Chitinophilic bacteria and uses thereof

Abstract

The invention relates to the technical field of microorganisms, and discloses a chitinophilic bacterium and application thereof. The chitinophilic bacterium provided by the invention is a new species in the genus, can be metabolized to produce metabolites such as beta-glucosidase, siderophore, IAA and the like, and has a very good growth promoting effect on plants.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a chitinophilic bacterium and a use thereof. Background Art

[0002] In the process of modern agricultural production, the unreasonable or excessive application of chemical fertilizers not only causes serious damage to the ecological environment, but also causes agricultural non-point source pollution, which in turn affects the quality and safety of agricultural products, making problems such as excessive chemical residues in agricultural products increasingly prominent. In the field of agricultural governance, biological governance is one of the key ways to deal with the problem of unreasonable and excessive use of chemical fertilizers. Among the many biological governance methods, functional microbial agents are considered to be the most promising means to replace chemical fertilizers at the current stage due to their unique advantages. They are also an important technical means for crop nutrition supply and biological control of crop diseases and pests.

[0003] Microbial fertilizers are third-generation agricultural fertilizers that are natural and pollution-free. Through the metabolic activities of the active microorganisms contained in them, they can decompose organic matter and minerals in the soil and release nutrients needed by plants, thereby providing sufficient nutrition for crops and promoting their growth and development. Microbial fertilizers can improve the utilization rate of chemical fertilizers, reduce the amount of chemical fertilizers used, thereby reducing agricultural production costs and reducing the pollution of chemical fertilizers to the environment.

[0004] However, it has been found in agricultural practice that the effects of microbial fertilizers on different regions and different crops are different. Therefore, in order to meet the production needs of different regions and different agricultural crops, it is still necessary to develop microbial resources and provide strains for microbial fertilizers with better effects according to regional planting characteristics and crop growth needs. Summary of the invention

[0005] The purpose of the present invention is to provide a chitinophilic bacterium and its use. The chitinophilic bacterium provided by the present invention is identified as a new strain of the genus, has good functions of producing β-glucosidase, siderophore, IAA, etc., and can be applied to the rhizosphere soil of crops to effectively promote the growth of crops.

[0006] In order to achieve the above object, the present invention provides a strain of Chitinophaga sp., wherein the deposit number of the Chitinophaga sp. is CGMCC No.1.62395.

[0007] The second aspect of the present invention provides a bacterial agent, which comprises the chitinophilic bacteria described in the first aspect.

[0008] The third aspect of the present invention provides a use of the chitinophilic bacteria described in the first aspect, or the bacterial agent described in the second aspect, wherein the use comprises at least one of the following:

[0009] (1) preparing β-glucosidase;

[0010] (2) preparing siderophores;

[0011] (3) preparing auxin;

[0012] (4) Promote plant growth;

[0013] (5) Prepare microbial fertilizer.

[0014] A fourth aspect of the present invention provides a method for preparing β-glucosidase, the method comprising culturing the chitinophilic bacteria described in the first aspect 1.

[0015] A fifth aspect of the present invention provides a method for preparing an iron carrier, the method comprising culturing the chitinophilic bacteria described in the first aspect.

[0016] A sixth aspect of the present invention provides a method for preparing auxin, the method comprising culturing the chitinophilic bacteria described in the first aspect.

[0017] The seventh aspect of the present invention provides a method for promoting plant growth, the method comprising applying the chitinophilic bacteria or a culture thereof described in the first aspect, or the bacterial agent described in the second aspect, to the rhizosphere soil of the plant.

[0018] The eighth aspect of the present invention provides a microbial fertilizer, which includes the chitinophilic bacteria described in the first aspect, or the bacterial agent described in the second aspect.

[0019] Through the above technical solution, the present invention can at least achieve the following beneficial effects:

[0020] (1) The chitinophilic bacteria provided by the present invention have been identified as a new species in the genus, which provides a basis for the development of new microbial resources and the preparation of microbial fertilizers.

[0021] (2) The chitinophilic bacteria provided by the present invention can produce metabolites such as β-glucosidase, IAA, and siderophore, and can be used to produce fertilizers or agents that promote plant growth.

[0022] (3) The chitinophilic bacteria provided by the present invention can be directly applied to the rhizosphere soil of crops to promote crop growth. The method of use is simple and easy, and the growth-promoting effect is significant. It has the potential to be used as a new type of microbial fertilizer raw material. Moreover, the strain can achieve a good growth-promoting effect without the need for chemical fertilizers, is highly environmentally friendly, and is suitable for large-scale promotion and application.

[0023] Biological Deposit

[0024] The strain YIM B11428 provided by the present invention is classified and named as Chitinophaga sp., and has been deposited in the General Microbiological Center of China Committee for the Preservation of Microorganisms on January 9, 2025, with the address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC NO.1.62395. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Phylogenetic tree of Chitinophilus YIM B11428 drawn using the Neighbor-Joining method.

[0026] Figure 2 (A) Colony morphology of Chitinophilus YIM B11428 on R2A medium; (B) Transmission electron microscopy image.

[0027] Figure 3 This is the result of detecting the production of β-glucosidase by Chitinophilus YIM B11428.

[0028] Figure 4 This is a graph showing the results of siderophore production detection by Chitinophilus YIM B11428.

[0029] Figure 5 This is a qualitative test result of IAA production by Chitinophilus YIM B11428.

[0030] Figure 6 (A) Leaf growth comparison of tomato plants among different groups; (B) Plant height growth comparison; (C) Ground diameter growth comparison.

[0031] Figure 7 This is a graph showing the results of a growth promotion experiment on Chitinophilus YIM B11428. DETAILED DESCRIPTION

[0032] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0033] In the present invention, "YIM B11428" is the number of the chitinophilic bacteria provided by the present invention during the research process, and "CGMCC NO.1.62395" is the deposit number of the strain, both of which refer to the same strain and can be used interchangeably in the present invention, or can also be directly written as "the strain of the present invention". In the present invention, unless otherwise specified, "chitinophilic bacteria" refers to the strain CGMCC NO.1.62395 provided by the present invention.

[0034] Shiro refers to a loose mass structure composed of hyphae of ectomycorrhizal fungi, soil, soil humus and roots in the soil. It is not only the place for hyphae differentiation and nuclear matching, but also an important condition for fungi to form fruiting bodies. Shiro functional microorganisms, as one of the important components of shiro, have extremely high economic and ecological value. The inventors of the present invention have found in long-term research that shiro functional microorganisms are expected to be used for growth promotion cultivation of host plants.

[0035] During the research, the inventor of the present invention accidentally isolated a strain of Chitinophilus from the soil of a fungus pond. After identification, the strain was found to be a new species of Chitinophilus. Further research showed that the strain has good ability to produce metabolites such as β-glucosidase, IAA, and siderophore, and can promote plant growth, and can be used to develop related products such as microbial fertilizers to promote crop growth.

[0036] Based on this, the first aspect of the present invention provides a strain of Chitinophaga sp., the deposit number of which is CGMCC No.1.62395.

[0037] The second aspect of the present invention provides a bacterial agent, which comprises the chitinophilic bacteria described in the first aspect.

[0038] The bacterial agent provided by the present invention can be a liquid bacterial agent or a solid bacterial agent. The present invention has no specific restrictions on the type and method of obtaining the bacterial agent, and any commonly used bacterial agent preparation method and dosage form in the art can be applicable to the present invention. For example, the liquid bacterial agent can be a culture solution obtained by culturing the chitinophilic bacteria provided by the present invention using a liquid culture medium, or a product that is still in a liquid state after the culture solution is concentrated, diluted, etc. For another example, the solid bacterial agent can be a solid (powdered) bacterial agent obtained by drying the above-mentioned liquid bacterial agent (such as freeze drying, etc.).

[0039] According to some preferred embodiments of the present invention, the content of the chitinophilic bacteria in the bacterial agent is not less than 10 7 CFU / g, preferably 10 7 -10 11CFU / g. It should be noted that, in the present invention, CFU / g and CFU / mL can be used interchangeably (i.e., 1CFU / g = 1CFU / mL), wherein CFU / g is usually used to describe the content of viable bacteria in solid inoculants, and CFU / mL is usually used to describe the content of viable bacteria in liquid inoculants, which can be converted according to the volume-to-mass ratio of 1mL liquid inoculant = 1g.

[0040] As used in the art, the term “10 7 CFU / g” means that 1g of bacterial agent contains 10 7 The effective viable bacteria count at the CFU level is "10 7 "CFU level" means that the number of effective live bacteria in 1g of bacterial agent reaches 10 7 CFU level. The number of effective live bacteria in 1g of bacterial agent is 1×10 7 CFU, 5×10 7 CFU, 9.9×10 7 CFU, etc. are all "10 7 CFU level". That is, in the bacterial agent of the present invention, the content of the chitinophilic bacteria can be greater than or equal to 1×10 7 CFU / g to less than 1×10 12 CFU / g.

[0041] For example, in the bacterial agent, the content of the chitinophilic bacteria can be 1×10 7 CFU / g, 2×10 7 CFU / g, 3×10 7 CFU / g, 4×10 7 CFU / g, 5×10 7 CFU / g, 6×10 7 CFU / g, 7×10 7 CFU / g, 8×10 7 CFU / g, 9×10 7 CFU / g, 1×10 8 CFU / g, 2×10 8 CFU / g, 3×10 8 CFU / g, 4×10 8 CFU / g, 5×10 8 CFU / g, 6×10 8 CFU / g, 7×10 8 CFU / g, 8×10 8 CFU / g, 9×10 8 CFU / g, 1×10 9 CFU / g, 2×10 9 CFU / g, 3×10 9 CFU / g, 4×109 CFU / g, 5×10 9 CFU / g, 6×10 9 CFU / g, 7×10 9 CFU / g, 8×10 9 CFU / g, 9×10 9 CFU / g, 1×10 10 CFU / g, 2×10 10 CFU / g, 3×10 10 CFU / g, 4×10 10 CFU / g, 5×10 10 CFU / g, 6×10 10 CFU / g, 7×10 10 CFU / g, 8×10 10 CFU / g, 9×10 10 CFU / g, 1×10 11 CFU / g, 2×10 11 CFU / g, 3×10 11 CFU / g, 4×10 11 CFU / g, 5×10 11 CFU / g, 6×10 11 CFU / g, 7×10 11 CFU / g, 8×10 11 CFU / g, 9×10 11 CFU / g, 9.5×10 11 CFU / g, 9.9×10 11 CFU / g, or it can be a range consisting of any two of the above values, or any intermediate value in the range.

[0042] The third aspect of the present invention provides a use of the chitinophilic bacteria described in the first aspect, or the bacterial agent described in the second aspect, wherein the use comprises at least one of the following:

[0043] (1) preparing β-glucosidase;

[0044] (2) preparing siderophores;

[0045] (3) preparing auxin;

[0046] (4) Promote plant growth;

[0047] (5) Prepare microbial fertilizer.

[0048] β-Glucosidase belongs to the cellulase class and is an important component of the cellulose decomposition enzyme system. β-Glucosidase participates in the metabolic process of plant cell walls, helps the reconstruction and renewal of plant cell walls, and supports the growth and development of plants; β-Glucosidase can hydrolyze non-reducing terminal sugars and activate plant hormones such as indoleacetic acid (IAA), jasmonic acid (JA) and salicylic acid (SA), and participates in regulating the growth of plant stems, leaves and roots, differentiation of vascular tissues, fertility, seed germination and other aspects, and plays a key role in the growth and development of plants.

[0049] Siderophore is a low molecular weight compound that chelates iron and is used to absorb iron. Through the action of siderophore, iron elements that cannot be directly utilized by plants in the form of oxides in nature can be converted into a form that can be directly utilized by plants, thereby promoting the absorption of iron by plants and further promoting the growth and development of plants.

[0050] Auxin is a general term for a class of plant hormones. Its chemical nature is indoleacetic acid or its analogues or derivatives. Low concentrations promote plant growth, while high concentrations inhibit plant growth. It participates in physiological processes such as plant growth and development, flowering, and fruit ripening.

[0051] The strain provided by the present invention can efficiently synthesize β-glucosidase, siderophore and auxin during the metabolic process, and thus can be used in the preparation and production of the above substances. The β-glucosidase, siderophore and auxin produced by the strain provided by the present invention can be applied to plants and used as biological fertilizers or plant nutrients.

[0052] In the present invention, the above-mentioned use (4) refers to the process of using the strain provided by the invention or its culture, metabolites and other substances produced by the strain to act on plants, thereby accelerating their growth and development, increasing their yield or improving their product quality.

[0053] As mentioned above, the strains provided by the present invention can produce a variety of substances that promote plant growth and development, so any plant whose growth and development are promoted after being acted upon by these substances can be suitable for the use of the present invention (4). According to some preferred embodiments of the present invention, the plant is selected from the Solanaceae family.

[0054] According to a particularly preferred embodiment of the present invention, the plant is tomato.

[0055] The strain provided by the present invention can be directly applied to plants and play a role in promoting plant growth, etc., so the strain of the present invention can be used to prepare microbial fertilizer.

[0056] In the present invention, the above-mentioned use (5) includes directly preparing the strain of the present invention into a bacterial agent for use as a microbial fertilizer, and may also include mixing the strain of the present invention with other fertilizer raw materials or further processing to obtain a microbial fertilizer containing (having activity) the strain.

[0057] According to some preferred embodiments of the present invention, use (5) may include preparing a bacterial agent from the chitinophilic bacteria YIMB11428, which is the microbial fertilizer. The characteristics of the bacterial agent are as described above and will not be repeated here.

[0058] A fourth aspect of the present invention provides a method for preparing β-glucosidase, the method comprising culturing the chitinophilic bacteria described in the first aspect.

[0059] A fifth aspect of the present invention provides a method for preparing an iron carrier, the method comprising culturing the chitinophilic bacteria described in the first aspect.

[0060] A sixth aspect of the present invention provides a method for preparing auxin, the method comprising culturing the chitinophilic bacteria described in the first aspect.

[0061] In the present invention, in the above-mentioned method for preparing β-glucosidase, siderophore and auxin, the same method can be used to culture the chitinophilic bacteria YIM B11428, or different methods can be used to culture the chitinophilic bacteria YIM B11428 (for example, the culture method can be optimized according to the production conditions of different metabolites to increase the yield of the target product, etc.).

[0062] According to some preferred embodiments of the present invention, the culture conditions include: a culture temperature of 25-35° C. For example, it can be 25° C., 26° C., 27° C., 28° C., 29° C., 30° C., 31° C., 32° C., 33° C., 34° C., 35° C., or a range consisting of any two of the above values, or any intermediate value in the range.

[0063] Preferably, when preparing β-glucosidase, siderophore and auxin, different culture media can be used to increase the yield of the target metabolite. Those skilled in the art can select a suitable culture medium for the production of the target metabolite according to the prior art, which will not be described in detail here.

[0064] The seventh aspect of the present invention provides a method for promoting plant growth, the method comprising applying the chitinophilic bacteria or a culture thereof described in the first aspect, or the bacterial agent described in the second aspect, to the rhizosphere soil of the plant.

[0065] According to some preferred embodiments of the present invention, the culture of Chitinophila refers to a culture product obtained by culturing Chitinophila YIM B11428, which may be a culture solution (comprising Chitinophila YIM B11428 and metabolites), or a product obtained by treating the culture solution (for example, filtering to obtain a culture solution containing only metabolites, or further purifying to obtain one or more desired metabolites).

[0066] Preferably, the culture comprises at least one of Chitinophilus YIM B11428, β-glucosidase, siderophore and auxin.

[0067] According to some preferred embodiments of the present invention, the amount of chitinophilic bacteria or the culture thereof applied is such that the effective viable count of chitinophilic bacteria is not less than 10 7 CFU / strain / time.

[0068] Preferably, the amount of chitinophilus or its culture applied is such that the effective viable count of chitinophilus is 10 7 -10 13 CFU / strain / time, preferably 10 9 -10 11 CFU / strain / time. For example, it can be 1×10 9 CFU / g, 2×10 9 CFU / g, 3×10 9 CFU / g, 4×10 9 CFU / g, 5×10 9 CFU / g, 6×10 9 CFU / g, 7×10 9 CFU / g, 8×10 9 CFU / g, 9×10 9 CFU / g, 1×10 10 CFU / g, 2×10 10 CFU / g, 3×10 10 CFU / g, 4×10 10 CFU / g, 5×10 10 CFU / g, 6×10 10 CFU / g, 7×10 10 CFU / g, 8×10 10 CFU / g, 9×10 10 CFU / g, 1×10 11 CFU / g, 2×10 11 CFU / g, 3×10 11 CFU / g, 4×10 11CFU / g, 5×10 11 CFU / g, 6×10 11 CFU / g, 7×10 11 CFU / g, 8×10 11 CFU / g, 9×10 11 CFU / g, 9.5×10 11 CFU / g, 9.9×10 11 CFU / g, or it can be a range consisting of any two of the above values, or any intermediate value in the range.

[0069] According to some preferred embodiments of the present invention, the amount of the bacterial agent applied is such that the effective viable count of Chitinophilus bacteria is not less than 10 7 CFU / strain / time.

[0070] Preferably, the amount of the bacterial agent applied is such that the effective viable count of Chitinophilus is 10 7 -10 13 CFU / strain / time, preferably 10 9 -10 11 CFU / strain / time. For example, it can be 1×10 9 CFU / g, 2×10 9 CFU / g, 3×10 9 CFU / g, 4×10 9 CFU / g, 5×10 9 CFU / g, 6×10 9 CFU / g, 7×10 9 CFU / g, 8×10 9 CFU / g, 9×10 9 CFU / g, 1×10 10 CFU / g, 2×10 10 CFU / g, 3×10 10 CFU / g, 4×10 10 CFU / g, 5×10 10 CFU / g, 6×10 10 CFU / g, 7×10 10 CFU / g, 8×10 10 CFU / g, 9×10 10 CFU / g, 1×10 11 CFU / g, 2×10 11 CFU / g, 3×10 11 CFU / g, 4×10 11 CFU / g, 5×10 11 CFU / g, 6×10 11 CFU / g, 7×1011 CFU / g, 8×10 11 CFU / g, 9×10 11 CFU / g, 9.5×10 11 CFU / g, 9.9×10 11 CFU / g, or it can be a range consisting of any two of the above values, or any intermediate value in the range.

[0071] Preferably, the plant is a plant of the Solanaceae family, preferably a tomato.

[0072] According to some preferred embodiments of the present invention, the chitinophilic bacteria or its culture, or the microbial agent can be applied 1-3 times per crop. A crop refers to the planting cycle of a plant from planting to harvesting, and the planting cycles of different crops are different. Those skilled in the art can judge the timing of applying the chitinophilic bacteria or its culture or microbial agent of the present invention to different crops based on the growth characteristics and growth conditions of the crops themselves, combined with the application frequency provided by the present invention. Since the chitinophilic bacteria of the present invention can promote the growth of roots and leaves, and also promote flowering when applied to crop seedlings, in order to obtain better planting effects, shorten the planting cycle, and increase crop yield and agricultural product quality, it is preferably applied at least once during the crop seedling stage.

[0073] An eighth aspect of the present invention provides a microbial fertilizer, which includes the chitinophilic bacteria described in the first aspect, or the bacterial agent described in the second aspect.

[0074] According to a preferred embodiment of the present invention, the microbial fertilizer may further include auxiliary materials. The auxiliary materials refer to other materials used in the art for preparing fertilizers, especially microbial fertilizers, except for active components (i.e., active microorganisms), such as culture media, diluents, buffers (such as phosphate buffer, sodium bicarbonate, magnesium oxide), excipients (such as cassava starch, sorbitol), protective agents (such as carbohydrate protective agents, sodium glutamate, calcium chloride), etc., used for culturing microorganisms or protecting microbial activity.

[0075] The present invention will be described in detail below by way of examples. It should be understood that the following examples are only used to further explain and illustrate the content of the present invention by way of example, and are not intended to limit the present invention.

[0076] In the following examples, unless otherwise specified, the reagents and materials used were all commercial products purchased from regular biological or chemical suppliers, and the purity of the reagents was analytical grade.

[0077] Example 1

[0078] This example is used to illustrate the acquisition, identification and preservation of Chitinophilus YIM B11428.

[0079] (I) Acquisition of strains

[0080] In the Ganba mushroom conservation area in Wuding County, Chuxiong Yi Autonomous Prefecture, Yunnan Province, China, after removing plant litter such as fallen branches and leaves on the surface within 20 cm in diameter of the Ganba mushroom pond, soil samples were collected from the pond about 5 cm deep from the surface.

[0081] The preparation method of the culture medium used in operations such as strain isolation and purification is as follows:

[0082] BG11 medium, photosynthetic bacteria medium and plate count broth medium (PCB medium) were mixed at a weight ratio of 1:1:1, 20 g / L agar was added and sterilized at 121°C for 20 min. BG11 medium, photosynthetic bacteria medium and PCB medium were purchased from Haibo Biotechnology Co., Ltd. (product numbers are HB8793, HB8882 and HB8756 respectively).

[0083] 2 g of soil sample was taken from the soil of the fungus pond by the dilution spread plate method and the plate streak method. It was placed in a 300 mL conical flask filled with 198 mL of sterile water. An appropriate amount of glass beads was added. The culture was shaken at 30 °C and 140 r / min for 4-6 h. 200 μL of the solution was taken and 10 -4 and 10 -5 The concentration was diluted and plated on the above culture medium, and cultured in a 30°C constant temperature incubator for 3-5 days. Single colonies with different morphological characteristics were picked, purified and numbered.

[0084] A bacterial strain was obtained from the soil sample of the fungus pond through the above steps and was named Chitinophilus YIMB11428.

[0085] (II) Identification of strains

[0086] 1. Molecular Biology Identification

[0087] The total DNA of strain YIM B11428 was obtained by the Chelex-100 rapid extraction method as a template, and 27F (5'-AGAGTTTGATCCTGGCTCAG-3', SEQ ID NO: 1) and 1492R (5'-TACGACTTAACCCCAATCGC-3', SEQ ID NO: 2) were used as primers, and the reaction system and conditions in Table 1 were used to amplify the 16S rRNA gene.

[0088] Table 1

[0089]

[0090] The amplified product was purified by 1% agarose gel electrophoresis (gel recovery and purification kit produced by Guangzhou Meiji Biotechnology Co., Ltd.) and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing result is shown in SEQ ID NO: 3:

[0091] GTAGCAATACTGGGTGGCGACCGGCAAACGGGTGCGGAACACGTACGCAACCTTCCTTGAAGC

[0092] GGGGGATAGCCCGAAGAAATTCGGATTAATACCCCGTAGTATGGTGGAGAGGCATCTTTCTAT

[0093] CATTAAAGCTCCGGCACTTTAAGATGGGCGTGCGTCTGATTAGGTAGTTGGTGAGGTAACGGCT

[0094] CACCAAGCCGACGATCAGTAACTGGCGTGAGAGCGCGACCAGTCACACGGGCACTGAGACACG

[0095] GGCCCGACTCCTACGGGAGGCAGCAGTAAGGAATATTGGTCAATGGACGCAAGTCTGAACCAG

[0096] CCATGCCGCGTGGAGGATGAAGGTCCTCTGGATTGTAAACTTCTTTTATTTGGGAAGAAATGTG

[0097] GGTTTTCTAACTCATTTGACGGTACCAGATGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCG

[0098] CGGTAATACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGCGGAT

[0099] CTGTAAGTCAGTGGTGAAATCTCCGAGCTTAACTCGGAAACTGCCGTTGATACTATAGATCTTG

[0100] AATGTTGTGGAGGTTAGCGGAATATGTCATGTAGCGGTGAAATGCATAGATATGACATAGAAC

[0101] ACCAATTGCGAAGGCAGCTGGCTACACAAATATTGACGCTGAGGCACGAAAGCGTGGGGATCA

[0102] AACAGGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGGATACTCGACATTTGCGATATAC

[0103] AGTAAGTGTCTGAGCGAAAGCATTAAGTATCCCACCTGGGAAGTACGACCGCAAGGTTGAAAC

[0104] TCAAAGGAATTGACGGGGGTCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGATACGCG

[0105] AGGAACCTTAACCTGGGCTAGAATGCTGGGGACTATGGGTGAAAGCTCATATTGTAGCAATAC

[0106] ACCGCCAGTAAGGTGCTGCATGGCTGTCGTCAGCTCGTGCCGTGAGGTGTTGGGTTAAGTCCCG

[0107] CAACGAGCGCAACCCCTATCTTTAGTTGCCAACAGGTTAAAGCTGGGAACTCTAAAGAAACTGC

[0108] CGTCGTAAGACGCGAGGAAGGAGGGATGATGTCAAGTCATCATGGCCTTTATGCCCAGGGCT

[0109] ACACACGTGCTACAATGGTAGGAACAAAGGGCTGCTACCTGGTAACAGGATGCTAATCTCAAA

[0110] AATCCTATCTCAGTTCGGATTGAGGGCTGCAACTCGCCCTCATGAAGCTGGAATCGCTAGTAAT

[0111] CGTATATCAGCAATGATACGGTGAATACGTTCCCGGACCTTGTACACACCGCCCGTCAAGCCATGAA(SEQ ID NO:3)

[0112] The sequencing results were compared with the EzBioCloud online platform (https: / / www.ezbiocloud.net / ) for analysis and preliminary identification of the strains. Afterwards, the 16S rRNA sequence of the model strain with high homology was selected as the reference comparison object in the LPSN platform (https: / / www.bacterio.net / List of Prokaryoticnames with Standing in Nomenclature), and the Mega 7.0 software was used for multiple sequence alignment to calculate the similarity between the test strain and the reference strain sequence; the neighbor joining method (Neighbor Joining analysis) was used to continue using the MEGA 7.0 software to exclude base deletion sites and construct a phylogenetic tree between the test strain and the reference strain; the Bootstrap value was set to 1000, and the rest were default values.

[0113] Figure 1 The phylogenetic tree of Chitinophila YIM B11428 drawn based on the neighbor-joining method is shown, from which it can be seen that Chitinophila YIM B11428 has the highest homology with Chitinophaga parva LY 1, but the homology rate is 97.52%, which is lower than 98.7%. According to the minimum standard proposed by Jongsik Chun for the use of genomic data for prokaryotic classification published in 2018, strain YIM B11428 can be judged as a new species of Chitinophila.

[0114] The whole genome sequencing results of strain YIM B11428 showed that the ANI value of it and its closest relative, Chitinophagaparva LY 1, was 81.81%, which was lower than the critical value of 95-96% recommended by the ANI standard. At the same time, the dDDH value was 32.77%, which was also lower than the standard value of 70%, and the G+C content was 52.36%, which was consistent with the range of the Chitinophaga genus. The strain YIM B11428 was judged to be a new species of the genus Chitinophaga.

[0115] 2. Identification of morphological and physiological and biochemical characteristics

[0116] Physiological and biochemical tests and colony morphological characteristics of Chitinophilus YIMB11428 were performed with reference to the Bergey's Manual of Bacterial Identification and the Manual of Systematic Identification of Common Bacteria.

[0117] Colony and cell morphology: On R2A medium, the colonies are orange-yellow, approximately round, with smooth edges and a shiny surface. The middle of the colony is slightly convex and moist and opaque (see Figure 2, A); In addition to R2A medium, strain YIM B11428 also grows in NA and LB medium, but cannot grow in TSB medium; under transmission electron microscopy, the cells are rod-shaped (about 500nm in diameter) without flagella and spores (such as Figure 2 ,B).

[0118] Physiological and biochemical characteristics: The strain was identified as a Gram-negative bacterium by Gram staining experiment; it was found to be non-motile by observation on semi-solid agar medium; the temperature tolerance range was 0-40°C, the pH tolerance range was 6.0-10.0, and the salt tolerance range was 0-1.5% (w / v); it had certain acid and alkali resistance and salt resistance. Catalase was negative, oxidase was positive, and it was strictly aerobic. The phenotypic characteristics of the strain were further compared with those of the reference standard strain Chitinophaga parva LY 1, and the results are shown in Table 2 below.

[0119] Table 2

[0120]

[0121] * In Table 2, “+” indicates positive, “-” indicates negative, and “w” indicates weakly positive.

[0122] According to the comparison results, both strains tested have the ability of D-glucose fermentation, D-mannose assimilation, N-acetylglucosamine assimilation, D-maltose assimilation, cystine arylamine enzyme, chymosin and α-glucosidase; however, there are obvious differences in the utilization of nitro-β-D-methylgalactose between the two strains. YIM B11428 cannot utilize this substance and does not have β-galactosidase. The more obvious difference in enzyme activity between the two is that Chitinophaga parva LY 1 does not have trypsin but has esterase (C4) and β-uronidase activity, while strain YIM B11428 is just the opposite.

[0123] Combined with the molecular biological test results of strain YIM B11428 and the bacterial morphology and physiological and biochemical characteristics test results, the strain was identified as a new species of the genus Chitinophaga and named Chitinophagasp.

[0124] 3. Preservation of strains

[0125] The chitinophilus YIM B11428 isolated above was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on January 9, 2025, with the deposit number CGMCC NO.1.62395, and the address of the depository is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0126] Example 2

[0127] This example is used to illustrate the effects of Chitinophilus YIM B11428 in producing β-glucosidase, siderophore and IAA.

[0128] (I) β-glucosidase

[0129] Esculin culture medium (g / L): peptone 5; potassium dihydrogen phosphate 1; ferric citrate 0.5; esculin 3; agar 2; pH adjusted to 7.3±0.1.

[0130] Chitinophilus YIM B11428 was inoculated on aesculin plate and slant medium by the streak method and the three-point method, respectively, and cultured in a 30°C constant temperature incubator. During the culture period, the color of the culture medium was observed every day for changes. If the color of the culture medium turned black, it indicated that the strain could hydrolyze aesculin and produce β-glucosidase, which was a positive result; otherwise, it was a negative result.

[0131] Figure 3 The figure shows the color changes of the plate and slant culture medium on the third day of culture. It can be seen that the color of the culture medium becomes darker and the color of the colony position is black, indicating that the strain has a good ability to produce β-glucosidase.

[0132] (ii) Siderophore

[0133] CAS detection medium (purchased from Qingdao Haibo Biotechnology Co., Ltd.) was used to detect the iron carrier production capacity.

[0134] Chitinophilus YIM B11428 was inoculated on CAS solid culture medium by four-point inoculation method and cultured in a constant temperature incubator at 30℃ for about 10 days. The size of the orange-yellow halo was observed, and the ratio of the halo diameter (D) to the colony diameter (d) was recorded.

[0135] Figure 4 The halo on the CAS medium is shown, which shows that Chitinophilus YIM B11428 can produce siderophores. After calculation, the ratio of halo to colony diameter D / d is about 1.2 / 0.4, indicating that the strain has a good ability to produce siderophores.

[0136] (III) IAA

[0137] KB medium: peptone 20 g / L; glycerol 15 ml / L, K2HPO4 1.5 g / L; MgSO4·7H2O 1.5 g / L; tryptophan 0.1 g / L; pH 7.2±0.2.

[0138] Sackowcki's color developer: Slowly add 150 mL of concentrated sulfuric acid into 250 mL of deionized water while stirring. After the solution cools, add 7.5 mL of 0.5 mol / L FeCl3·6H2O solution.

[0139] A single colony of ammoniaphilic bacteria YIM B11428 was selected and inoculated into KB medium. The culture was shaken at 180 rpm at 30°C for 48 h. 1 mL of the fermentation liquid was aseptically pipetted into a centrifuge tube and quickly mixed with 4 mL of Sackowcki's colorimetric reagent. The tube was incubated at room temperature and away from light for 40 min to develop color. The color change was observed and recorded. If pink appeared, it was positive, indicating that the strain could secrete IAA.

[0140] 1 mL of KB medium was mixed with 4 mL of Sackowcki's colorimetric reagent and treated in the same manner as the control (CK). The control and fermentation liquid were dropped onto a white ceramic plate for color development. The results are shown in Figure 5 ,It can be seen that the culture fluid of YIMB11428 is obviously pink, indicating that the strain has a good ability to secrete IAA.

[0141] Example 3

[0142] This example is used to illustrate the growth-promoting effect of Chitinophilus YIM B11428 on tomatoes.

[0143] 1. Bacterial agent

[0144] YIM B11428 was inoculated into 300 mL of NB medium (purchased from Qingdao Haibo Biotechnology Co., Ltd.) and cultured at 30°C with shaking at 180 rpm for 72 h to obtain a viable bacterial count of about 1×10 9 The culture solution or its dilution (diluted with sterile NB medium) is used as a liquid inoculant for subsequent growth promotion experiments.

[0145] 2. Experimental plants

[0146] The same weight of soil was added to the pots, and 3 pots were randomly grouped for each treatment. Tomato seedlings with similar growth characteristics were selected and planted at 3 plants per pot.

[0147] 3. Experimental treatment

[0148] Different treatment reagents (same dosage in each group) were used to irrigate the roots of tomato seedlings, and the growth of tomato seedlings in each group was observed. The treatment reagents in each group are as follows:

[0149] Control group:

[0150] CK1: sterile NB liquid medium;

[0151] CK2: sterile water;

[0152] Experimental Group:

[0153] T1: Liquid inoculant, YIM B11428 content is 1×10 9 CFU / mL;

[0154] T2: Liquid inoculant, YIM B11428 content 1×10 8 CFU / mL;

[0155] T3: Liquid inoculant, YIM B11428 content 1×10 7 CFU / mL.

[0156] On the 7th day after the tomato seedlings were transplanted into the pots, the roots of the tomato seedlings were irrigated with 100 mL / plant of the treatment reagent, and then the treated tomato seedlings were placed in a greenhouse for growth, and the soil was kept sufficiently moist during the period. The number of leaves, ground diameter, and plant height of the tomato plants were measured every week for 4 weeks; in addition to measuring the above parameters in the 4th week, the tomato plants were carefully dug out, the soil attached to the roots was washed, and the root length of the tomato plants was measured. The measurement method is as follows:

[0157] Number of leaves: Count the leaves that are differentiated and in normal condition, excluding fallen or withered leaves.

[0158] Plant height: Use a ruler to measure the height from the top of each tomato plant to the surface of the soil in the pot. The mean value ± standard deviation of the data is the plant height of the tomato plant.

[0159] Ground diameter: Use a vernier caliper to measure the diameter of each tomato stem at about 1±0.2 cm from the soil surface of the flowerpot. The average value±standard deviation of each data is the ground diameter of the tomato plants in this group.

[0160] Root length: Dig out the underground part of each tomato plant, clean it, and measure the distance from the root end to the top of the root tip with a ruler. The mean value ± standard deviation of each group of data is the root length of the tomato plants in that group.

[0161] 4. Measurement results

[0162] Tables 3 and 4 show the measurement results of the 3rd and 4th weeks, respectively (Note: in Tables 3 and 4, different superscript letters indicate significant differences (P<0.05), and the data in the tables are mean ± standard error).

[0163] Table 3

[0164] parameter CK1 CK2 T1 T2 T3 Number of blades <![CDATA[50.50±0.50 bc ]]> <![CDATA[48.67±3.00 c ]]> <![CDATA[57.84±2.84 ab ]]> <![CDATA[60.09±1.42 a ]]> <![CDATA[47.34±1.67 c <!-- 10 -->]]> Plant height (cm) <![CDATA[12.25±0.75 ab ]]> <![CDATA[11.09±1.09 b ]]> <![CDATA[14.34±0.17 a ]]> <![CDATA[14.50±1.50 a ]]> <![CDATA[14.04±0.21 a ]]> Ground diameter (mm) <![CDATA[3.99±0.04 b ]]> <![CDATA[4.51±0.12 ab ]]> <![CDATA[4.79±0.28 a ]]> <![CDATA[4.53±0.24 ab ]]> <![CDATA[4.25±0.05 ab ]]>

[0165] Table 4

[0166] parameter CK1 CK2 T1 T2 T3 Number of blades <![CDATA[53.84±1.17 bc ]]> <![CDATA[50.67±1.67 c ]]> <![CDATA[65.84±4.17 a ]]> <![CDATA[66.17±2.84 a ]]> <![CDATA[61.33±3.00 ab ]]> Plant height (cm) <![CDATA[15.25±1.58 a ]]> <![CDATA[12.67±1.17 a ]]> <![CDATA[15.67±0.84 a ]]> <![CDATA[15.59±0.59 a ]]> <![CDATA[17.09±1.42 a ]]> Ground diameter (mm) <![CDATA[4.54±0.33 a ]]> <![CDATA[4.78±0.03 a ]]> <![CDATA[5.01±0.20 a ]]> <![CDATA[4.87±0.20 a ]]> <![CDATA[4.62±0.13 a ]]> Root length (cm) <![CDATA[28.35±1.90 a ]]> <![CDATA[19.50±0.75 a ]]> <![CDATA[29.82±3.74 a ]]> <![CDATA[28.66±4.13 a ]]> <![CDATA[31.08±4.76 a ]]>

[0167] After calculation, in the third week of tomato growth after root irrigation, the mean number of leaves in the T2 group was significantly higher than that in the CK1 group by 19% and the CK2 group by 23%; the mean ground diameter in the T1 group was significantly higher than that in the CK1 group by 20%; in addition, the mean plant heights of the experimental groups were both greater than those in the CK1 group and also significantly greater than those in the CK2 group, with the T1 and T2 treatment groups being better, 17% and 18% higher than those in the CK1 group, and significantly higher than those in the CK2 group by 29% and 31%. In the fourth week of tomato growth after root irrigation, the mean number of leaves, plant height, ground diameter, and root length in the T1 and T2 groups were greater than those in the control group; the number of leaves in the T2 group was significantly higher than that in the CK1 group by 23% and the CK2 group by 31%, the plant height in the T3 group was 12% higher than that in the CK1 group, and the ground diameter in the T1 group was 10% higher than that in the CK1 group.

[0168] Figure 6 The figure shows the comparison of the measurement results of the number of leaves added (A), plant height growth (B) and ground diameter growth (C) at the end of growth of tomato plants in the control group CK1, CK2 and the experimental group T1, T2, T3. Figure 6 As can be seen in (A), the number of leaves added in the T2 group and the control group was significantly different, which was significantly higher than that in the CK1 group by 1.65 times and the CK2 group by 2.63 times, respectively. Meanwhile, the number of leaves added in the T1 and T3 groups was also significantly higher than that in the CK2 group. Figure 6 (B and C) It can be seen that the plant height growth and ground diameter growth of the T2 group were higher than those of the control group. The plant height growth was 1.14 times higher than that of the CK1 group and 2.3 times higher than that of the CK2 group, and the ground diameter growth was 3.09 times higher than that of the CK1 group and 1.89 times higher than that of the CK2 group.

[0169] Figure 7 From left to right, the comparison results of tomato plants in groups CK2, CK1, T1, T2 and T3 are shown. It can be seen that the root length, leaf number and root density of the experimental group are better than those of the control group, and the plant growth of the experimental group is generally good; the experimental group flowered earlier than the CK2 group, and the number of flowers in the T2 group was relatively large.

[0170] From the above results, it can be seen that after YIM B11428 was applied to the rhizosphere soil, it had a good growth-promoting effect on the leaves, root length, plant height, and ground diameter of tomato seedlings, especially on tomato leaves. This has a certain positive effect on the photosynthesis and accumulation of sugar and water in tomato plants, and can improve the quality of tomato fruits. In addition, this is the first time that chitinophilic bacteria have been found to have a growth-promoting effect on Solanaceae plants.

[0171] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A Chitinophaga sp., characterized in that: The deposit number of the chitinophilus bacteria is CGMCC No.1.62395.

2. A bacterial agent, characterized in that The bacterial agent comprises the chitinophilic bacteria according to claim 1.

3. The bacterial agent according to claim 2, wherein In the bacterial agent, the content of the chitinophilic bacteria is not less than 10 7 CFU / g, preferably 10 7 -10 11 CFU / g.

4. The use of the chitinophilic bacteria according to claim 1, or the bacterial agent according to claim 2 or 3, characterized in that: The use includes at least one of the following: (1) preparing β-glucosidase; (2) preparing siderophores; (3) preparing auxin; (4) Promote plant growth; (5) Prepare microbial fertilizer.

5. The use according to claim 4, wherein The plant is selected from the Solanaceae family, preferably tomato.

6. A method for preparing β-glucosidase, characterized in that: The method comprises culturing the chitinophilic bacteria according to claim 1.

7. A method for preparing siderophore, characterized in that: The method comprises culturing the chitinophilic bacteria according to claim 1.

8. A method for preparing auxin, characterized in that: The method comprises culturing the chitinophilic bacteria according to claim 1.

9. A method for promoting plant growth, characterized in that: The method comprises applying the chitinophilic bacteria or a culture thereof according to claim 1, or the bacterial agent according to claim 2 or 3, to the rhizosphere soil of the plant.

10. A microbial fertilizer, characterized in that: The microbial fertilizer includes the chitinophilic bacteria described in claim 1, or the bacterial agent described in claim 2 or 3.

Images