprayed on the straws and solid fermented in a constant temperature incubator at 28°C for 20 days. The mycelium on the surface of the straw was washed off, the straw was dried and weighed, and the relative weight loss was calculated.

[0114] The results are shown in Table 6. After 20 days, the straw surface was covered with hyphae and turned black and soft. The degradation rates of wheat straw and sorghum straw were 38.9% and 41.7% respectively. Figure 6 As shown in Figure 2, the degradation effect of Trichoderma pseudokoningii GZUAS181022 on straw is as follows Figure 7 shown.

[0115] Table 6 Results of the straw degradation test with Trichoderma koningii GZUAS181022

[0116]

[0117] 7. Determination of enzyme activity of Trichoderma pseudokoningii GZUAS181022

[0118] Definition of enzyme activity: The amount of enzyme required to catalyze the production of 1 μg of glucose per minute is defined as one unit of enzyme activity.

[0119] Trichoderma pseudokoningii GZUAS181022 was inoculated into PDA liquid culture medium and cultured in a shaking incubator at 28°C and 180 r / min for 3 days. The culture solution was centrifuged at 10,000 r / min and 4°C for 10 minutes, and the supernatant was the crude enzyme solution. The DNS method was used to determine the cellulase and filter paper enzyme activities.

[0120] (1) Establishment of glucose standard curve: Take 8 test tubes, number them 1, 2, 3, 4, 5, 6, 7, 8, and add 0, 0.5 mL, 1.0 mL, 1.5 mL, 2.0 mL, 2.5 mL, 3.0 mL, 3.5 mL of 0.1% glucose standard solution, respectively. Fill each test tube to 7 mL with distilled water, add 2 mL of DNS color developer, shake well, and boil in water for 5 min. Use the test tube numbered 1 as the control and measure the absorbance at a wavelength of 540 nm.

[0121] (2) Cellulase activity assay: Take two test tubes, number them 1 and 2, add 4 mL of 1% sodium carboxymethyl cellulose solution to each test tube, and preheat them in a 50°C water bath for 2 min. Add 1 mL of phosphate buffer to test tube 1 and 1 mL of crude enzyme solution to test tube 2, shake well and start timing immediately, and place in a 50°C water bath for 5 min. After 5 min in the water bath, immediately add 1 mL of 2 mol / L NaOH solution and 2 mL of DNS colorimetric reagent to all test tubes, shake well and place in a boiling water bath for 5 min. Use test tube 1 as the blank, measure the absorbance at a wavelength of 540 nm, and calculate the enzyme activity based on the standard curve.

[0122] (3) Filter paper enzyme activity assay: Take two test tubes, number them 1 and 2, add 2 mL of phosphate buffer (pH 4.8) to test tube 1, add 1 mL of crude enzyme solution and 1 mL of phosphate buffer (pH 4.8) to test tube 2, respectively, preheat the water bath to 50°C, add a 40 mg filter paper, and keep it at 50°C for 1 h. Add 3 mL of DNS solution, boil in a boiling water bath for 5 min, cool to room temperature, use test tube 1 as a blank, measure the absorbance at a wavelength of 540 nm, and calculate the enzyme activity based on the standard curve.

[0123] The results showed that the cellulase activity and filter paper enzyme activity were 1523.3U / mL and 533.6U / mL respectively.

[0124] 8. Trichoderma pseudokoningii GZUAS181022 for the prevention and treatment of grape canker

[0125] (1) Trichoderma pseudokoningii GZUAS181022 and Botrytis cinerea were inoculated onto PDA agar medium, respectively, and cultured in a constant temperature incubator at 28°C for 5 days. The spores were washed off with sterile purified water and diluted to 10 6 CFU / mL is reserved.

[0126] (2) Select fresh grape leaves with branches and perform initial inoculation using a sterile syringe according to the inoculation scheme in Table 7. Inoculate each treatment group to the lower epidermis of the leaves. Select 10 leaves from each group, randomly select 3 sites from each leaf, and inject 20 μL at each site. Cover the leaves with a safety bag, and use sterile gauze dipped in sterile purified water to wrap one end of the branch to keep it moist.

[0127] (3) After an interval of 24 h, 20 μL of sterile purified water was injected into the same leaf position of test groups 0, 1, and 2 using a sterile syringe. 20 μL of Trichoderma pseudokoningii solution and Botrytis cinerea solution were injected into the same leaf position of test groups 3 and 4, respectively. The leaves were covered with an insulation bag, and sterile gauze dipped in sterile purified water was used to wrap one end of the branch to retain moisture.

[0128] (4) After 5 days, the disease index and control effect of each experimental group were statistically analyzed. Disease index = ∑ (number of diseased leaves at each level × disease grade) / (total number of leaves investigated × highest grade) × 100%. Control effect = (disease index of control group - disease index of treatment group) / disease index of control group × 100%. The disease grade standard of grape canker is shown in Table 8.

[0129] Table 7 Experimental settings for the control of grape canker by using Trichoderma koningii GZUAS181022

[0130]

[0131] Table 8 Grape canker disease classification standards

[0132]

[0133] Table 9 Results of the test on the control of grape canker by Trichoderma pseudokoningii GZUAS181022

[0134]

[0135] The results are shown in Table 9. It can be seen from the results that: Trichoderma pseudokoningii GZUAS181022 has no pathogenicity to grape leaves; the control effect of first inoculating Botrytis cinerea and then inoculating Trichoderma pseudokoningii GZUAS181022 is 32.8%; the control effect of first inoculating Trichoderma pseudokoningii and then inoculating Botrytis cinerea is 65.5%; the control effect of first inoculating Trichoderma pseudokoningii GZUAS181022 is better than that of later inoculating Trichoderma pseudokoningii GZUAS181022. It can be seen that the Trichoderma pseudokoningii GZUAS181022 provided in this study has a good control effect on grape canker caused by Botrytis cinerea. The control effect of Trichoderma pseudokoningii GZUAS181022 on grape leaves is shown in Table 9. Figure 8 In the figure, a~e correspond to experimental groups 0 to 4 respectively.

[0136] 9. Experiment on the growth-promoting effect of Trichoderma pseudokoningii GZUAS181022 in saline-alkali land

[0137] (1) Trichoderma pseudokoningii GZUAS181022 was inoculated on PDA agar medium and cultured in a constant temperature incubator at 28°C for 5 days. The spores were washed with sterile purified water and diluted to 10 6 CFU / mL is reserved.

[0138] (2) Select plump, uniform-sized, healthy, and pest-free corn seeds, soak them in 75% ethanol solution for 10 seconds, rinse them with sterile purified water 4 to 5 times, and dry them. Spread two layers of sterile gauze on a culture dish, place the seeds on the gauze, spray them with clean water, and culture them at 25°C for germination. After the corn seeds germinate, select the seedlings with good and uniform growth for later use.

[0139] (3) The experiment set up an experimental group and a control group, with 3 replicates in each group and 20 seedlings in each replicate. Moderate saline-alkali land was selected as the experimental site. The experimental group adopted the planting scheme of dipping the roots with spore liquid, and the control group adopted the planting scheme of dipping the roots with sterile purified water. Foliar fertilizer was sprayed on the experimental group and the control group once every 7 days, based on the water dripping on the leaves. The growth status of the plants was measured after 20 days.

[0140] The results of the corn plant growth test are shown in Table 10. The results show that all indicators of the test group are significantly higher than those of the control group, proving that the spore suspension of Trichoderma pseudokoningii GZUAS181022 has a significant promoting effect on the growth of corn in saline-alkali land. Fig. 9 .

[0141] Table 10 Results of corn plant growth status measurement (20 days)

[0142]

[0143] Although the present invention has been described in detail above by means of general description, specific implementation methods and experiments, it is obvious to those skilled in the art that some modifications or improvements can be made to the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A salt-alkali tolerant Trichoderma koningiopsis GZUAS181022, characterized in that: The salt-alkali tolerant Trichoderma koningiopsis is named Trichoderma koningiopsis GZUAS181022, and was deposited in Guangdong Provincial Microbiological Culture Collection Center on July 17, 2024, with the deposit number GDMCC NO: 64875.

2. Use of the salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 as claimed in claim 1 in inhibiting Botrytis cinerea and Aspergillus fumigatus.

3. Use of the spore suspension of salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 as claimed in claim 1 in preventing and treating grape canker caused by Botrytis cinerea.

4. Use of the spore suspension of salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 according to claim 1 in promoting plant seed germination.

5. The use according to claim 4, characterized in that: The plant seeds are corn, rapeseed, rice, soybean and cucumber seeds.

6. Use of the spore suspension of the salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 as claimed in claim 1 in degrading agricultural straw.

7. The use according to claim 6, characterized in that: The agricultural straws are wheat straws and sorghum straws.

8. Use of the spore suspension of the salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 as claimed in claim 1 in promoting the growth of plants in alkaline soil and salinized soil.

9. The use according to claim 8, characterized in that: The plant is corn.

10. The use according to any one of claims 4 to 9, characterized in that: The preparation method of the spore suspension of the salt-alkali tolerant Trichoderma koningiopsis GZUAS181022 is as follows: inoculate the Trichoderma koningiopsis GZUAS181022 into a PDA culture medium, place the culture medium in a constant temperature incubator at 28° C. for 5 days, wash the spores with sterile purified water, and dilute the spores to 10 6 CFU / mL is obtained.

Images