A tremella fuciformis spore strain and a process for preparing tremella fuciformis polysaccharide by fermentation

Abstract

The present invention relates to a tremella spore strain and a process for fermenting tremella polysaccharide thereof, and belongs to the technical field of microbial fermentation and biochemistry. The present invention screens and mutates a tremella strain with a high tremella polysaccharide yield, the strain name is FTPS005.1, which has been deposited in the China Center for Type Culture Collection on October 21, 2024, with a deposit number of CCTCC NO: M20242283; and through fermentation optimization and three consecutive batches of repeated experiments, the final tremella polysaccharide yield reaches more than 24.5g / L, with the advantages of high yield and stability; the raw materials used in the fermentation medium provided by the present invention are all cheap, easy to obtain, green and pollution-free raw materials, and the raw material cost is low; the tremella polysaccharide powder prepared by the present invention is pure white, and the molecular weight is concentrated at 300,000-600,000 Dal, which has a more superior antioxidant property than the tremella polysaccharide prepared by the traditional extraction method.

Description

Technical Field

[0001] The invention relates to a tremella spore strain and a process for preparing tremella polysaccharide by fermenting the strain, and belongs to the technical field of microbial fermentation and biochemistry. Background Art

[0002] Tremella fuciformis Berk, also known as white fungus, is a traditional Chinese medicinal and edible fungus. It is known as the "king of fungi". It is mainly distributed in Fujian, Sichuan and other places. It is a unique edible fungus species in my country. Tremella is rich in carbohydrates, proteins, multiple amino acids and vitamins. Tremella polysaccharide is the main active substance of Tremella. It is currently directly extracted from the fruiting body. It has the effects of immune regulation, anti-oxidation, anti-tumor, blood sugar regulation, nourishing yin and moistening the lungs, etc. It is widely used in food, health food and cosmetics.

[0003] Although the current Tremella polysaccharide is directly extracted from the fruiting body, it has the defects of unstable quality, difficulty in amplification, waste of resources, and great influence of Tremella production area, while the fermentation method is not restricted by these factors, and only needs a simple culture medium and suitable fermentation conditions to stably produce Tremella polysaccharide. The current fermentation production of Tremella polysaccharide is to directly carry out liquid fermentation from Tremella mycelium. Although the output reported at present is all at 20g / L (document "Effect of Licorice on Tremella Fermentation Metabolism and Antioxidant Activity of Fermentation Liquid"), Tremella mycelium has a two-morph phenomenon, and the mycelium is extremely unstable under the condition of high humidity (document "Exploration of Germination Conditions of Binucleate Yeast-like Spores Produced by the Gelatinization of Tremella Fruiting Body and Mycelium"), which has a great influence on fermentation; at the same time, there are also shortcomings such as long growth cycle of strains, easy attachment of mycelium to the stirring shaft and tank wall, and difficulty in cleaning. Another way to produce Tremella polysaccharide by fermentation is to directly use Tremella fuciformis spores. Dikaryotic yeast-like spores (FBMds) from fruiting body and mycelia produced by gelatinization are an important part of the life history of Tremella fuciformis. They can produce a large amount of Tremella fuciformis polysaccharide under liquid conditions and are the main form of fermentation production of Tremella fuciformis polysaccharide. At present, there are relatively many research documents and patents on the production of Tremella polysaccharides based on Tremella fuciformis spore fermentation, but most of them have low yields, only 2-12g / L, and high polysaccharide impurities. For example, Chinese patent document CN110669681A (application number 201911080658.7) discloses a Tremella strain XY and its application in the production of Tremella polysaccharides, with a total yield of 15-25g / L and unstable yield; the document "Research Progress on Tremella Polysaccharides" mentioned that the input-output ratio of nitrogen sources in the current fermentation medium is relatively large, and it does not have the value of industrial production; Patent CN 109234334 A (application number 201811300710.0) optimizes the fermentation medium, but the Tremella yield is only 12.8g / L, which is low. Although some data have a high yield, the sevage method is often used to remove protein, which is highly polluting, expensive, and toxic, and is not suitable for large-scale industrial production. At present, the production of Tremella polysaccharide by Tremella fuciformis spore fermentation has not yet been industrialized and scaled up, which may be related to factors such as difficulties in technology transfer, relatively high costs, and relatively unstable output. Summary of the invention

[0004] In view of the deficiencies in the prior art, the present invention provides a Tremella fuciformis spore strain and a process for preparing Tremella fuciformis polysaccharide by fermentation thereof.

[0005] The technical solution of the present invention is as follows:

[0006] A Tremella fuciformis Berk strain FTPS005.1 was deposited in the China Center for Type Culture Collection on October 21, 2024. The deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: M20242283.

[0007] The ITS identification sequence of the Tremella fuciformis strain FTPS005.1 is shown in the sequence listing SEQ ID NO.1.

[0008] The application of the Tremella fuciformis strain FTPS005.1 in the production of Tremella fuciformis polysaccharide.

[0009] A preparation method for producing Tremella polysaccharide comprises the following steps:

[0010] (1) applying spores of Tremella fuciformis strain FTPS005.1 onto an activation medium for activation culture to obtain an activated strain;

[0011] (2) inoculating the activated strain into a seed culture medium to obtain a primary seed solution, and then inoculating the primary seed solution into a secondary seed culture medium to obtain a secondary seed solution;

[0012] (3) inoculating the secondary seed liquid into a fermentation medium for fermentation to obtain a Tremella fermentation liquid;

[0013] (4) subjecting the Tremella fuciformis fermented liquid to high-pressure homogenization, crushing, enzymolysis, filtration, desalting, removal of small molecule impurities and decolorization to obtain a Tremella fuciformis polysaccharide solution, and spray drying the Tremella fuciformis polysaccharide solution to obtain Tremella fuciformis polysaccharide.

[0014] Preferably, the preparation method of the activated strain in step (1) is as follows: inoculating spores of Tremella fuciformis strain FTPS005.1 into an activation culture medium, and culturing at 26-28° C. for 3-5 days to obtain an activated strain.

[0015] Further preferably, the activation medium comprises the following components: 20 g / L glucose, 2 g / L yeast powder, 2 g / L peptone, 1 g / L dipotassium hydrogen phosphate, 0.46 g / L potassium dihydrogen phosphate, 1 g / L magnesium sulfate heptahydrate, 10 mg / L vitamin B1, 20 g / L agar powder, the solvent is water, and the pH is natural.

[0016] Preferably, the preparation method of the seed solution in step (2) is as follows: the activated strain obtained in step (1) is selected and inoculated into a seed culture medium at 26-28°C and a rotation speed of 160-220 r / min until OD 560 When the OD reaches 5-8, the first-level seed solution is obtained, and the first-level seed solution is inoculated into the second-level seed culture medium at a volume ratio of 5%-10%, and cultured at 26-28°C and a rotation speed of 160-220r / min until the OD 560When the concentration reaches 15-20, the secondary seed liquid is obtained.

[0017] Further preferably, the seed culture medium comprises the following components: 20 g / L glucose, 2 g / L yeast powder, 2 g / L peptone, 1 g / L dipotassium hydrogen phosphate, 0.46 g / L potassium dihydrogen phosphate, 1 g / L magnesium sulfate heptahydrate, 10 mg / L vitamin B1, the solvent is water, and the pH is natural; the secondary seed culture medium comprises the following components: 20 g / L glucose, 4 g / L yeast powder, 1 g / L dipotassium hydrogen phosphate, 0.46 g / L potassium dihydrogen phosphate, 1 g / L magnesium sulfate heptahydrate, the solvent is water, and the pH is natural.

[0018] Preferably, the preparation method of the fermentation liquid in step (3) is as follows: the secondary seed liquid is inoculated into the above-mentioned Tremella fuciformis spore fermentation medium at a volume ratio of 6%-10%, 24-28°C, 300-800r / min, the dissolved oxygen is controlled to be maintained at 20%-30%, the pH is controlled between 3.5-5.0, and the fermentation end point is when the dissolved oxygen is greater than 30% and the dissolved oxygen continues to rise within 1 hour.

[0019] Preferably, the preparation method of the Tremella polysaccharide in step (4) is as follows: ① the fermentation liquid is homogenized and circulated at 800-1000 bar for 2-3 times to obtain a homogenous liquid; ② the pH value of the homogenous liquid is adjusted to 7-7.5, trypsin and lipase are added, and enzymolysis is carried out at 30-50°C for 2-6 hours; ③ the enzymolysis liquid is filtered through 3-5μm, 1μm, 0.45μm, and 100nm in sequence, and then desalted, small molecular impurities are removed and decolorized by 200-500Dal ultrafiltration, and then decolorized for a second time to obtain a Tremella polysaccharide solution; ④ the Tremella polysaccharide solution is directly introduced into a spray dryer for spray drying to obtain Tremella polysaccharide.

[0020] Further preferably, the amount of trypsin added is 0.5‰-5‰ by mass volume ratio, and the amount of lipase added is 0.5‰-5‰ by mass volume ratio; and the secondary decolorization method is Al2O3 column chromatography.

[0021] In the fermentation liquid preparation method, the Tremella fuciformis spore fermentation medium comprises the following components: 40-80 g / L of white sugar, 2-10 g / L of sugarcane juice, 2-10 g / L of yeast powder, 1-6 g / L of corn steep liquor, 0-0.75 g / L of histidine, 0-0.75 g / L of serine, 0-0.75 g / L of glutamic acid, 0-0.75 g / L of glutamine, 20-100 g / L of ash fungus extract, 1 g / L of dipotassium hydrogen phosphate, 0.5 g / L of potassium dihydrogen phosphate, 1 g / L of magnesium sulfate heptahydrate, and the solvent is water.

[0022] Preferably, the Tremella fuciformis spore fermentation medium comprises the following components: 50 g / L white sugar, 10 g / L sugarcane juice, 2 g / L yeast powder, 4 g / L corn steep liquor, 0.5 g / L glutamic acid, 0.5 g / L glutamine, 0.5 g / L serine, 0.5 g / L histidine, 60 g / L Mycelium incense extract, 1 g / L dipotassium hydrogen phosphate, 0.5 g / L potassium dihydrogen phosphate, 1 g / L magnesium sulfate heptahydrate, and the solvent is water.

[0023] Preferably, the preparation method of the incense ash fungus extract is as follows:

[0024] a. Activate the ash fungus and inoculate it into a sawdust culture medium, and culture it at 24-28°C until the sawdust culture medium is covered with white ash fungus hyphae and the sawdust culture medium turns brown to black, thereby obtaining the ash fungus sawdust culture;

[0025] b. Adjust the water content of the wood chip culture of the ash fungus obtained in step a to 60%-70%, weigh 50-100 g, add 1 L of water, boil in a boiling water bath for 20-60 min, filter, retain the filtrate, wash the solid residue with water 2-3 times, retain the washing liquid, discard the solid residue, mix all the liquids, filter through a 3-5 μm pore size to remove large particles of insoluble matter, pass through a 100 nm ceramic membrane, and control the final volume to 1 L.

[0026] Further preferably, in step a, the ash fungus is inoculated into PDA enriched medium, cultured at 24-28°C until it fills the plate and then used directly; or it is then transferred to PDA enriched medium and cultured at 24-28°C until it fills the plate, prepared into a mushroom block, and inoculated into sawdust medium.

[0027] Further preferably, the PDA enriched culture medium comprises the following components: 200 g / L potatoes, 20 g / L glucose, 3 g / L yeast powder, 3 g / L peptone, 1.5 g / L potassium dihydrogen phosphate, 1.5 g / L magnesium sulfate heptahydrate, 20 g / L agar powder, and the solvent is water; the sawdust culture medium comprises the following components by weight: 67 parts of sawdust, 30 parts of bran, 2 parts of glucose, 1 part of gypsum, and the material-water mass ratio is 1:1.3.

[0028] Beneficial effects:

[0029] The invention screens and mutates a tremella strain with a high tremella polysaccharide yield, and finally achieves a tremella polysaccharide yield of more than 24.5 g / L through fermentation optimization and three consecutive batches of repeated experiments. The invention has the advantages of high yield and stability; the fermentation cycle is short and the conditions are easy to control, which has the advantages of scaled-up production; the entire post-treatment process adopts an alcohol-free process, which greatly reduces the cost and danger of a traditional ethanol extraction process; the obtained tremella polysaccharide powder is pure white, has a molecular weight concentrated in 300,000-600,000 Dal, and has more superior antioxidant performance than tremella polysaccharides prepared by a traditional extraction method.

[0030] The raw materials used in the fermentation medium provided by the present invention are all cheap, easy to obtain, green and pollution-free raw materials with low raw material cost; sugarcane juice is the primary product after sugarcane is squeezed, and can be directly used with only a simple filtration process, which is green, environmentally friendly, low-cost and widely available; corn pulp is a by-product of deep processing of corn, contains rich soluble protein, growth hormone and some precursor substances, is low-priced and has abundant sources. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is a curve of the mortality rate of bacteria at different mutagenesis times.

[0032] Figure 2 This is the colony morphology of Tremella fuciformis spore strain FTPS005.1.

[0033] Figure 3 This is a microscopic examination of spores of Tremella fuciformis spore strain FTPS005.1;

[0034] In the figure, ①: photographed under an upright biological microscope, eyepiece 20×, objective lens 40×; ②: photographed under an upright biological microscope, eyepiece 20×, objective lens 100×.

[0035] Figure 4 This is a picture of different colors of Tremella polysaccharide obtained by adding different amounts of corn syrup.

[0036] Figure 5 This is the infrared spectrum of Tremella polysaccharide. DETAILED DESCRIPTION

[0037] The specific implementation scheme is described in detail below. Any replacement or modification based on this invention scheme that does not depart from the scope of the present invention is within the scope of protection of the present invention. Unless otherwise specified, the technical means used in the examples are conventional technical means well known to those skilled in the art, and the reagents used can be obtained through commercial or commercial channels.

[0038] Example 1

[0039] The process of obtaining Tremella fuciformis spore strains:

[0040] ① Acquisition of the original strain: fresh Tremella fuciformis fruiting bodies from the market and in the wild are collected, crude polysaccharides in Tremella fuciformis are determined according to the agricultural industry standard of the People's Republic of China NY / T1676-2008, and the fruiting bodies with the highest crude polysaccharide content (34.17 g / 100 g (dry weight)) are selected; after the surface of the fruiting body is sterilized, the surface of the fruiting body is cut open with a sterile scalpel, a piece of about 0.5 cm is cut from the part close to the inner side, and the piece is directly placed in a PDA liquid culture medium and cultured at 26-30° C. for 3-7 days; the OD value of the fermented liquid is 0.1447 g / 10.138 g / 10.167 g / 10.177 g / 10.16 ... 560The value is above 0.2, and the microscopic examination is used to confirm whether the strain morphology conforms to the Tremella fuciformis spore morphology and whether it is contaminated with foreign bacteria; the culture medium confirmed as Tremella fuciformis spores is directly applied to the PDA enriched culture medium, and cultured at 26-30°C for 3-7 days. The single colonies with faster growth, full colonies and sticky colonies are observed and selected with the naked eye. The selected strain is the wild strain FTPS005 collected in Gutian County, Ningde City, Fujian Province. The culture medium composition of the step is as follows:

[0041] PDA liquid medium: 200g potato, 20g glucose, 3g yeast powder, 3g peptone, add water to 1L; pH natural;

[0042] PDA enriched medium: 200g potato, 20g glucose, 3g yeast powder, 3g peptone, 1.5g magnesium sulfate heptahydrate, 1.5g potassium dihydrogen phosphate, 20g agar powder, add water to make up to 1L; pH natural.

[0043] ② Mutagenesis: The above strain FTPS005 was subjected to mutagenesis treatment, and the mutagenesis method was atmospheric pressure and room temperature plasma mutagenesis (Atmospheric and Room Temperature Plasma, ARTP), and the equipment used was the ARTP-M series ARTP mutagenizer produced by Tianmu Biotechnology Co., Ltd.; the mutagenesis steps were referred to the equipment instruction manual; the strain mutagenesis lethality curve was shown in Figure 1 Under the condition of 120W, the lethality can reach more than 90% after 210s of mutagenesis. Therefore, the mutagenesis conditions are 120W (mutation power), 210s (mutation time), and 10SLM (gas flow rate). The mutagenesis culture medium and the recovery culture medium are both PDA-enriched medium, and the protective agent is glycerol.

[0044] The colony morphology of the mutagenic strain is milky white to light yellow yeast-like colonies, which are round, plump and moist. As the culture time increases, the edges of the colonies shrink into irregular wrinkles, such as Figure 2 The cell morphology in the colony is spindle-shaped, oval, and round. The proliferation of the colony cells is mainly through budding, and some cells produce pseudohyphae by binary fission, such as Figure 3 The seed solution was stored in a glycerol tube and frozen at -80℃ for later use.

[0045] A glycerol tube of a mutagenic strain was directly inoculated into a PDA liquid medium and cultured at 26°C and 160 r / min for 5 days; 50 ml of the fermentation broth was centrifuged in a high-speed refrigerated centrifuge at 10,000 r / min for 5 min, the supernatant was discarded, the precipitate was transferred to a mortar, liquid nitrogen was added and ground into a white powder for standby use, the total DNA of Tremella fuciformis spores was extracted according to the instructions of a DNA extraction kit (purchased from Shanghai Shenggong), the ratio of A260 to A280 was 1.8 and the extraction concentration was 298.641 ng / μL using a nucleic acid protein detector, indicating that the DNA extraction purity and concentration were qualified; the 18S rDNA ITS region universal primer pair ITS4 / ITS5 (primer sequence (5'-3') TCCTCCGCTTATTGATATGC / GGAAGTAAAAGTCGTAACAAGG) was used to perform PCR amplification on the extracted total DNA of Tremella fuciformis spores, and the amplification system and amplification program are shown in Tables 1 and 2.

[0046] Table 1. PCR reaction system

[0047]

[0048] Table 2. PCR reaction program

[0049]

[0050]

[0051] The PCR product was electrophoresed using 1% agarose gel, and the gel was recovered after passing the test. Shanghai Shenggong Biotechnology Co., Ltd. was commissioned to sequence; the sequencing results were copied and pasted into NCBI for sequence comparison. According to the sequence comparison results, the strain was determined to be Tremella fuciformis Berk strain, and the strain was named FTPS005.1. It was deposited in the China Center for Type Culture Collection on October 21, 2024. The deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC NO:

[0052] M20242283. The ITS identification sequence is shown in the sequence listing as SEQ ID NO.1.

[0053] Example 2

[0054] Preparation of Tremella polysaccharide by bacterial fermentation

[0055] Activation of Tremella fuciformis spore strain: Spores of Tremella fuciformis strain FTPS005 (source of strain: wild strain collected from Gutian County, Ningde City, Fujian Province) and spores of the mutagenic strain FTPS005.1 were inoculated into activation culture medium, respectively, and cultured at 26° C. for 3 days.

[0056] The activation culture medium comprises: 20 g / L glucose, 2 g / L yeast powder, 2 g / L peptone, 1 g / L dipotassium hydrogen phosphate, 0.46 g / L potassium dihydrogen phosphate, 1 g / L magnesium sulfate heptahydrate, 10 mg / L vitamin B1, 20 g / L agar powder, the solvent is water, and the pH is natural.

[0057] The activated strains are fermented to prepare Tremella polysaccharide, specifically as follows:

[0058] Seed solution preparation: Pick the above activated strains and inoculate them into the seed culture medium at 26°C and 160r / min to OD 560 The value reached 6, and the first-level seed solution was obtained. The first-level seed solution was inoculated into the second-level seed culture medium at a volume ratio of 5%, and the OD was cultured at 26°C and a rotation speed of 160 r / min. 560 When it reaches 15, the secondary seed liquid is obtained.

[0059] Fermentation: The secondary seed liquid is inoculated into the fermentation medium at a volume ratio of 10%. The culture conditions are: 26°C, 300-800r / min, the dissolved oxygen (dissolved oxygen associated with stirring) is controlled to be maintained at 20%-30%, the pH is controlled at 3.5-5.0, and the fermentation end point is when the dissolved oxygen is greater than 30% and the dissolved oxygen continues to rise within 1 hour (a total fermentation of 7 days).

[0060] The seed culture medium is: 20g glucose, 2g yeast powder, 2g peptone, 1g dipotassium hydrogen phosphate, 0.46g potassium dihydrogen phosphate, 1g magnesium sulfate heptahydrate, 10mg vitamin B1, add water to make up to 1L, pH natural.

[0061] The secondary seed culture medium is: 20g glucose, 4g yeast powder, 1g dipotassium hydrogen phosphate, 0.46g potassium dihydrogen phosphate, 1g magnesium sulfate heptahydrate, add water to make up to 1L, pH natural.

[0062] Fermentation medium components: 50g white sugar, 2g yeast powder, 1g dipotassium hydrogen phosphate, 0.5g potassium dihydrogen phosphate, 1g magnesium sulfate heptahydrate, add water to make up to 1L; the fermentation medium can be adjusted according to the needs of the test case.

[0063] Preparation of Tremella polysaccharide from Tremella fuciformis spore strain fermentation broth: The fermentation broth was homogenized by a high-pressure homogenizer at 1000 bar for 3 cycles to obtain a homogenized solution; the pH value of the homogenized solution was adjusted to 7.0-7.5, and 1‰ (w / vg / mL) trypsin (enzyme activity 250NF U / mg, purchased from Beijing Solebow Technology Co., Ltd.), 1.5‰ (w / vg / mL) lipase (enzyme activity 20,000 U / g, purchased from Beijing Solebow Technology Co., Ltd.), enzymolysis at 50°C for 3h to obtain an enzymolysis solution; the enzymolysis solution was coarsely filtered through a 3-5μm filter plate and frame and finely filtered through a 1μm filter plate and frame to obtain a fine filtrate; the fine filtrate was successively passed through a 0.45μm filter membrane and a 100nm ceramic membrane, and the filtrate was collected and desalted, small molecule impurities were removed and decolorized through a 200Dal ultrafiltration membrane to obtain a concentrated solution; the concentrated solution was directly introduced into an Al2O3 chromatography column for secondary decolorization to obtain a colorless Tremella polysaccharide solution; the Tremella polysaccharide solution was directly introduced into a spray dryer for spray drying to obtain Tremella polysaccharide powder, and the Tremella polysaccharide yield was calculated by weighing.

[0064] Test Example 1

[0065] The fermentation broth in Example 2 was subjected to dissolved oxygen curve, dynamic viscosity, OD 560 Determine and calculate the final yield of Tremella polysaccharide and the content and molecular weight of each component in Tremella polysaccharide. The specific determination method is as follows:

[0066] (1) The dissolved oxygen data of the fermentation liquid is automatically detected online by the fermentation tank. The dissolved oxygen data represents the growth of Tremella fuciformis strains. The secretion of Tremella fuciformis polysaccharides is mainly concentrated in the stable growth period of Tremella fuciformis spores. At this time, the strain has a large oxygen demand and the dissolved oxygen in the fermentation liquid will drop rapidly. When the dissolved oxygen rises rapidly, it means that the strain begins to die and enters the decay period, indicating the end of fermentation.

[0067] (2) Dynamic viscosity measurement: 20 mL of fermentation broth was directly measured using a Brookfield DV2TLVTJ0 rotational viscometer. The unit of dynamic viscosity is mPa.s.

[0068] (3)OD 560 Determination: The fermentation liquid was diluted appropriately to keep the OD value within the range of 0.2-0.8. Water was used as blank and the absorbance was directly determined at 560 mm using a T6 New Century UV spectrophotometer produced by Beijing Puxi General Instrument Co., Ltd.

[0069] OD 560 =A 560 ×N

[0070] Where: A 560 ——Absorbance of the solution at 560 mm; N——Dilution multiple

[0071] (4) Loss on drying: directly measured using a Mettler-Toledo HS153 halogen moisture analyzer;

[0072] (5) Determination of total sugar content: The optimized phenol-sulfuric acid method was used. The specific steps are as follows: 0, 0.4, 0.6, 0.8, 1.0, 1.2, and 1.4 mL of the mannose standard stock solution were placed in a 25 mL stoppered test tube, and the solution was filled to 2.0 mL with distilled water, and 1.0 mL of 6% phenol solution was added. The mixture was shaken well, and 6.0 mL of concentrated sulfuric acid was added with a pipette suspended vertically at room temperature. The mixture was allowed to stand for 10 min, and the mixture was mixed evenly with an oscillator. The mixture was placed in a boiling water bath for 30 min, and then cooled to room temperature in an ice water bath after the reaction was completed. The absorbance A value was measured at a wavelength of 490 nm, and a standard curve was drawn with the absorbance value as the ordinate and the amount of mannose (μg) as the abscissa.

[0073] Weigh about 0.03g of the sample (accurate to 0.0001g), place it in a 500mL volumetric flask, add distilled water to the mark, shake well, let it stand for 2 hours, and set aside. Pipette 2.0mL of the above solution, place it in a 25mL stoppered test tube, add 1.0mL of 6% phenol solution, shake well, add 6.0mL of concentrated sulfuric acid with the pipette suspended vertically at room temperature, let it stand for 10 minutes, mix evenly with an oscillator, place it in a boiling water bath to react for 30 minutes, and cool to room temperature in an ice water bath after the reaction is completed. Use 2.0mL of water as a blank control and measure the absorbance at a wavelength of 490nm. The total sugar content is calculated as follows:

[0074]

[0075] In the formula: X is the total sugar content, %; C1 is the mannitol content on the standard curve corresponding to the absorbance measured by the sample, μg; m is the sample mass, g; h is the percentage of weight loss after sample drying, %; 1.25 is the conversion factor of total sugar equivalent to mannose.

[0076] (6) Determination of glucuronic acid: The sulfuric acid-carbazole method is used. The specific steps are as follows: accurately weigh 100 mg of glucuronic acid standard that has been vacuum dried at 105°C to a constant weight, put it into a 100-mL volumetric flask, add water to dissolve and dilute to the scale, and shake well to obtain a glucuronic acid standard stock solution; use a pipette to draw 5 mL of the glucuronic acid standard stock solution into a 100-mL volumetric flask and add purified water to dilute to the scale to obtain a glucuronic acid standard solution of about 50 μg / mL; accurately measure 0, 0.2, 0.4, 0.6, 0.8, and 1.0 mL of the glucuronic acid standard solution and place them in 25-mL stoppered test tubes, respectively, add purified water to 1.0 mL each, mix well, cool in an ice bath, slowly add 5.0 mL of borax-sulfuric acid solution that has been cooled in an ice bath, seal, mix well, heat in a boiling water bath for 10 minutes, and cool to room temperature in an ice bath. Accurately add 0.2 mL of carbazole test solution, mix well, heat in a boiling water bath for 15 minutes, and cool to room temperature in an ice bath. Use a UV-visible spectrophotometer to measure the absorbance at a wavelength of 530 nm, and calculate the regression equation based on the concentration of glucuronic acid and the corresponding absorbance.

[0077] Weigh 0.1g (W1, accurate to 0.001g) of the test sample, place it in a 100mL volumetric flask, and add water to dissolve and make up the volume. Weigh 5g (W2, accurate to 0.01g), place it in a 50mL volumetric flask, add purified water to dilute to the scale, shake well, and the test solution is obtained; take 2 stoppered test tubes, add 1mL of the test solution to each, and take another 25mL stoppered test tube and add 1mL of purified water as a blank sample, mix well, cool in an ice bath, slowly add 5.0mL of borax sulfuric acid solution that has been cooled in an ice bath, seal, mix well, heat in a boiling water bath for 10 minutes, and cool to room temperature in an ice bath. Accurately add 0.2mL of carbazole test solution, mix well, heat in a boiling water bath for 15min, and cool to room temperature in an ice bath; use a UV-visible spectrophotometer to measure the absorbance at a wavelength of 530nm. The formula for calculating the glucuronic acid content is as follows:

[0078]

[0079] Where: X G ——glucuronic acid content, %; C1——glucuronic acid concentration in the test solution calculated by regression equation, μg / mL; W1——weighed mass of the test sample, g; W2——weighed amount of the test solution diluted in the second step, g; h——weight loss percentage of the sample after drying, %.

[0080] (7) Molecular weight determination: using Ubbelohde viscometer method.

[0081] Table 3. Dynamic viscosity and OD of fermentation broth 560 The yield and content of Tremella polysaccharide

[0082]

[0083] OD 560 Reflects the relative number of Tremella fuciformis spores, OD 560 The larger the OD value, the higher the growth activity of the strain; the dynamic viscosity of the fermentation liquid reflects the molecular weight of Tremella polysaccharide to a certain extent. The larger the viscosity, the higher the molecular weight will be. It can be seen from the experimental results provided in Table 3 that according to the OD 560 Based on the data of dynamic viscosity of fermentation liquid, it can be preliminarily determined that the starting strain (FTPS005 strain) and the mutated strain FTPS005.1 have the same strain activity and molecular weight level. The total sugar, glucuronic acid and protein contents are all quality control indicators of Tremella polysaccharide. The molecular weight shows the size of Tremella polysaccharide molecules. The current mainstream products require the higher the molecular weight, the better. The Tremella polysaccharides obtained by fermentation of the starting strain and the FTPS005.1 strain are both white powders, with a total sugar content of ≥90%, a uronic acid content of 10%-25%, and a protein content of ≤0.1%, which meets the Q / FCG 1001S-2024 enterprise standard. Under the condition of consistent strain activity, consistent molecular weight level and consistent product quality, the mutated strain FTPS005.1 has increased its Tremella polysaccharide production by 71.1% compared with the starting strain, with the highest yield reaching 8.52g / L, and has a more obvious yield advantage.

[0084] Test Example 2

[0085] Effect of sugarcane juice on fermentation products of Tremella fuciformis spore strain

[0086] Tremella polysaccharide was prepared by fermentation using Tremella fuciformis spore strain FTPS005.1, wherein the strain activation process and fermentation process were consistent with those in Example 2, the parameters of the fermentation broth and Tremella fuciformis polysaccharide were determined in accordance with those in Experimental Example 1, and the fermentation medium formula was shown in Table 4.

[0087] Table 4. Fermentation medium formula

[0088]

[0089] Table 5. Results of various parameters measured by FTPS005.1 in fermentation medium with different contents of sugarcane juice

[0090]

[0091]

[0092] From the experimental results in Table 5, it can be seen that with the increase of sugarcane juice addition, the yield of Tremella polysaccharide also increases. When the addition amount is 10g / L, the yield of Tremella polysaccharide reaches 11.12g / L. When the addition amount is greater than 10g / L, the yield of Tremella polysaccharide no longer increases significantly. The viscosity of the fermentation liquid after adding sugarcane juice and the OD value of the fermentation liquid are 560All are within the same level range, and the total sugar content, glucuronic acid content and protein content of Tremella polysaccharide all meet the Q / FCG 1001S-2024 enterprise standard.

[0093] Test Example 3

[0094] Effect of corn steep liquor on fermentation products of Tremella fuciformis spore strain

[0095] Tremella polysaccharide was prepared by fermentation using Tremella fuciformis spore strain FTPS005.1, wherein the strain activation process and fermentation process were consistent with those in Example 2, the parameters of the fermentation broth and Tremella fuciformis polysaccharide were determined in accordance with those in Experimental Example 1, and the fermentation medium formula was shown in Table 6.

[0096] Table 6. Fermentation medium formulation

[0097]

[0098] Table 7. Parameter determination results of FTPS005.1 under different contents of corn steep liquor fermentation medium conditions

[0099]

[0100] From the experimental results in Table 7, it can be seen that with the increase of corn syrup addition, the yield of Tremella polysaccharide increases accordingly, and when the addition amount reaches 4g / L, the yield of Tremella polysaccharide reaches 11.72g / L, which is 41.5% higher than that of the control group; when the addition amount is greater than 4g / L, the yield of Tremella polysaccharide no longer increases significantly, and when it is greater than 6g / L, the yield begins to decrease; at the same time, when the corn syrup addition amount is greater than 4g / L, Figure 4 As shown in the figure, the decolorization effect of Tremella polysaccharide was significantly weakened, and the color turned significantly yellow compared with the control group. The viscosity of the fermentation liquid after adding corn syrup increased with the increase of corn syrup addition, and reached the maximum value when the addition amount reached 6g / L. 560 They are all within the same level range, and the total sugar content, glucuronic acid content and protein content of Tremella polysaccharide are in line with the Q / FCG1001S-2024 enterprise standard.

[0101] Test Example 4

[0102] Effects of amino acids on fermentation products of Tremella fuciformis spore strains

[0103] Tremella polysaccharide was prepared by fermentation using Tremella fuciformis spore strain FTPS005.1, wherein the strain activation process and the fermentation process were consistent with those in Example 2, the parameters of the fermentation broth and Tremella fuciformis polysaccharide were determined in accordance with those in Test Example 1, and the fermentation medium formula was: 50 g white sugar, 2 g yeast powder, 1 g dipotassium hydrogen phosphate, 0.5 g potassium dihydrogen phosphate, 1 g magnesium sulfate heptahydrate, and amino acids (specific amounts added are shown in Table 8) were added with water to make the volume 1 L.

[0104] Table 8. Amino acid addition

[0105]

[0106] Table 9. Results of various parameters of FTPS005.1 under fermentation medium with different amino acid contents

[0107]

[0108]

[0109] The IBM spass software was used to perform variance analysis on Tremella polysaccharide yield, and the results are shown in Tables 10 and 11:

[0110] Table 10. Test of between-subject effects

[0111]

[0112]

[0113] Table 11. Mean and range analysis of each factor

[0114]

[0115] From the experimental results in Table 9, the analysis results in Table 10 and Table 11, it can be seen that glutamine, glutamic acid, serine and histidine have extremely significant effects on the yield of Tremella polysaccharide (p < 0.01); from the variance analysis, it can be seen that glutamine has the greatest effect on the yield of Tremella polysaccharide, followed by glutamic acid and serine, and histidine has the least effect; combined with the range analysis, it can be seen that the optimal addition amount of each amino acid is as follows: glutamine 0.5g / L, glutamic acid 0.5g / L, serine 0.5g / L, histidine 0.5g / L. Different groups have different viscosities as the fermentation yield of Tremella polysaccharide is different, but the OD of the fermentation liquid is 560 All are within the same level range, and the total sugar content, glucuronic acid content and protein content of Tremella polysaccharide all meet the Q / FCG 1001S-2024 enterprise standard.

[0116] The fermentation medium was prepared according to the optimal amino acid formula, and Tremella polysaccharide was fermented with Tremella fuciformis spore strain FTPS005.1, wherein the strain activation process and fermentation process were consistent with Example 2, and the determination of various parameters of the fermentation liquid and Tremella fuciformis polysaccharide were consistent with Experimental Example 1.

[0117] The above optimal amino acid formula is: 50g white sugar, 2g yeast powder, 1g dipotassium hydrogen phosphate, 0.5g potassium dihydrogen phosphate, 1g magnesium sulfate heptahydrate, 0.5g glutamine, 0.5g glutamic acid, 0.5g serine, 0.5g histidine, add water to make up to 1L.

[0118] Table 12. Results of various parameters measured under the optimal amino acid fermentation medium conditions for FTPS005.1

[0119]

[0120] The culture medium was prepared according to the optimal amino acid formula, and the Tremella fuciformis spore strain FTPS005.1 was fermented and cultured. The average yield of Tremella fuciformis polysaccharide was 16.26 g / L, which was 92.0% higher than that of the starting culture medium (control culture medium, experiment number 1). The addition of amino acids promoted the increase of the molecular weight of Tremella fuciformis polysaccharide, and the viscosity of the fermentation liquid was increased to more than 6000 mPa.s, and the molecular weight of Tremella fuciformis polysaccharide was increased to more than 500,000 Dal, which was more in line with the requirements of cosmetic grade. The OD value of the fermentation liquid was 0.14, which was higher than that of the control culture medium ...3, which was higher than that of the control culture medium. 560 There is no obvious change, and the total sugar content, glucuronic acid content and protein content of Tremella polysaccharide all meet the enterprise standard Q / FCG 1001S-2024.

[0121] Test Example 5

[0122] Effects of the extract of Psoralea corylifolia on the fermentation products of Tremella fuciformis spore strains

[0123] Tremella polysaccharide was prepared by fermentation using Tremella fuciformis spore strain FTPS005.1, wherein the strain activation process and fermentation process were consistent with Example 2, the parameters of the fermentation broth and Tremella fuciformis polysaccharide were determined in accordance with Experimental Example 1, and the fermentation medium formula was shown in Table 13.

[0124] The preparation process of the incense ash mushroom extract is as follows:

[0125] (1) Take out the ash fungus from the -4℃ refrigerator, pour off the mineral oil on the inclined surface of the test tube, and use a sterile inoculation spatula to cut a piece of ash fungus of about 0.5×0.5 cm from the inclined surface and place it in the center of the PDA enriched medium plate. Cultivate at 28℃ until the plate is full of ash fungus, and then use a 6mm puncher to punch holes in the grown ash fungus.

[0126] (2) The circular inoculum blocks obtained by the puncher are further transferred to a new PDA enriched medium plate. After repeating the above steps, three circular inoculum blocks are picked up with a sterile inoculation spatula and inoculated into a 750 mL glass culture bottle containing sawdust medium. The bottles are cultured at 26° C. for 24 days. At this time, the sawdust medium is full of white mycelium of the fragrant ash fungus, and the sawdust medium turns brown to black, thereby obtaining the sawdust culture of the fragrant ash fungus.

[0127] (3) Sampling and measuring the water content of the wood chip culture of the incense ash fungus obtained in step (2) to adjust the water content to 65%. Weigh 100g of the wood chip culture of the incense ash fungus, add 1L of water, and filter it through gauze while it is hot after boiling in a water bath for 30 minutes, retain the filtrate, wash the solid residue 3 times, retain the washing liquid, and discard the solid residue; after mixing all the liquids, pass through a 3-5μm filter paper to remove large particles of insoluble matter, pass through a 100nm ceramic membrane, collect the filtrate, and adjust the final volume to 1L.

[0128] Among them, the above-mentioned Annuloypoxylon stygium was purchased from Shandong Tongkang Agricultural Development Co., Ltd.

[0129] The sawdust culture medium comprises the following components by weight: 67 parts of sawdust, 30 parts of bran, 2 parts of glucose, 1 part of gypsum, and a material-water mass ratio of 1:1.3. According to the standard of 500g culture medium per bottle, the sawdust culture medium is accurately weighed and placed in a 750mL glass culture bottle, which is sealed with a cotton plug and sterilized at 121°C for 30 minutes.

[0130] Table 13. Fermentation medium formulation

[0131]

[0132]

[0133] Table 14. Parameter determination results of FTPS005.1 under fermentation medium with different contents of ash fungus extract

[0134]

[0135] From the data analysis of Table 14, it can be seen that with the increase in the amount of the incense ash mushroom extract, the yield of Tremella polysaccharide increases accordingly, and when the addition amount reaches 60g / L, the Tremella polysaccharide yield reaches a maximum of 14.11g / L, which is 65.4% higher than the control group; after the addition amount is greater than 60g / L, the Tremella polysaccharide yield no longer increases significantly, and with the increase of the incense ash mushroom extract, the chroma of Tremella polysaccharide also increases, and the decolorization effect is significantly weakened. At the same time, with the increase in the amount of incense ash mushroom extract, the viscosity of the fermentation liquid also increases, and the OD value of the fermentation liquid 560 All are within the same level range, and the total sugar content, glucuronic acid content and protein content of Tremella polysaccharide all meet the Q / FCG 1001S-2024 enterprise standard.

[0136] Test Example 6

[0137] Tremella polysaccharide was prepared by fermentation using Tremella fuciformis spore strain FTPS005.1, wherein the strain activation process and the fermentation process were consistent with those in Example 2, and the parameters of the fermentation liquid and Tremella polysaccharide were determined in accordance with those in Test Example 1, and the fermentation medium formula was as follows:

[0138] Control group: 50g white sugar, 2g yeast powder, 1g dipotassium hydrogen phosphate, 0.5g potassium dihydrogen phosphate, 1g magnesium sulfate heptahydrate, add water to make up to 1L.

[0139] Experimental group 1: 50g white sugar, 10g sugarcane juice, 2g yeast powder, 4g corn steep liquor, 0.5g serine, 0.5g glutamic acid, 0.5g glutamine, 0.5g histidine, 60g ash mushroom extract, 1g dipotassium hydrogen phosphate, 0.5g potassium dihydrogen phosphate, 1g magnesium sulfate heptahydrate, add water to make up to 1L.

[0140] The culture medium formula of experimental group 2 and experimental group 3 was the same as that of experimental group 1.

[0141] Table 15. Results of various parameters of FTPS005.1 under different fermentation medium conditions

[0142]

[0143] The experimental results show that the maximum yield of Tremella polysaccharide can reach 24.87 g / L when the Tremella fuciformis spores are fermented according to the optimal formula, which is 197% higher than that of the control group. By comparing the data of experimental group 1, experimental group 2 and experimental group 3, it can be seen that the strain has a relatively stable Tremella polysaccharide production capacity, and the viscosity of the fermentation liquid can reach about 14000 mPa.s, and the OD value of the fermentation liquid is 2.3447 W / L. 560 The molecular weight can reach about 51, and the total sugar content, glucuronic acid content and protein content are in line with the Q / FCG 1001S-2024 enterprise standard.

[0144] Test Example 7

[0145] The infrared spectrum, antioxidant properties and cytotoxicity tests were performed on the Tremella polysaccharide prepared in Experimental Group 1 of Test Example 6.

[0146] The infrared spectrum determination method of Tremella polysaccharide is as follows: take 2-3 mg of Tremella polysaccharide powder, add 300 mg of potassium bromide, grind it thoroughly and press it into transparent thin slices in a tablet press, and scan it directly with an infrared spectrometer. The infrared spectrum is as follows: Figure 5 shown.

[0147] From the spectrum results, we can see that at 3400cm -1 There is an OH bond stretching vibration peak at 2950cm -1 There is a weak absorption stretching vibration peak of CH bond at 1600-1700cm -1 There is an absorption peak between 1090cm -1 There is angular vibration of alcohol hydroxyl group; at 610cm -1There is an absorption peak at , which represents α-D-pyranose. The spectrum results are basically consistent with the peak results of the Tremella polysaccharide standard spectrum in the T / SFABA4-2018 group standard, indicating that the fermentation product of Experimental Group 1 of Test Example 6 is Tremella polysaccharide.

[0148] The antioxidant capacity of Tremella polysaccharide is determined as follows:

[0149] (1) Accurately weigh 3.94 mg of DPPH and dilute to 100 mL with ethanol to obtain a DPPH solution;

[0150] (2) Control group: 10 mg of control group Tremella polysaccharide (finished Tremella polysaccharide (prepared by extraction method), product manufacturer: Shandong Focus Freda Biological Co., Ltd.) was dissolved in ultrapure water to prepare sample solutions with concentrations of 10, 5, 2.5, 1.25, 0.625, 0.3125, 0.1563, 0.07815, and 0.039075 mg / mL, respectively;

[0151] (3) Experimental group: 10 mg of Tremella polysaccharide prepared in Experimental Group 1 of Test Example 6 was dissolved in ultrapure water, and a series of sample solutions were prepared according to the preparation method of step (2);

[0152] (4) 500 mg of vitamin C was dissolved in ultrapure water to prepare vitamin C solutions with concentrations of 0.1, 0.05, 0.025, 0.0125, 0.00625, 0.003125, and 0.001563 g / mL as positive control solutions;

[0153] (5) taking anhydrous ethanol as the ethanol control solution;

[0154] (6) Add 1 mL of the test solution into a 10 mL colorimetric tube. The test solution includes the sample solution and the vitamin C control solution. The reaction is carried out at room temperature in the dark for 30 min. Each reaction is set up in triplicate. The sample addition conditions are shown in Table 16.

[0155] Table 16. Solution preparation

[0156]

[0157] (7) using an ultraviolet spectrophotometer to measure the absorbance at a wavelength of 517 nm;

[0158] The calculation formula of DPPH clearance rate is as follows:

[0159] DPPH clearance rate = [1-(absorbance value of Ai-absorbance value of Aj) / absorbance value of Ac]*100%

[0160] Table 17. DPPH scavenging rate of vitamin C control solution

[0161]

[0162]

[0163] Table 18. DPPH removal rate of sample solutions

[0164]

[0165] According to the experimental results in Tables 17 and 18, the Tremella polysaccharide prepared by the present invention has strong antioxidant properties; at the same time, compared with the Tremella polysaccharide prepared by the extraction method, it has stronger antioxidant properties.

Claims

1. A Tremella fuciformis Berk strain FTPS005.1 was deposited in the China Center for Type Culture Collection on October 21, 2024. The deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: M20242283.

2. Application of the Tremella fuciformis strain FTPS005.1 according to claim 1 in producing Tremella fuciformis polysaccharides.

3. A method for producing Tremella polysaccharide, characterized in that: The steps include: (1) applying spores of Tremella fuciformis strain FTPS005.1 onto an activation medium for activation culture to obtain an activated strain; (2) inoculating the activated strain into a seed culture medium to obtain a primary seed solution, and then inoculating the primary seed solution into a secondary seed culture medium to obtain a secondary seed solution; (3) inoculating the secondary seed liquid into a fermentation medium for fermentation to obtain a Tremella fermentation liquid; (4) subjecting the Tremella fuciformis fermented liquid to high-pressure homogenization, crushing, enzymolysis, filtration, desalting, removal of small molecule impurities and decolorization to obtain a Tremella fuciformis polysaccharide solution, and spray drying the Tremella fuciformis polysaccharide solution to obtain Tremella fuciformis polysaccharide.

4. The preparation method according to claim 3, characterized in that: The preparation method of the activated strain in step (1) is as follows: inoculating spores of Tremella fuciformis strain FTPS005.1 into an activation culture medium, and culturing at 26-28° C. for 3-5 days to obtain an activated strain; Preferably, the activation medium comprises the following components: 20 g / L glucose, 2 g / L yeast powder, 2 g / L peptone, 1 g / L dipotassium hydrogen phosphate, 0.46 g / L potassium dihydrogen phosphate, 1 g / L magnesium sulfate heptahydrate, 10 mg / L vitamin B1, 20 g / L agar powder, the solvent is water, and the pH is natural.

5. The preparation method according to claim 3, characterized in that: The preparation method of the seed solution in step (2) is as follows: the activated strain obtained in step (1) is selected and inoculated into a seed culture medium at 26-28°C and a rotation speed of 160-220 r / min until the OD 560 When the OD reaches 5-8, the first-level seed solution is obtained, and the first-level seed solution is inoculated into the second-level seed culture medium at a volume ratio of 5%-10%, and cultured at 26-28°C and a rotation speed of 160-220r / min until the OD 560 When the temperature reaches 15-20, the secondary seed solution is obtained; Preferably, the seed culture medium comprises the following components: 20 g / L glucose, 2 g / L yeast powder, 2 g / L peptone, 1 g / L dipotassium hydrogen phosphate, 0.46 g / L potassium dihydrogen phosphate, 1 g / L magnesium sulfate heptahydrate, 10 mg / L vitamin B1, the solvent is water, and the pH is natural; the secondary seed culture medium comprises the following components: 20 g / L glucose, 4 g / L yeast powder, 1 g / L dipotassium hydrogen phosphate, 0.46 g / L potassium dihydrogen phosphate, 1 g / L magnesium sulfate heptahydrate, the solvent is water, and the pH is natural.

6. The preparation method according to claim 3, characterized in that: The preparation method of the fermentation liquid in step (3) is as follows: the secondary seed liquid is inoculated into the Tremella fuciformis spore fermentation medium at a volume ratio of 6%-10%, and the culture is carried out at 24-28° C. and 300-800 r / min. The dissolved oxygen is controlled to be maintained at 20%-30%, and the pH is controlled at 3.5-5.

0. The fermentation end point is when the dissolved oxygen is greater than 30% and the dissolved oxygen rises continuously within 1 hour.

7. The preparation method according to claim 3, characterized in that: The preparation method of the tremella polysaccharide in step (4) is as follows: ① the fermentation liquid is homogenized and circulated at 800-1000 bar for 2-3 times to obtain a homogenous liquid; ② the pH value of the homogenous liquid is adjusted to 7-7.5, trypsin and lipase are added, and enzymolysis is carried out at 30-50° C. for 2-6 hours; ③ the enzymolysis liquid is filtered through 3-5 μm, 1 μm, 0.45 μm, and 100 nm in sequence, and then desalted, small molecular impurities are removed, and decolorized by 200-500 Dal ultrafiltration, and then decolorized for a second time to obtain a tremella polysaccharide solution; ④ the tremella polysaccharide solution is directly introduced into a spray dryer for spray drying to obtain tremella polysaccharide.

8. The preparation method according to claim 7, characterized in that: The amount of trypsin added is 0.5‰-5‰ by mass volume, and the amount of lipase added is 0.5‰-5‰ by mass volume; the secondary decolorization method is Al2O3 column chromatography.

9. The preparation method according to claim 6, characterized in that: The Tremella fuciformis spore fermentation medium comprises the following components: 40-80 g / L of white sugar, 2-10 g / L of sugarcane juice, 2-10 g / L of yeast powder, 1-6 g / L of corn steep liquor, 0-0.75 g / L of histidine, 0-0.75 g / L of serine, 0-0.75 g / L of glutamic acid, 0-0.75 g / L of glutamine, 20-100 g / L of ash fungus extract, 1 g / L of dipotassium hydrogen phosphate, 0.5 g / L of potassium dihydrogen phosphate, 1 g / L of magnesium sulfate heptahydrate, and the solvent is water; Preferably, the Tremella fuciformis spore fermentation medium comprises the following components: 50 g / L white sugar, 10 g / L sugarcane juice, 2 g / L yeast powder, 4 g / L corn steep liquor, 0.5 g / L glutamic acid, 0.5 g / L glutamine, 0.5 g / L serine, 0.5 g / L histidine, 60 g / L Mycelium incense extract, 1 g / L dipotassium hydrogen phosphate, 0.5 g / L potassium dihydrogen phosphate, 1 g / L magnesium sulfate heptahydrate, and the solvent is water.

10. The preparation method according to claim 9, characterized in that: The preparation method of the incense ash fungus extract is as follows: a. Activate the ash fungus and inoculate it into a sawdust culture medium, and culture it at 24-28°C until the sawdust culture medium is covered with white ash fungus hyphae and the sawdust culture medium turns brown to black, thereby obtaining the ash fungus sawdust culture; b. Adjust the water content of the wood chip culture of the incense ash fungus obtained in step a to 60%-70%, weigh 50-100 g, add 1 L of water, boil in a boiling water bath for 20-60 min, filter, retain the filtrate, wash the solid residue with water 2-3 times, retain the washing liquid, discard the solid residue, mix all the liquids, filter through a 3-5 μm pore size to remove large particles of insoluble matter, pass through a 100 nm ceramic membrane, and control the final volume to 1 L; Preferably, in step a, the incense ash fungus is inoculated into a PDA enriched medium, cultured at 24-28° C. until it fills the plate, and then used directly; or it is transferred to a PDA enriched medium and cultured at 24-28° C. until it fills the plate, prepared into a mushroom block, and inoculated into a sawdust medium; Preferably, the PDA enriched culture medium comprises the following components: 200 g / L potato, 20 g / L glucose, 3 g / L yeast powder, 3 g / L peptone, 1.5 g / L potassium dihydrogen phosphate, 1.5 g / L magnesium sulfate heptahydrate, 20 g / L agar powder, and the solvent is water; the sawdust culture medium comprises the following components by weight: 67 parts of sawdust, 30 parts of bran, 2 parts of glucose, 1 part of gypsum, and the material-water mass ratio is 1:1.3.

Images