A kind of brewer's yeast engineering bacteria for producing spermidine and its application

Abstract

The invention discloses an engineered yeast strain for producing spermidine and its application, and belongs to the field of synthetic biology. The invention adopts a metabolic engineering method, and realizes a new pathway for synthesizing spermidine in yeast by introducing exogenous arginine decarboxylase, exogenous carboxylaminopropyl agmatine dehydrogenase gene, exogenous carboxylaminopropyl agmatine decarboxylase gene, and exogenous aminopropyl agmatine urea hydrolase gene. When the exogenous pathway is introduced, the spermidine concentration reaches 5.8 g / L. The invention obtains an engineered yeast strain for producing spermidine with high yield, which has good industrial application prospects.

Description

Technical Field

[0001] The invention relates to an engineering yeast for producing spermidine and application thereof, belonging to the technical field of bioengineering. Background Art

[0002] Spermidine is a polyamine compound with the molecular formula NH2(CH2)3NH(CH2)4NH2. It is widely present in microorganisms, plants and animals and is an important physiologically active substance. As a natural organic small molecule, spermidine has many important biological functions in organisms, including participating in cell growth, maintaining DNA stability, anti-oxidation and immune regulation.

[0003] At present, the yield of spermidine synthesized by microorganisms is relatively low, far from meeting the needs of industrial applications. This is because the metabolic pathway for synthesizing spermidine is relatively complex, involving multiple enzyme-catalyzed reactions, and the catalytic efficiency of each enzyme needs to be improved to increase the total yield. There are some intermediates in the synthetic pathway of spermidine, which may be toxic to microbial strains, resulting in obstruction of the metabolic pathway. Therefore, the screening and construction of microbial engineering strains for spermidine production remains challenging, and it is necessary to find hosts with high spermidine production potential.

[0004] The biological pathways for synthesizing spermidine that have been discovered mainly include two routes: the first pathway directly generates spermidine through carboxylated adenosylmethionine and putrescine under the action of spermidine synthase. In this process, methionine (Met) first undergoes adenylation and decarboxylation reactions by related enzymes to form carboxylated adenosylmethionine, and then reacts with putrescine under the catalysis of spermidine synthase to finally synthesize spermidine. This is a relatively common traditional spermidine synthesis pathway that exists in animals, plants and microorganisms. The second pathway synthesizes spermidine through aspartate-β-semialdehyde and putrescine under the catalysis of carboxyspermidine dehydrogenase and decarboxylase. In this process, common amino acids such as aspartate (Asp) first undergo phosphorylation and dehydrogenation reactions by related enzymes to form aspartate-β-semialdehyde, and then are catalyzed by carboxyspermidine dehydrogenase and decarboxylase to finally synthesize spermidine.

[0005] Saccharomyces cerevisiae has unique advantages as a host for producing spermidine: (1) Saccharomyces cerevisiae has a very complex metabolic network, which allows it to use a variety of substrates to synthesize the intermediates and precursors required for spermidine. This can increase the yield and diversity of spermidine; (2) Saccharomyces cerevisiae has a nucleus and can perform nuclear expression, which is very important for the synthesis of complex proteins or synthesis pathways that require post-transcriptional modification; (3) Yeast is usually able to synthesize pantothenic acid, which is a cofactor required for spermidine synthesis. Pantothenic acid plays a key role in the synthesis of spermidine; (4) Saccharomyces cerevisiae is widely used in food and wine production and has been widely recognized as a safe microorganism. This reduces the biosafety risk in industrial production.

[0006] Prior art (CN111201316A) improves Saccharomyces cerevisiae by means of genetic engineering, combining the overexpression of spermidine pathway genes with pathway modifications involving the synthesis and regeneration of cofactors or cosubstrates (particularly S-adenosylmethionine (SAM)) involved in spermidine production, SAM can then be converted into decarboxylated S-adenosylmethionine (dSAM) and used for spermidine synthesis, and the final spermidine yield reaches 1.4 g / L. Although this technology has improved the yield of spermidine, the current yield still cannot meet industrial demand. Therefore, the problem that needs to be solved urgently is still to obtain a microbial strain that produces high spermidine. Summary of the invention

[0007] The invention provides a genetic engineering bacterium of saccharomyces cerevisiae, which is a new way to introduce exogenous synthetic spermidine by taking saccharomyces cerevisiae as a host.

[0008] The first object of the present invention is to provide a genetically engineered yeast of saccharomyces cerevisiae, wherein the engineered bacteria introduces an exogenous spermidine synthesis pathway and contains genes for arginine decarboxylase, carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase and aminopropylagmatine urea hydrolase.

[0009] In one embodiment, the arginine decarboxylase may be an arginine decarboxylase from any source; alternatively, it may be an arginine decarboxylase from Escherichia coli or the like.

[0010] Further optionally, it is from Escherichia coli BL21.

[0011] In one embodiment, the carboxyaminopropylagmatine dehydrogenase may be a carboxyaminopropylagmatine dehydrogenase from any source; alternatively, it may be a carboxyaminopropylagmatine dehydrogenase from Spirochaeta thermophila, Denitrovibrioacetiphilus, Geobacter sulfurreducens, Ilumatobacter coccineus, and the like.

[0012] Further optionally, it is from Spirochaeta thermophila DSM 6578 or Denitrovibrioacetiphilus DSM 12809 or Geobacter sulfurreducens KN400 or Ilumatobactercoccineus YM16-304.

[0013] In one embodiment, the carboxyaminopropylagmatine decarboxylase may be a carboxyaminopropylagmatine dehydrogenase from any source; alternatively, it may be a carboxyaminopropylagmatine dehydrogenase from Spirochaeta thermophila, Denitrovibrioacetiphilus, Geobacter sulfurreducens, Ilumatobacter coccineus, and the like.

[0014] Further optionally, it is from Spirochaeta thermophila DSM 6578 or Denitrovibrioacetiphilus DSM 12809 or Geobacter sulfurreducens KN400 or Ilumatobactercoccineus YM16-304.

[0015] In one embodiment, the aminopropylagmatine urea hydrolase may be a carboxyaminopropylagmatine dehydrogenase from any source; alternatively, it may be a carboxyaminopropylagmatine dehydrogenase from Spirochaeta thermophila, Denitrovibrioacetiphilus, Geobacter sulfurreducens, Ilumatobacter coccineus, etc.

[0016] Further optionally, it is from Spirochaeta thermophila DSM 6578 or Denitrovibrioacetiphilus DSM 12809 or Geobacter sulfurreducens KN400 or Ilumatobactercoccineus YM16-304.

[0017] In one embodiment, the amino acid sequence number of the exogenous arginine decarboxylase is QJZ05082.1; the amino acid sequence number of the exogenous carboxyaminopropylagmatine dehydrogenase is WP_014623968.1; the amino acid sequence number of the exogenous carboxyaminopropylagmatine decarboxylase is WP_014623969.1; and the amino acid sequence number of the exogenous aminopropylagmatine ureahydrolase is WP_014623970.1.

[0018] In one embodiment, the exogenous arginine decarboxylase, exogenous carboxyaminopropylagmatine dehydrogenase, exogenous carboxyaminopropylagmatine decarboxylase and exogenous aminopropylagmatine ureahydrolase are integrated into the genome of Saccharomyces cerevisiae for expression.

[0019] In one embodiment, the exogenous arginine decarboxylase, exogenous carboxyaminopropylagmatine dehydrogenase, exogenous carboxyaminopropylagmatine decarboxylase and exogenous aminopropylagmatine ureahydrolase genes correspond to promoters pADH1, pPGK1, pGAPDH and pTPI, respectively.

[0020] In one embodiment, the gene integration and expression of the genetically engineered bacteria is carried out using the principle of homologous recombination.

[0021] In one embodiment, the gene is integrated using Crispr / Cas9 gene editing technology.

[0022] The second object of the present invention is to provide a method for constructing a genetically engineered yeast strain of Saccharomyces cerevisiae for producing spermidine, comprising the steps of:

[0023] (1) introducing exogenous arginine decarboxylase, carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase and aminopropylagmatine ureahydrolase genes into plasmid pEC-XK99E;

[0024] (2) Promoters pADH1, pPGK1, pGAPDH, and pTPI were inserted upstream of the exogenous genes in pEC-XK99E;

[0025] (3) The plasmid pEC-XK99E was integrated into the Saccharomyces cerevisiae genome through homologous recombination.

[0026] The third object of the present invention is to provide an application of a genetically engineered strain of Saccharomyces cerevisiae in producing spermidine.

[0027] Beneficial Effects

[0028] The present invention constructs a brewer's yeast that produces high spermidine using glucose as raw material based on synthetic biology methods. The production process is simple, the raw materials are easily available, the cost is low, and it has good prospects for industrial application. The details are as follows:

[0029] The present invention introduces an exogenous pathway, and realizes the synthesis of a new pathway of spermidine in saccharomyces cerevisiae by introducing exogenous arginine decarboxylase, exogenous carboxylaminopropyl agmatine dehydrogenase gene, exogenous carboxylaminopropyl agmatine decarboxylase gene, and exogenous aminopropyl agmatine urea hydrolase gene. Saccharomyces cerevisiae hardly produces spermidine without genetic engineering, and the output is extremely low, close to zero. The genetically engineered bacteria of saccharomyces cerevisiae of the present invention can greatly increase the output of spermidine. When the exogenous pathway is introduced, the concentration of spermidine reaches 5.8 g / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the method for synthesizing spermidine in the present invention. DETAILED DESCRIPTION

[0031] 1. Strains and plasmids involved in the present invention

[0032] The pEC-XK99E shuttle plasmid purchased from Novagen, and the CRISPR-Cas9 plasmids preserved in our laboratory, Escherichia coli JM109, Saccharomyces cerevisiae S288C, Saccharomyces cerevisiae YJM693, Saccharomyces cerevisiae SGU90, Saccharomyces cerevisiae YJM453, Saccharomyces cerevisiae VL3.

[0033] 2. Culture medium and fermentation conditions

[0034] Culture medium:

[0035] LB medium: peptone 10g / L, yeast powder 5g / L, NaCl 10g / L, pH = 7.4. Add 20g / L agar to the solid medium. When screening E. coli DH5α transformants, add 100μg / mL ampicillin to the medium;

[0036] YPD medium: peptone 20g / L, yeast powder 10g / L, glucose 20g / L, solid medium plus 20g / L agar;

[0037] Yeast culture basic medium (Delft medium): glucose 20g / L, ammonium sulfate 5g / L, potassium dihydrogen phosphate 14.4g / L, magnesium sulfate heptahydrate 0.5g / L, trace element complex solution 1mL / L, vitamin complex 2mL / L. Antifoam 204 should be added at 0.4% (V / V) during fermentation in the fermenter.

[0038] Culture conditions:

[0039] Seed culture: inoculate the cultured fresh slant seeds into a culture tube containing 2 mL of seed culture medium, culture at a shaker speed of 200 r / min, a temperature of 30°C, and a culture time of 24 h.

[0040] Shake flask fermentation: The fermentation medium was filled with 20 mL of liquid and the starting OD 600 The inoculation rate was 0.05, the temperature was 30°C, the rotation speed was 200r / min, the fermentation time was 72h, and samples were taken regularly for detection and analysis.

[0041] Fermentation tank culture: according to the starting OD 600 0.05 The seed culture medium was connected to a 1L fully automatic fermentation tank, and 0.3L of fermentation medium was placed in the tank. The stirring speed was 600r / min, the ventilation volume was 1.0vvm, the temperature was 30℃, the pH value and dissolved oxygen were detected online using a pH electrode and a dissolved oxygen electrode, and 2mol / NaOH solution was added through an automatic feeding pump to maintain the pH at 5.5. Sampling was taken regularly for detection and analysis.

[0042] 3. Molecular Biology Operations

[0043] E. coli plasmid extraction

[0044] Pick a single colony of E. coli into LB medium, add ampicillin to a final concentration of 100 μg / mL, and culture overnight in a constant temperature shaker at 37°C. Collect the cells by centrifugation for plasmid extraction according to the instructions of the plasmid extraction kit.

[0045] E. coli plasmid transformation

[0046] The preparation of E. coli competent cells adopts the CaCl2 method. The transformation steps are as follows: (1) Take out the competent cells and melt them in an ice bath; (2) Add the DNA to be transformed, mix gently with a wide-mouthed pipette tip, and place on ice for 30 minutes; (3) Place the tube in a circulating water bath preheated to 42°C for 90 seconds. Do not shake the centrifuge tube; (4) Quickly transfer the tube to an ice bath to cool the cells for 1 to 2 minutes; (5) Add 600 μL LB medium to each tube and place it in a 37°C water bath for 1 hour to allow the bacteria to recover and express resistance genes; (6) Spread an appropriate volume of transformed competent cells on an LB plate containing the corresponding antibiotic; (7) Place the plate at 37°C until the liquid is absorbed; (8) Invert the plate, culture at 37°C, and observe the colonies.

[0047] Yeast strain genome extraction

[0048] Pick a single yeast colony into YPD medium and culture it in a constant temperature shaker at 30°C for 20 hours. Collect the bacteria by centrifugation for genome extraction according to the instructions of the yeast genome extraction kit.

[0049] Yeast electroporation

[0050] Transfer a single yeast colony freshly grown on YPD medium to liquid YPD medium and culture overnight at 30°C, 200 rpm. 600 0.05 inoculum was transferred to fresh liquid YPD medium and cultured at 30°C, 200 rpm until OD 600 = 1.2, collect the cells by centrifugation. -1 LiAc, 10 mmol L -1 DTT, 0.6 mol L -1 sorbitol, 10mmol L -1 Tris-HCL, pH = 7.5 buffer treatment 8 × 10 8 Cells. Collect the cells by centrifugation and use 5 mL of pre-cooled 1 mol L -1 The cells were washed three times with 1 mol L sorbitol and -1 Resuspend cells in sorbitol to 10 10 cell mL -1 . Add 1 μg of purified DNA fragments to the cell suspension, incubate on ice for 5 minutes, transfer the mixture to a pre-cooled 0.2 cm electroporation cup, and electroporate. The electroporation conditions are 2.5 KV, 25 μF, 200 Ω, and immediately add 1 mL of pre-cooled 1 mol L - 1 sorbitol, let stand at room temperature for 1 hour, spread 0.2 mL of the electroporated product on the selection plate, and culture at 30°C for 48-96 hours.

[0051] 4. Determination of spermidine content

[0052] Preparation of OPA derivatization reagent: OPA reagent was prepared by Uren method and Karababa (15). 0.20 g of OPA was dissolved in 9.0 mL of methanol, and 1.0 mL of 0.40 M (pH 9.0) borate buffer and 160 μL of 2-mercaptoethanol (reducing agent) were added. OPA reagent was stored at 4°C.

[0053] Spermidine was first derivatized with o-phthalaldehyde (OPA; Sigma, St. Louis, MO). 50 μL of sample and 450 μL of water were added to 400 μL of methanol. After adding 100 μL of OPA reagent, the mixture was filtered through a 0.2-μm filter membrane and 20.0 μL of the filtrate was immediately injected into the HPLC instrument.

[0054] HPLC detection conditions: Spermidine was detected by the method in reference (Qian, ZG, XXXia, and SYLee, Metabolic engineering of Escherichia coli for the production of putrescine: a fourcarbon diamine. Biotechnol Bioeng, 2009. 104 (4): p. 651-662): Luna 5-μm C18 (2) 100A column (250 × 4.6 mm; Phenomenex) operated at 25 ° C and 0.8 mL / min mobile phase was used for all sample separations. The mobile phase consisted of solvent A (55% methanol in 0.1 M sodium acetate, pH 7.2) and solvent B (methanol). The following gradient was applied: 1-6 min, 100% A; 6-10 min, linear gradient of B from 0% to 30%; 10-15 min, linear gradient of B from 30% to 50%; 15-19 min, linear gradient of B from 50% to 100%; 19-23 min, 100% B; 23-25 ​​min, linear gradient of B from 100% to 30%; 25-28 min, linear gradient of B from 30% to 0% (all in vol %).

[0055] 5. Enzyme digestion, ligation, purification, DNA extraction and other operations

[0056] (1) Enzyme digestion reaction system: 10×Q Cut Buffer 5 μL, DNA 20 μL, ddH2O 33 μL, endonuclease-1 1 μL, endonuclease-2 1 μL, mix well, and heat in a 37°C water bath for 0.5 to 1 h.

[0057] (2) Ligation reaction system: 5 μL of Lightning Cloning Enzyme, 1-2 μL of double-enzyme-cut plasmid (10-100 ng), 4-5 μL of homologous target fragment, add ddH2O to 10 μL, mix well, and heat in a 50°C water bath for 30 min.

[0058] (3) PCR amplification of target gene reaction system (50 μL): DNA template 1 μL, 5× PrimeSTAR Buffer 10 μL, dNTP Mixture 4 μL, amplification primer 1 μL, amplification primer 1 μL, PrimeSTAR HSDNA Polymerase 0.5 μL, ddH2O 32.5 μL. PCR amplification program: 30 cycles (98°C 10 s, 55°C 10 s, 72°C 1 kb / min), 72°C 10 min, 4°C storage.

[0059] (4) Colony PCR reaction system: 2×Fastag PCR SuperMix 25μL, upstream primer (concentration 10μM) 1μL, downstream primer (concentration 10μM) 1μL, ddH2O to 50μL, a small amount of colonies or bacterial liquid as template. PCR amplification program: 30 cycles (98℃10s, 55℃10s, 72℃4kb / min), 72℃10min, 4℃ storage.

[0060] Example 1: Introduction of exogenous spermidine synthesis pathway

[0061] The present invention introduces ADC / CAPADH / CAPADC / APAUH pathways from different microbial strains into Saccharomyces cerevisiae for heterologous expression. The arginine decarboxylase encoded by ADC decarboxylates arginine to generate agmatine, and the carboxyaminopropyl agmatine dehydrogenase encoded by CAPADH directly uses aspartate semialdehyde and agmatine as precursors to synthesize carboxyaminopropyl agmatine, and then decarboxylates aminopropyl agmatine under the action of the carboxyaminopropyl agmatine decarboxylase encoded by CAPADC, and finally generates spermidine under the action of the aminopropyl agmatine urea hydrolase encoded by APAUH. First, arginine decarboxylase, carboxyaminopropyl agmatine dehydrogenase, carboxyaminopropyl agmatine decarboxylase and aminopropyl agmatine urea hydrolase from multiple different sources are expressed in Saccharomyces cerevisiae by a gene integration method. The enzyme with the highest catalytic efficiency is further selected, and the best ADC / CAPADH / CAPADC / APAUH pathway is exogenously integrated. The genome integration position selected by the present invention is upstream of the ARG8 gene of Saccharomyces cerevisiae S288C.

[0062] The specific process is as follows:

[0063] The arginine decarboxylase gene speA was cloned from the genome of Escherichia coli BL21 using amplification primers, and its amino acid sequence is numbered QJZ05082.1 on NCBI; the carboxyaminopropylagmatine dehydrogenase genes stcapadh, dacapadh, gscapadh, and iccapadh were cloned from the genomes of Spirochaeta thermophila DSM 6578, Denitrovibrio acetiphilus DSM 12809, Geobactersulfurreducens KN400, and Ilumatobacter coccineus YM16-304 using amplification primers, and their amino acid sequences are accession NOs WP_014623968.1, WP_013011851.1, WP_010943175.1, and WP_015442124.1 on NCBI, respectively; The carboxyaminopropylagmatine decarboxylase genes stcapadc, dacapadc, gscapadc, and iccapadc were cloned from the genomes of Spirochaeta thermophila DSM 6578, Denitrovibrio acetiphilus DSM12809, Geobacter sulfurreducens KN400, and Ilumatobacter coccineus YM16-304, and the amino acid sequences were numbered WP_014623969.1, WP_013011852.1, WP_004513933.1, and WP_015442123.1 in NCBI, respectively; The aminopropylagmatine urea hydrolase genes stapauh, daapauh, lbapauh, and icapauh were cloned from the genome of YM16-304, and the amino acid sequence numbers in NCBI were WP_014623970.1, WP_013011853.1, WP_015770028.1, and WP_015442122.1, respectively. First, the three target genes of arginine decarboxylase, carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase, and aminopropylagmatine urea hydrolase from different strains were connected to the multiple cloning site of the shuttle plasmid pEC-XK99E by homologous recombination.

[0064] CAPADH and CAPADC in the above-mentioned microorganisms are located adjacent to each other in a gene cluster. Using stcapadh-EcoRⅠ-F and stcapadc-SacⅠ-R as primers and the Spirochaeta thermophila DSM 6578 genome as a template, the target fragment stcapadh-stcapadc was amplified. The multiple cloning site of the plasmid pEC-XK99E was treated with double enzymes EcoRⅠ and SacⅠ. After the digestion product was purified, the cut plasmid was connected with the amplified target fragment stcapadh-stcapadc. The connection product pEC-XK99E-stcapadh-stcapadc was transferred into JM109 competent cells, and positive clones were selected on a resistant plate card sodium plate, and colony PCR was further tested. The plasmid pEC-XK99E was digested with double enzymes XmaⅠ and BamHⅠ to treat the multiple cloning site. After the digestion product was purified, the cut plasmid was connected with the amplified target fragment EcspeA. The ligation product pEC-XK99E-EcspeA was transferred into JM109 competent cells, and positive clones were selected on the resistance plate card sodium plate. The colony PCR was further verified. Using stapauh-XbaI-F and stapauh-HindⅢ-R as primers, Spirochaeta thermophila DSM 6578 genome was used as a template to amplify the target fragment stapauh. The multiple cloning site of the plasmid pEC-XK99E-stcapadh-stcapadc was cut with double enzymes XbaI and HindⅢ. After purification, the digestion product was ligated with the amplified target fragment stapauh. The ligation product pEC-XK99E-stcapadh-stcapadc-stapauh was transformed into JM109 competent cells, and the positive clones were selected on the resistance plate card sodium plate, and the correctness was further verified by colony PCR.

[0065] The connection of other genes is similar to the above. The primer sequences used are shown in Table 1:

[0066] Table 1 Primer sequences (SEQ ID NO. 1-6)

[0067]

[0068]

[0069] Since yeast is a eukaryotic organism, independent constitutive promoter sequences were inserted upstream of each gene fragment, namely pADH1, pPGK1, pGAPDH and pTPI. By restriction digestion and ligation, the plasmid pEC-XK99E-pADH1-EcspeA-pPGK1-stcapadh-pGAPDH-stcapadc-pTPI-stapauh was constructed, and the gene fragment pADH1-EcspeA-pPGK1-stcapadh-pGAPDH-stcapadc-pTPI-stapauh was further obtained by restriction digestion. Furthermore, using the Saccharomyces cerevisiae S288C genome as a template, primers ZHhf-F, ZHhf-R, ZHhr-F and ZHhr-R were designed to amplify 1000 bp upstream of the ARG8 gene as the left and right homologous arms, and connected to the upstream and downstream of the pADH1-EcspeA-pPGK1-stcapadh-pGAPDH-stcapadc-pTPI-stapauh gene fragment, respectively, to form hf-pADH1-EcspeA-pPGK1-stcapadh-pGAPDH-stcapadc-pTPI-stapauh-hr as a repair template, which was electroporated into the Saccharomyces cerevisiae S288C competent cell together with the CRISPR-Cas9 plasmid carrying ARG8 upstream-sgRNA (SEQ ID NO.11: TTTCACGCTTTTAAATAGAGCGG). After 48 hours, the corresponding transformants were selected and cultured in the corresponding medium to reach OD 600 After the value is above 0.8, the genome is extracted using a yeast genome extraction kit and sequenced for verification. The ADC / CAPADH / CAPADC / APAUH gene-integrated recombinant bacteria are constructed. The gene integration methods for other strains are the same as above.

[0070] Table 2 Primer sequences (SEQ ID NO.7~10)

[0071] Primer name Sequence 5'-3' SEQ ID ZHhf-F GGATGAAGACTATCAGCTTCTAG No.7 ZHhf-R TTAAGTGAGTCACATAGCGAGCT No.8 ZHhr-F TTCGTTTGTTAGAATAATTCAAGAATCG No.9 ZHhr-R ATCCAAAACATAGTTGCTTACAG No.10

[0072] The obtained recombinant bacteria were fermented and the spermidine concentration in the supernatant was detected by HPLC, as shown in Table 3.

[0073] Table 3

[0074] Recombinant bacteria Spermidine(g / L) S.cerevisiae-ECspeA-stcapadh-stcapadc-stapauh 5.8 S.cerevisiae-ECspeA-iccapadh-iccapadc-icapauh 4.7 S.cerevisiae-ECspeA-dacapadh-dacapadc-daapauh 3.8 S.cerevisiae-ECspeA-gscapadh-gscapadc-lbapauh 5.0 S.cerevisiae-ECspeA-stcapadh-gscapadc-stapauh 3.2 S.cerevisiae-ECspeA-gscapadh-stcapadc-stapauh 4.4 S.cerevisiae-ECspeA-stcapadh-dacapadc-stapauh 3.8 S.cerevisiae-ECspeA-dacapadh-stcapadc-stapauh 5.2

[0075] Among them, S.cerevisiae-ECspeA-stcapadh-stcapadc-stapauh had the best production effect, and the spermidine concentration in the shake flask supernatant was measured to be 5.8 g / L.

[0076] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A genetically engineered yeast strain of Saccharomyces cerevisiae, characterized in that: The engineering bacteria express exogenous arginine decarboxylase, exogenous carboxyaminopropylagmatine dehydrogenase, exogenous carboxyaminopropylagmatine decarboxylase and exogenous aminopropylagmatine urea hydrolase.

2. The genetically engineered yeast of claim 1, characterized in that: The exogenous arginine decarboxylase is from Escherichia coli.

3. The genetically engineered yeast of claim 1, characterized in that: The exogenous carboxyaminopropylagmatine dehydrogenase is from Spirochaeta thermophila or Denitrovibrio acetiphilus or Geobactersulfurreducens or Ilumatobacter coccineus.

4. The genetically engineered yeast of claim 1, characterized in that: The exogenous carboxyaminopropylagmatine decarboxylase is from Spirochaeta thermophila or Denitrovibrio acetiphilus or Geobactersulfurreducens or Ilumatobacter coccineus.

5. The genetically engineered yeast of claim 1, characterized in that: The exogenous aminopropylagmatine urea hydrolase is from Spirochaeta thermophila or Denitrovibrio acetiphilus or Geobactersulfurreducens or Ilumatobacter coccineus.

6. The genetically engineered yeast of claim 1, characterized in that: The amino acid sequence number of the exogenous arginine decarboxylase is QJZ05082.1; the amino acid sequence number of the exogenous carboxyaminopropyl agmatine dehydrogenase is WP_014623968.1; the amino acid sequence number of the exogenous carboxyaminopropyl agmatine decarboxylase is WP_014623969.1; and the amino acid sequence number of the exogenous aminopropyl agmatine urea hydrolase is WP_014623970.

1.

7. The genetically engineered yeast of claim 1, characterized in that: The exogenous arginine decarboxylase, exogenous carboxyaminopropylagmatine dehydrogenase, exogenous carboxyaminopropylagmatine decarboxylase and exogenous aminopropylagmatine urea hydrolase are integrated into the genome of Saccharomyces cerevisiae for expression.

8. The genetically engineered yeast of claim 1, characterized in that: The exogenous arginine decarboxylase, exogenous carboxyaminopropylagmatine dehydrogenase, exogenous carboxyaminopropylagmatine decarboxylase and exogenous aminopropylagmatine ureahydrolase genes correspond to promoters pADH1, pPGK1, pGAPDH and pTPI, respectively.

9. A method for constructing a genetically engineered strain of Saccharomyces cerevisiae that produces spermidine, characterized in that: Includes steps: (1) introducing exogenous arginine decarboxylase, carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase and aminopropylagmatine ureahydrolase genes into plasmid pEC-XK99E; (2) Promoters pADH1, pPGK1, pGAPDH, and pTPI were inserted upstream of the exogenous genes in pEC-XK99E; (3) The plasmid pEC-XK99E was integrated into the Saccharomyces cerevisiae genome through homologous recombination.

10. Use of the genetically engineered yeast Saccharomyces cerevisiae according to any one of claims 1 to 8 in producing spermidine.

Images