A kind of six-sister morel Guizhou DL06 and its application

Abstract

The present invention belongs to the field of edible fungi, and specifically discloses a strain of Morchella sextelata, Guizhou DL06, which is deposited in the China Center for Type Culture Collection, and its deposit number is CCTCC NO: M2022901. The present invention also discloses the use of the strain. The present invention provides a new strain of Morchella sextelata, which enriches the types of Morchella; secondly, the ascocarp of Guizhou DL06 of the present invention is dark brown, has a good mushroom shape, and has a high commercial value; in addition, the strain of the present invention also has the advantages of short cultivation period, high yield, strong mycelium resistance to heavy metal cadmium stress, low cost, high economic benefit, etc.

Description

Technical Field

[0001] The invention belongs to the field of edible fungi, and in particular relates to a Morchella liumei strain and also relates to the use of the strain. Background Art

[0002] Morchella belongs to the Morchaceae family. It is named because its cap resembles a tripe. It is a precious medicinal and edible mushroom. Morchella grows mostly on the humus layer of broad-leaved forests or mixed coniferous and broad-leaved forests. It is distributed all over the world and in 28 provinces, municipalities and autonomous regions in my country. Morchella is not only delicious and unique in taste, but also rich in nutritional value, high in protein, rich in essential amino acids and vitamins, trace elements and carbohydrates, and rich in fatty acid types. Morchella fruiting bodies can also be used as medicine. According to the "Chinese Materia Medica", Morchella is flat in nature, sweet and cold in taste, non-toxic; it is beneficial to the stomach and intestines, aids digestion, eliminates phlegm and regulates qi, nourishes the kidneys, nourishes the brain and refreshes the mind; Morchella contains polysaccharides that inhibit tumors, antibacterial and antiviral active ingredients, and has the effects of enhancing the body's immunity, anti-fatigue, anti-virus, and inhibiting tumors. It has always been used as a high-end supplement for human nutrition in Europe and the United States.

[0003] Morchella sextelata is a species of the genus Morchella and is one of the main cultivated morels in my country. At present, the main problems in the cultivation of Morchella sextelata are: (1) The cultivation cycle is long, which is generally about 120 days. Morchella is a seasonally cultivated edible fungus. Fresh mushrooms are often put on the market in large quantities from February to March each year. Usually, the price of fresh mushrooms put on the market before the Spring Festival is generally higher than that after the Spring Festival, which can bring higher commercial value. Mushrooms before the Spring Festival often require a shorter cultivation cycle. (2) In some areas in southwest my country, the content of heavy metal cadmium in the soil exceeds the standard, which has an adverse effect on the growth of morels and directly affects the yield of morels. Therefore, it is crucial to cultivate Morchella strains that are resistant to heavy metal cadmium stress, have a short cultivation cycle and are high in yield for the stable development of the morel industry.

[0004] my country's vast primeval forests from south to north are rich in wild edible mushroom resources, including wild Morchella. The development and domestication of wild Morchella can not only enrich people's dining tables and meet people's needs for a high level of life, but also use its medicinal and edible properties to develop higher value-added foods, beverages and health products, which can improve people's health and well-being while increasing mushroom farmers' income and export earnings. Summary of the invention

[0005] The invention aims to provide a Morchella liumei strain which has a short cultivation period, strong resistance to heavy metal cadmium stress and high yield.

[0006] Another object of the present invention is to provide the use of the above-mentioned Morchella lilii strain.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] The invention provides a Morchella sextelata strain Guizhou DL06, which is preserved in China Center for Type Culture Collection, located at Wuhan University, Wuhan, China, with a preservation number of CCTCCNO: M2022901 and a preservation date of June 15, 2022.

[0009] The present invention also provides application of the strain Qian DL06 in food or health products.

[0010] The present invention also provides a food or a health product, wherein the food or the health product contains the strain Guizhou DL06 or an extract of Guizhou DL06.

[0011] The present invention also provides application of the strain Guizhou DL06 in beverages.

[0012] The present invention also provides a beverage, wherein the beverage contains the strain Guizhou DL06 or an extract of Guizhou DL06.

[0013] The present invention also provides the use of the strain Guizhou DL06 in preparing medicines for improving human immunity.

[0014] The present invention also provides a genetically engineered Morchella liumei, wherein the starting strain of the genetically engineered Morchella liumei is the strain Guizhou DL06.

[0015] The advantages and beneficial technical effects of the present invention are as follows: (1) The ascocarps of the strain Guizhou DL06 of the present invention are dark brown, have a good mushroom shape, and have a high commercial value. (2) The cultivation cycle of the strain Guizhou DL06 of the present invention is short. Under traditional field cultivation, the cultivation cycle of Guizhou DL06 from sowing to mushroom harvesting is 80 to 85 days, which is significantly shorter than the 100 to 130-day cultivation cycle of other six-sister morel strains. (3) The fruiting body yield of the strain Guizhou DL06 of the present invention is high. The average agricultural cultivation yield of the strain Guizhou DL06 of the present invention is 495 kg / mu, which is significantly higher than the yield of 330 to 257 kg / mu of other existing six-sister morels. (4) The strain Guizhou DL06 of the present invention has a strong ability to resist heavy metal cadmium stress. Under different cadmium concentration stresses, its solid seed mycelium growth rate and liquid seed mycelium biomass are significantly higher than those of other six-sister morel strains, that is, Guizhou DL06 has a higher ability to resist heavy metal cadmium stress than other main cultivated strains. (5) The breeding process of the strain Guizhou DL06 of the present invention is multi-sporic self-pollination. After mating type detection, it has a double mating type. Compared with the strain separated by traditional tissues, its genetic material is more complete and its traits are more stable.

[0016] Biological preservation: The Morchella sextelata strain Guizhou DL06 of the present invention is a wild Morchella collected by the inventor in Bijie City, Guizhou Province, and is cultivated through adaptive cultivation and multi-spore self-pollination screening; the strain has been deposited in the China Center for Type Culture Collection on June 15, 2022; the preservation address is: Wuhan University, Wuhan, China; the preservation number is CCTCC NO: M2022901. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 .Photo of the fruiting body of the strain Guizhou DL06 of the present invention.

[0018] Figure 2 . Phylogenetic tree diagram of the strain Guizhou DL06 of the present invention.

[0019] Figure 3 ISSR fingerprint comparison and identification chart of the strain of the present invention and other different Morchella liliumei strains; wherein M is the DNA molecular weight; 1 is Qian DL06; 2 is Qian Morchella No. 1; 3 is Lefeng No. 2; 4 is Faxing No. 1. DETAILED DESCRIPTION

[0020] The present invention is further described below by way of examples, but the present invention is not limited thereto. Unless otherwise specified, the experimental methods used below are all conventional experimental methods, and the biochemical reagents used are all conventional biochemical reagents.

[0021] Example 1 Collection, separation and breeding process of the strain Guizhou DL06 of the present invention

[0022] (1) Strain collection and isolation process

[0023] In April 2017, the inventors found a wild Morchella fruiting body in Bijie, Guizhou Province. The mycelium (strain) was obtained by separating the fruiting body tissue. After morphological characteristics, ITS-PCR detection, phylogenetic tree construction and ISSR fingerprint map comparison, and then by gene fragment size and sequence, it was identified as Morchella sextelata. The strains after tissue separation were cultivated and fruited, and then the fruiting bodies with good flower shapes were separated and inoculated on PDA medium for cultivation. The fruiting test was carried out at the experimental base of Guizhou Academy of Agricultural Sciences. After fruiting, the ascospores were collected and then bred through multi-spore self-pollination.

[0024] (2) Strain selection process

[0025] Genomic DNA was extracted according to the instructions of the DNA extraction kit (Beijing Kangwei Century Company). Two sets of primer combinations P8-FF / P8-5R and P10-2F / P10-2R were used for PCR amplification to detect the mating type genes MAT1-1 and MAT1-2 of the monosporic strain. The primer sequences are as follows:

[0026] P8-5F: 5'-TTACCTTACTGGACTGGTTCGTGAG-3';

[0027] P8-5R: 5'-TGGAATGTCTGTGATTGAGGCTGTG-3'.

[0028] P10-2F: 5'-GGCCAGAACAGATGCTCGAAGAAGC-3';

[0029] P10-2R: 5'-GTGGCAACTCCCAAAGCATGATCAA-3'.

[0030] The PCR amplification reaction system is as follows: total volume 20 μL: 1 μL of 20-50 ng / μL DNA template, 2 μL of 10×Buffer (with Mg2+), 0.5 μL of 2.5 mM dNTP, 0.2 μL of 5 U / μL DNA polymerase, 0.5 μL of each 0.2 μM primer, and double distilled water to 20 μL. The PCR amplification conditions are as follows: pre-denaturation at 94°C for 5 min; 94°C for 30 s, 63°C for 30 s, 72°C for 3 min, 30 cycles; 72°C for extension for 10 min.

[0031] The products after PCR amplification were detected by electrophoresis. The mating type of the monospore strain with MAT1-1 but no MAT1-2 gene band was MAT1-1. On the contrary, the mating type of the monospore strain with MAT1-2 but no MAT1-1 gene band was MAT1-2. Double mating type strains were selected, and after several generations of cultivation, various comparative tests on strain growth rate, yield and resistance to heavy metal cadmium stress were conducted to screen out strains with stable genetic traits, fast mycelial growth rate, high yield, and the ability to maintain a high growth rate under heavy metal cadmium stress. They were named: Guizhou DL06.

[0032] Example 2 Classification and Identification of the Strain Guizhou DL06 of the Present Invention:

[0033] (1) Morphological identification of Guizhou DL06:

[0034] The strain Guizhou DL06 of the present invention: the ascocarp is dark brown, the fruiting body is 5 to 12 cm high, the ascocarp is 4 to 8 cm long, 2 to 4 cm thick, conical, blunt at the top, and connected to the stipe at the lower edge. The ascocarp has developed longitudinal ridges, shallow transverse ridges, and short villi all over the ridges. The transverse and longitudinal ridges cross to form pits. The ridges are relatively flat when young and tender, and become sharp when mature; the stipe is 2 to 6 cm long and 2.5 to 4 cm thick, the stipe is milky white, the base of the stipe is swollen, and the root has white villi. The ascus is columnar, and the mature ascus contains eight ascospores, which are arranged in a single longitudinal direction. According to the description and photos of the corresponding morphological characteristics of the six-sister morel on page 64 of "Morchella Biology and Cultivation Technology" (Liu Wei, Zhang Ya, etc., Jilin Science and Technology Press, 2017), the strain Guizhou DL06 of the present invention is consistent with the morphological characteristics of the six-sister morel, indicating that Guizhou DL06 belongs to the six-sister morel species (Morchella sextelata) in the genus Morchella.

[0035] (2) Molecular biological classification and identification of Guizhou DL06

[0036] The genomic DNA of strain Qian DL06 was extracted using a new plant genomic DNA extraction kit CW0531 (Beijing Kangwei Century Company), and PCR amplification was performed using universal primers ITS1 and ITS4. The sequences of the ITS1 and ITS4 primers are as follows:

[0037] ITS1: 5'-TCCGTAGGTGAACCTGCGG-3';

[0038] ITS4: 5'-TCCTCCGCTTATTGATATGC-3'.

[0039] The ITS-PCR reaction system is as follows: total volume 20 μL: 1 μL of 20-50 ng / μL DNA template, 10× Buffer (with Mg 2+ )2μL, 2.5mM dNTP 0.5μL, 5U / μl DNA polymerase 0.2μL, 0.2μM primers 0.5μL each, add double distilled water to 20μL. The reaction conditions of the ITS-PCR are: pre-denaturation at 94℃ for 5min; 94℃ for 1min, 60℃ for 1min, 72℃ for 75s, 30 cycles; extension at 72℃ for 10min. As a result, a DNA molecule fragment with a fragment length of 712bp was amplified and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The nucleotide sequence of the DNA molecule fragment is shown in SEQ ID NO: 1. After BLAST comparison, the ITS sequence of the strain Guizhou DL06 of the present invention has the highest similarity with the ITS sequence of Morchella sextelata, and the highest similarity can reach 99.86%. The phylogenetic tree diagram was constructed (see Figure 2). From the above results, it can be seen that the strain Guizhou DL06 of the present invention belongs to the species Morchella sextelata of the genus Morchella, and is different from any other Morchella sextelata strains, and is a new Morchella sextelata strain.

[0040] Example 3 Comparative identification test of ISSR patterns of the strain Guizhou DL06 of the present invention and other Morchella lilii strains

[0041] (I) Test strains: (1). Qian DL06; (2). Qian Morchella No. 1 (the six-sister Morchella strain approved by Guizhou Province in 2022); (3). Lefeng No. 2 (the six-sister Morchella strain approved by Guizhou Province in 2023); (4). Faxing No. 1 (the six-sister Morchella strain promoted for cultivation in Qiandongnan area of ​​Guizhou).

[0042] (II) Test methods:

[0043] The new plant genomic DNA extraction kit CW0531 (Beijing Kangwei Century Company) was used to extract the genomic DNA of Qian DL06, Qian Morchella No. 1, Lefeng No. 2, and Faxing No. 1, respectively. According to the agricultural industry standard of the People's Republic of China NY / T 1730-2009 "ISSR method for authenticity identification of edible fungi", 20 ISSR primers (see Table 1) were selected for PCR amplification. The primer sequences are as follows:

[0044] Table 1 ISSR random primer sequences

[0045] Primer name Primer sequence 5'-3' Primer name Primer sequence 5'-3' P1 TGCACACACACACAC P11 GAGAGAGAGAGAGAGAAC P2 GTGACACACACACAC P12 AGAGAGAGAGAGAGAGAGGC P3 GTGACGACTCTCTCTCTCT P13 TCTCTCTCTCTCTCTCCG P4 GGATGCAACACACACACAC P14 ACACACACACACACACG P5 CGTGTGTGTGTGTGT P15 GTGTGTGTGTGTGTGTTA P6 AGTGTGTGTGTGTGT P16 TGTGTGTGTGTGTGTGGA P7 CCAGTGGTGGTGGTG P17 ACACACACACACACAC P8 GGAGTGGTGGTGGTG P18 ACACACACACACACACACC P9 AGAGAGAGAGAGAGAGAGG P19 ACACACACACACACACACCT P10 GAGAGAGAGAG AGAGAC P20 ACACACACACACACACACCTG

[0046] The ISSR-PCR amplification reaction system is as follows: the total volume of the PCR reaction is 20 μL, containing 1×PCR reaction buffer, 0.2 mmol / L dNTP, 1U Taq DNA polymerase, 0.4 pmol / L primer, 20ng-50ng template DNA, and sterilized double distilled water to 20 μL. The ISSR-PCR amplification reaction conditions are as follows: pre-denaturation at 94°C for 4 min; then denaturation at 94°C for 30 s, annealing at 5°C below the Tm value of the primer for 45 s, extension at 72°C for 2 min, for a total of 35 cycles; extension at 72°C for 7 min, and storage at 4°C.

[0047] Results The ISSR pattern of the gene amplified with primer P13 (see Figure 3 ) It can be seen that there are obvious differences in the specific bands of the strain Guizhou DL06 of the present invention and the other three Morchella sextelata strains, indicating that Guizhou DL06 of the present invention is different from the other Morchella sextelata strains and is a new Morchella sextelata strain.

[0048] Example 4 Cultivation test of strain Guizhou DL06 of the present invention

[0049] Proceed as follows:

[0050] (1) Stock culture: Use a sterilized and cooled inoculation hook to inoculate a 5 mm diameter Guizhou DL06 strain (this strain has been deposited in the China Center for Type Culture Collection, Wuhan University, Wuhan, China, with a deposit number of CCTCC NO: M2022901) in the center of the stock culture medium plate, and culture it at 20°C and 60-75% relative humidity. After about 3 days, the mycelium will cover the plate, and continue to culture it under light-proof conditions for 7 days. At this time, a large number of sclerotia will form on the plate, and the Guizhou DL06 stock culture is obtained. The preparation method of the stock culture medium is as follows: Peel 200 g of potatoes and cut them into 1.5 cm cubes, put them into 800 mL RO water and boil them for 20 min, filter the extract through 3 layers of gauze, add 20 g of glucose, 18 g of agar, 1 g of potassium dihydrogen phosphate, and 0.5 g of magnesium sulfate, mix them well, and then dilute them to 1000 mL with RO water, sterilize them at 121°C for 20 min, and pour them into a 9 cm diameter plate for later use.

[0051] (2) Stock culture: Use the sterilized and cooled strains to scoop out 5 pieces of the mother strain of Guizhou DL06 obtained in step (1) with a diameter of 5 mm, inoculate them on the stock culture medium, and culture them at 18°C, relative air humidity of 60-75%, and in dark conditions. The bag is full in about 7 days, and the culture is continued for about 14 days until the mycelium is ripe and the mycelium is full of the bag. At this time, a large number of sclerotia are formed in the bag, and the Guizhou DL06 stock is obtained. The components and weight percentages of the stock culture medium are: 80% wheat, 13% humus, 5% rice husk, 1% gypsum, 1% calcium carbonate, and the water content of the culture medium is 60-65%. Mix the components, stir them evenly, put them into a polypropylene plastic bag (16cm×35cm×0.005cm), tie them, and sterilize them at 121°C for 2 hours for use.

[0052] (3) Cultivation of cultivars: Use a sterilized and cooled cultivar shovel to dig out the original Guizhou DL06 obtained in step (2) at a mass ratio of 1:30, inoculate it on a cultivar culture medium, and culture it at 18°C, relative air humidity of 60-75%, and in dark conditions for 20 days until the mycelium fills the bag and a large number of sclerotia are formed in the bag, thereby obtaining the Guizhou DL06 cultivar. The cultivar culture medium has the same composition and preparation method as the original culture medium in step (2).

[0053] (4) Furrowing, sowing and film covering: select arable land in a greenhouse with a pH of 6-6.5 and fine soil, remove weeds and plow the soil, and open furrows before sowing. The width of the furrow is 80-100 cm, and a 50 cm walkway is left between the furrows. The soil moisture content is 40-45%. Break the Guizhou DL06 cultivar obtained in step (3) into small particles and evenly spread them on the furrow surface. Sow 400 bags of cultivar per mu of arable land, and immediately cover the land with a layer of soil about 2-3 cm thick.

[0054] (5) Mycelium culture and placement of nutrient bags: After sowing, the maximum temperature in the greenhouse is controlled at 15-20°C, the relative humidity of the air is 60-70%, the soil moisture content is 45%, and the light intensity is 50-100 lux. After 5 days, the mycelium will cover the surface of the ridge to form a white "fungus frost". The nutrient bags are placed. Each nutrient bag is cut with two cuts parallel to the long side of the nutrient bag with a clean knife. The cut surface is placed close to the soil on the ridge surface. 2,000 nutrient bags are evenly placed per mu of land. After the nutrient bags are placed, they are covered with black polypropylene film with air holes. The nutrient bags are placed in the field for about 45-50 days, and the black polypropylene film is removed. The preparation method of the nutrient bag is as follows: 90% wheat, 9% rice husk, and 1% quicklime are mixed evenly according to the weight percentage ratio, and the water content is 60-65%, and stirred evenly. Use a polypropylene plastic bag (12cm×24cm×0.005cm), put the mixed nutrients into the bag, tie the bag with a polypropylene rope, sterilize at 121°C for 1 hour, and then cool to room temperature.

[0055] (6) Primordial differentiation: After removing the mulch in step (5), spray water to make the soil moisture content reach 50-55%. During the fruiting body growth stage, the maximum temperature in the greenhouse is controlled between 10-20°C and the minimum temperature is not less than 3°C. The relative humidity of the air is 75-85%, and the light intensity is 200-300 lux. The greenhouse is naturally ventilated to induce primordium formation. A large number of primordia will be formed about 5 days after spraying water. After the primordia are formed, continued cultivation will form 1-2 cm young mushrooms.

[0056] (7) Management and harvesting of mushrooms: The maximum temperature in the greenhouse is controlled at 10-20℃, the relative humidity is 70-80%, the soil moisture content is 40-45%, the light intensity is 500-1000lux, the greenhouse is naturally ventilated, and the high temperature is cooled by spraying, ventilation of the greenhouse side windows, and covering the roof with reflective film. It takes about 20-25 days from the occurrence of primordium to the maturity of the fruiting body. When the fruiting body grows to 5-8cm in height, the ridges and pits of the cap are clear, and the ascocarp part has basically unfolded, it is mature and should be harvested in time.

[0057] Results (see Figure 1) The ascocarps of the strain Guizhou DL06 of the present invention are dark brown, with a good mushroom shape, a compact fruiting body texture, a delicate taste, and a high commercial value. As can be seen from Table 2, the strain Guizhou DL06 of the present invention has a short cultivation cycle. The cycle from sowing to mushroom harvesting of the strain Guizhou DL06 of the present invention is 80 to 85 days, which is significantly shorter than the 100-130-day cultivation cycle of the existing main cultivated six-sister morels Guizhou Morel No. 1, Lefeng No. 2, and Faxing No. 1. In addition, Guizhou DL06 has a high yield. The average yield of its agricultural cultivation is 495kg / mu, which is significantly higher than the 330-357kg / mu of other existing main cultivated six-sister morels. It shows that the strain Guizhou DL06 of the present invention has a shorter cultivation cycle and higher yield than the existing main cultivated six-sister morels, and the corresponding labor cost is low, and the selling price is high before the Spring Festival, which brings significant economic benefits.

[0058] Table 2 Comparison of cultivation cycle and yield of the strains of the present invention and other Morchella lilii strains

[0059] Guizhou DL06 Guizhou Morel No. 1 Lefeng No.2 Fa Xing No. 1 Cultivation period (d) 80～85 100～110 110～130 100～110 Yield (kg / mu) 495 330.46 346.2 357.6

[0060] Example 5 Heavy metal cadmium stress resistance test of Guizhou DL06 solid seed of the present invention

[0061] (I) Test strains: Same as in Example 3.

[0062] (II) Test methods:

[0063] (1) Different concentrations of cadmium standard solution were added to PDA medium. The final cadmium concentrations of the medium were 2, 4, 6, 8, and 10 mg / L, respectively. PDA medium without cadmium solution was used as blank control (CK). A total of 26 treatments were performed, and the pH of all mediums was adjusted to 7. Three replicates were set at different concentrations, and the test Morchella edulis blocks were inoculated and cultured in an incubator at 23°C. The mycelial growth in medium with different concentrations of heavy metals was recorded.

[0064] (2) Determination of hyphae growth rate: After Morchella is inoculated on solid culture medium, when any treatment fills the plate, the culture is stopped and the growth time is recorded. The plate is photographed and the colony diameter of each treatment is measured by the cross-hatch method. The average daily growth rate of the hyphae is calculated by measuring the hyphae length on the plate.

[0065] The results (see Table 3) showed that the solid mycelial growth rate of the strain Qian DL06 of the present invention under different concentrations of cadmium stress was higher than that of other Morchella lilii strains, indicating that the strain Qian DL06 of the present invention has a higher tolerance to heavy metal cadmium stress than other main cultivated Morchella lilii strains.

[0066] Table 3 Comparative test results of mycelial growth rate of solid strain Guizhou DL06 of the present invention at different cadmium concentrations

[0067]

[0068] Example 6 Heavy metal cadmium stress tolerance test of the liquid seed of Guizhou DL06 of the present invention

[0069] (I) Test strains: Same as in Example 3.

[0070] (II) Test methods

[0071] (1) Different concentrations of cadmium standard solution were added to PDB liquid culture medium. The final cadmium concentrations in the culture medium were 2, 4, 6, 8, and 10 mg / L, respectively. The blank control (CK) was set without cadmium standard solution. The pH of all culture media was adjusted to 7. Each bottle of culture medium was inoculated with Morchella strains for culture. Six Morchella blocks with a diameter of 5 mm were inoculated and cultured in a shaking incubator at 23°C, 150 r / min, and protected from light for 5 days. Three replicates were set for each treatment. The mycelial growth in culture medium with different concentrations of heavy metal cadmium was recorded.

[0072] (2) Determination of mycelial biomass: Filter the mycelial pellets in the liquid culture medium with a 100-mesh filter, rinse the mycelial pellets repeatedly with pure water, and then dry the mycelial pellets in an oven at 45°C until constant weight, and weigh the mass of dry mycelium.

[0073] The results (see Table 4) showed that the liquid mycelial biomass of the strain Qian DL06 of the present invention was higher than that of other varieties under different concentrations of cadmium stress, indicating that the strain Qian DL06 of the present invention has a higher tolerance to heavy metal cadmium stress than other main cultivated varieties.

[0074] Table 4 Comparative test results of mycelial biomass of the present invention's strain Qian DL06 liquid inoculation at different cadmium concentrations

[0075]

Claims

1. A Morchella sextelata strain Guizhou DL06, which is deposited in China Center for Type Culture Collection with a deposit number of CCTCC NO: M2022901.

2. Use of the strain Guizhou DL06 according to claim 1 in food or health products.

3. A food or health product, characterized in that: The food or health product contains the strain Qian DL06 or the extract of Qian DL06 according to claim 1.

4. Use of the strain Guizhou DL06 according to claim 1 in beverages.

5. A beverage, characterized in that The beverage contains the strain Guizhou DL06 or an extract of Guizhou DL06 according to claim 1.

6. Use of the strain Guizhou DL06 according to claim 1 in the preparation of drugs for improving human immunity.

7. A genetically engineered Morchella liumei, characterized in that: The starting strain of the genetically engineered Morchella lilii is the strain Guizhou DL06 described in claim 1.

Images