Genetically engineered bacterium for efficiently synthesizing melatonin as well as preparation method and application of genetically engineered bacterium
By constructing recombinant E. coli expressing multiple key enzyme genes, and optimizing cofactor circulation and regeneration paths through knockout and introduction of genes, the problem of insufficient melatonin yield in microbial fermentation is solved, and efficient high-yield melatonin production is achieved.
Patent Information
- Application Number
- CN202411754841.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-03
- Publication Date
- 2025-04-01
AI Technical Summary
In the prior art, the yield of microbial fermentation method used to produce melatonin is still insufficient, and it is difficult to achieve industrial production.
By constructing recombinant E. coli, a variety of key enzyme genes are expressed, such as methoxytransferase, adenosine homocysteine nuclease, ribosyl homocysteine lyase, etc., and by knocking out endogenous cofactor degradation genes, the exogenous SAM cycle regeneration path is introduced, and the fermentation conditions are optimized to increase the yield of melatonin.
The high yield of melatonin was achieved, with an output reaching 668mg/L, solving the problem of insufficient yield in the existing technology, and further increasing the yield through plasma mutagenesis, approaching the requirements of industrial production.
Smart Images
Figure CN119736225A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of gene recombination fermentation, and specifically relates to a genetic engineering bacterium for efficiently synthesizing melatonin, and a preparation method and application thereof. Background Art
[0002] Melatonin (N-acetyl-5-methoxytryptamine) is an important indoleamine derivative and the strongest endogenous free radical scavenger discovered so far. Its most well-known functions are improving sleep and anti-depression. It also has a good effect in delaying aging, improving diabetes, and regulating the cardiovascular and immune systems. The various positive functions of melatonin have led to a surge in sales in the global market, and the supply is in short supply. The global market is estimated to be US$1 billion in 2020 and is expected to reach US$3.4 billion by 2026.
[0003] At present, commercial melatonin is mainly produced by chemical synthesis, which is highly polluting and costly. The raw materials extracted from plants and animals are in short supply and have low extraction rates, which greatly limits the production of melatonin. In recent years, the rapid development of microbial fermentation methods has provided hope for more economical and environmentally friendly production. Now a few strains such as yeast and Pseudomonas have been proven to be used for biosynthesis of melatonin. Dong Zhiyang's team at the Chinese Academy of Sciences successfully achieved a melatonin production of 1g / L in a 2L bioreactor by constructing a heterologous production pathway for melatonin in Escherichia coli, improving enzyme activity through protein engineering, and promoting cofactor supply through gene editing (Microbial Cell Factories, 2021. DOI: 10.1186 / S12934-021-01662-8.). In another study, the researchers successfully achieved a melatonin production of 2 g / L in a 3L bioreactor by screening enzymes with better activity, improving enzyme activity through protein engineering, and reducing the efflux of the substrate tryptophan, which is the highest reported so far (ACS Synthetic Biology, 2020, 9(6).DOI:10.1021 / acssynbio.0c00065.).
[0004] Although some progress has been made in the synthesis of melatonin by microorganisms, the bottleneck of production makes it an insurmountable obstacle to industrial production. Summary of the invention
[0005] In order to solve the above problems, the present invention provides a genetically engineered bacterium for efficiently synthesizing melatonin, wherein the genetically engineered bacterium is a recombinant Escherichia coli expressing any one or more of the following genes:
[0006] methoxytransferase gene comt, adenosylhomocysteine nucleosidase gene mtn, ribosylhomocysteine lyase gene luxS, methionine adenosyltransferase gene metK, methionine synthase gene metH, adenosine kinase gene ado1, S-adenosyl-L-homocysteine hydrolase gene sahse;
[0007] The methoxytransferase gene comt is derived from any one or more of rice, passion fruit, eucalyptus, Anshui pike, and dace;
[0008] The adenosine kinase gene ado1 and the S-adenosine-L-homocysteine hydrolase gene sahse are derived from Saccharomyces cerevisiae;
[0009] The nucleotide sequence of the adenosylhomocysteine nucleosidase gene mtn is shown in SEQ ID NO.2, the nucleotide sequence of the ribosylhomocysteine lyase gene luxS is shown in SEQ ID NO.3, the nucleotide sequence of the methionine adenyltransferase gene metK is shown in SEQ ID NO.4, and the nucleotide sequence of the methionine synthase gene metH is shown in SEQ ID NO.5.
[0010] Furthermore, the nucleotide sequence of the methoxytransferase gene Oscomt from rice is shown in SEQ ID NO.18;
[0011] The nucleotide sequence of the methoxytransferase gene Mccomt from passion fruit is shown in SEQ ID NO.12;
[0012] The nucleotide sequence of the methoxytransferase gene Egcomt from Eucalyptus grandis is shown in SEQ ID NO.13;
[0013] The nucleotide sequence of the methoxytransferase gene Sacomt from the Anshui pike is shown in SEQ ID NO.16;
[0014] The nucleotide sequence of the methoxytransferase gene Lrcomt from dace is shown in SEQ ID NO.17;
[0015] The nucleotide sequence of adenosine kinase gene ado1 from Saccharomyces cerevisiae is shown in SEQ ID NO.6;
[0016] The nucleotide sequence of the S-adenosyl-L-homocysteine hydrolase gene sahse from Saccharomyces cerevisiae is shown in SEQ ID NO.7.
[0017] Furthermore, the recombinant E. coli is also knocked out or knocked down in any one or more of the following genes:
[0018] adenosylmethionine decarboxylase gene sped, cyclopropane fatty acid acylphospholipid synthase gene cfa, DNA-cytosine methyltransferase gene dcm, DNA binding transcription repressor metJ;
[0019] The nucleotide sequence of the adenosylmethionine decarboxylase gene sped is shown in SEQ ID NO.8;
[0020] The nucleotide sequence of the cyclopropane fatty acid acylphospholipid synthase gene cfa is shown in SEQ ID NO.9;
[0021] The nucleotide sequence of the DNA-cytosine methyltransferase gene dcm is shown in SEQ ID NO.10;
[0022] The nucleotide sequence of the DNA binding transcription inhibitor metJ is as shown in SEQ ID NO.11.
[0023] Furthermore, the genetically engineered bacteria are introduced with adenosylhomocysteine nucleosidase gene mtn, ribosylhomocysteine lyase gene luxS, methionine adenosyltransferase gene metK, methionine synthase gene metH, methoxytransferase gene Oscomt from rice, adenosine kinase gene ado1 from Saccharomyces cerevisiae, and S-adenosyl-L-homocysteine hydrolase gene sahse from Saccharomyces cerevisiae;
[0024] As well as recombinant Escherichia coli in which the adenosylmethionine decarboxylase gene sped, cyclopropane fatty acid acylphospholipid synthase gene cfa, DNA-cytosine methyltransferase gene dcm, and DNA-binding transcription repressor metJ were knocked out.
[0025] Furthermore, the Escherichia coli is Escherichia coli BL21DE3.
[0026] The present invention also provides a method for efficiently synthesizing melatonin, which uses glucose or glycerol as a growth carbon source, N-acetyl serotonin as a substrate, and uses the aforementioned genetically engineered bacteria for fermentation; the fermentation includes shake flask fermentation or fermentation tank fermentation.
[0027] Furthermore, the step of shake flask fermentation comprises:
[0028] The aforementioned genetically engineered bacteria were inoculated into a shake flask medium and cultured for 36 to 84 hours, during which N-acetyl serotonin was added at 0 hours and 12 hours;
[0029] Furthermore, the formula of the shake flask culture medium is: 8-12 g / L yeast powder, 15-25 g / L peptone, 30-50 g / L glucose, 3-8 g / L NaCl, and the rest is water;
[0030] The N-acetyl serotonin is added to a final concentration of 0.7 to 0.9 g / L;
[0031] The culture conditions are stable at 30° C. and a rotation speed of 220 rpm.
[0032] The present invention also provides a method for high-throughput detection of melatonin, comprising the following steps:
[0033] The control substance and the sample to be tested were placed in a 96-well plate for high-throughput fluorescence detection; the detection conditions were:
[0034] The excitation wavelength is 270-310nm, the emission wavelength is 360-380nm, and the detection volume is 0.1-0.5ml.
[0035] Furthermore, the sample to be tested is a fermentation broth of microbial fermentation using glucose or glycerol as a growth carbon source and N-acetyl serotonin as a substrate;
[0036] The strains used in the microbial fermentation include the aforementioned genetically engineered bacteria;
[0037] The reference substance is melatonin, with a concentration of 0-600 mg / L.
[0038] Beneficial effects of the present invention:
[0039] (1) The present invention screened 7 methyltransferases from different sources, among which, except for the methyltransferase from rice, all the other methyltransferases were found for the first time to have a positive effect on the production of melatonin by Escherichia coli fermentation. Among them, after the methyltransferase gene Lrcomt from dace was integrated into Escherichia coli, the production of melatonin by shake flask fermentation reached more than 250 mg / L.
[0040] (2) The present invention solves the degradation or inhibition problem of endogenous cofactor S-adenosylmethionine (SAM) by knocking out the Sped, cfa, dcm, and metJ genes in Escherichia coli on the basis of integrating the methyltransferase gene, and further enhances the accumulation of SAM by introducing an exogenous SAM recycling regeneration pathway, achieving a high yield of 668 mg / L of melatonin. The melatonin production of high-yield recombinant Escherichia coli can be further improved after plasma mutagenesis, solving the problem that melatonin cannot be industrially mass-produced at present.
[0041] (3) The present invention also creates a method for high-throughput detection of melatonin, which uses a high-throughput fluorescence detection device to detect melatonin fermentation broth at specific excitation wavelengths and emission wavelengths. Although the detection accuracy of this method is not as good as that of the traditional HPLC method, it can roughly estimate and judge the melatonin content in the fermentation broth when accurate measurement is not possible. It has practical application value in quickly evaluating the performance of microorganisms producing melatonin by fermenting with glucose or glycerol as the growth carbon source and N-acetyl serotonin as the substrate.
[0042] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.
[0043] The above contents of the present invention are further described in detail below through specific implementation modes in the form of embodiments, but it should not be understood that the scope of the above subject matter of the present invention is limited to the following examples. BRIEF DESCRIPTION OF THE DRAWINGS
[0044] Figure 1 Schematic diagram of melatonin production pathway DETAILED DESCRIPTION
[0045] The materials, reagents and equipment used in the specific embodiments of the present invention are all purchased from commercial sources, and the nucleotide sequence information involved is as follows:
[0046] Methoxytransferase gene comt, nucleotide sequence (SEQ ID NO.1):
[0047]
[0048] Adenosylhomocysteinase gene mtn, nucleotide sequence (SEQ ID NO.2):
[0049] ATGAAAATCGGCATCATTGGTGCAATGGAAGAAGAAGTTACGCTGCTGCGTGACAAAATCGAAAACCGTCAAACTATCAGTCTCGGCGGTTGCGAAATCTATACCGGCCAACTGAATGGAACCGAGGTTGCGCTTCTGAAATCGGGCATCGGTAAAGTCGCTGCGGCGCTGGGTGCCACTTTGCTGTTGGAACACTGCAAGCCAGATGTGATTATTAACACCGGTTCTGCCGGTGGCCTGGCACCAACGTTGAAAGTGGGCGATATCGTTGTCTCGGACGAAGCGCGTTATCACGACGCGGATGTCACGGCATTTGGTTATGAATACGGTCAGTTACCAGGCTGTCCGGCAGGCTTTAAAGCTGACGATAAACTGATCGCTGCCGCTGAGGCCTGCATTGCCGAACTGAATCTTAACGCTGTACGTGGCCTGATTGTTAGCGGCGACGCTTTCATCAACGGTTCTGTTGGTCTGGCGAAAATCCGCCACAACTTCCCACAGGCCATTGCTGTAGAGATGGAAGCGACGGCAATCGCCCATGTCTGCCACAATTTCAACATCCCGTTTGTTGTCGTACGCGCCATCTCCGACGTGGCCGATCAACAGTCTCATCTTAGCTTCGATGAGTTCCTGGCTGTTGCCGCTAAACAGTCCAGCCTGATGGTTGAGTCACTGGTGCAGAAACTGGCACATGGCTAA
[0050] Ribosylhomocysteine lyase gene luxS, nucleotide sequence (SEQ ID NO.3):
[0051] ATGCCGTTGTTAGATAGCTTCACAGTCGATCATACCCGGATGGAAGCGCCTGCAGTTCGGGTGGCGAAAACAATGAACACCCCGCATGGCGACGCAATCACCGTGTTCGATCTGCGCTTCTGCGTGCCGAACAAAGAAGTGATGCCAGAAAGAGGGATCCATACCCTGGAGCACCTGTTTGCTGGTTTTATGCGTAACCATCTTAACGGTAATGGTGTAGAGATTATCGATATCTCGCCAATGGGCTGCCGCACCGGTTTTTATATGAGTCTGATTGGTACGCCAGATGAGCAGCGTGTTGCTGATGCCTGGAAAGCGGCAATGGAAGACGTGCTGAAAGTGCAGGATCAGAATCAGATCCCGGAACTGAACGTCTACCAGTGTGGCACTTACCAGATGCACTCGTTGCAGGAAGCGCAGGATATTGCGCGTAGCATTCTGGAACGTGACGTACGCATCAACAGCAACGAAGAACTGGCACTGCCGAAAGAGAAGTTGCAGGAACTGCACATCTAG
[0052] Methionine adenosyltransferase gene metK, nucleotide sequence (SEQ ID NO.4):
[0053]
[0054] Methionine synthase gene metH, nucleotide sequence (SEQ ID NO.5):
[0055]
[0056] Adenosine kinase gene ado1, nucleotide sequence (SEQ ID NO.6):
[0057]
[0058] S-adenosyl-L-homocysteine hydrolase gene sahse, nucleotide sequence (SEQ ID NO.7):
[0059]
[0060] S-adenosylmethionine decarboxylase gene sped, nucleotide sequence (SEQ ID NO.8):
[0061] TTGAAAAAACTGAAACTGCATGGCTTTAATAATCTGACCAAAAGTCTGAGTTTTTGTATTTACGATATCTGCTACGCCAAAACTGCCGAAGAGCGCGACGGTTATATTGCTTATATCGATGAACTCTATAATGCCAACCGTCTGACCGAAATCCTGTCAGAAACCTGTTCCATTATCGGGGCTAATATTCTTAACATCGCCCGCCAGGATTACGAACCACAGGGTGCCAGCGTCACTATTCTGGTGAGTGAAGAACCGGTTGACCCGAAACTCATCGACAAAACAGAACACCCCGGCCCACTGCCAGAAACGGTCGTTGCCCATCTTGATAAAAGTCATATTTGCGTACATACCTACCCGGAAAGTCATCCTGAAGGCGGTTTATGTACCTTCCGCGCCGATATTGAAGTCTCTACCTGCGGCGTGATTTCTCCGCTGAAGGCGCTGAATTACCTGATCCACCAGCTTGAGTCCGATATCGTAACCATTGATTATCGCGTGCGCGGTTTTACCCGCGACATTAACGGTATGAAGCACTTTATCGACCATGAGATTAATTCGATTCAGAACTTTATGTCTGACGATATGAAGGCGCTGTATGACATGGTGGATGTGAACGTCTATCAGGAAAATATCTTCCATACCAAGATGTTGCTTAAAGAGTTCGACCTTAAGCACTACATGTTCCACACCAAACCGGAAGACTTAACCGACAGCGAGCGCCAGGAAATTACCGCTGCGCTGTGGAAAGAAATGCGCGAGATTTATTACGGGCGCAATATGCCAGCTGTTTAA
[0062] Cyclopropane fatty acyl-phospholipid synthase gene cfa, nucleotide sequence (SEQ ID NO.9):
[0063]
[0064] DNA-cytosine methyltransferase gene dcm, nucleotide sequence (SEQ ID NO.10):
[0065]
[0066] DNA binding transcription inhibitor metJ, nucleotide sequence (SEQ ID NO.11):
[0067] ATGGCTGAATGGAGCGGCGAATATATCAGCCCATACGCTGAGCACGGCAAGAAGAGTGAACAAGTCAAAAAGATTACGGTTTCCATTCCTCTTAAGGTGTTAAAAATCCTCACCGATGAACGCACGCGTCGTCAGGTGAACAACCTGCGTCACGCTACC AACAGCGAGCTGCTGTGCGAAGCGTTTCTGCATGCCTTTACCGGGCAACCTTTGCCGGATGATGCCGATCTGCGTAAAGAGCGCAGCGACGAAATCCCGGAAGCGGCAAAAGAGATCATGCGTGAGATGGGGATTAACCCGGAGACGTGGGAATACTAA
[0068] Passion fruit derived methoxytransferase gene Mccomt, nucleotide sequence (SEQ ID NO.12):
[0069] ATGGAACAAAAAGCTATAAATAGTTCATCTGCTGATGATCAGGACCAACAGCACTTTGCATACGCCGCGCATCTGGTTACCCTGTCTGTGTTCCCGTTTACCCTGCAGGCAGCCCTGGAACTTGGCGTGTTCAAGATCCTGGCTAAGGCGTCCCCGGGTGCTGAGCTGAGCGCTGCGGAGATCGCCGCGAAAATCACCGCAACGAACCGCAACGCTGCCTCTATGGTTGATCGTATGCTGCGTTTGCTGGCGACCCACAGCGTCGTGGGCTGCTCCACTGTAGAAGACGAGGGCGGTAATGTTAAACGCCTGCATTCTTTGACCCCGGTGAGCAAGTATTTTGTTCGTAACGAGGACGGCGTGTCTTTAGGTCCGATGATCAGCTTGATCCAGGACCAGGTTTTTCTGGACAGCTGTCCGGCGATTCCGGTCAGCCGTATTGACAATAAGAGCTGGGAAATCATTCGTCGTGCGCAAGGTAGAAGCCTCAAGTACGCGTTATGGGGTGAAGCGTTGGTGCTGAACAGCCACCTGTTCAGCAGCGGTCTGTCTAGTCATGATCAACCGGATGAGTTCAAGAAACTGCCGAAACCGCGCCAACACAGCAGCCAGAAACGTAAAGCGCCAGAGGAAATGGCATCGAAGTTCTTGGCGCTGTCCTCCACCAAACGCCAACGTGCCAGCGCACCGTCCATTCCGCCTGCGACGCCATGA
[0070] Eucalyptus grandis-derived methoxytransferase gene Egcomt, nucleotide sequence (SEQ ID NO.13):
[0071] ATGAGTTCAGAAGAGGCACCCGCTATAACAATCAGCCATGAGGACGAGGACATCCTTAAGGCGTTCGAAATTCCGCCGATGGTGTTTGTTCCGATGGTGCTGAAGGGCGCGATTGAATTGGGCATCCTGGAGTTGCTGGCGAAGTGCGGCCAGTTGTCCCCGCTGGACATCGCCGCACGTCTAAGCATCGATAATCCGGCTACCCCGGATATTATTAACCGCTTGCTGCGTCTTCTGGTTAGCTATTCGATCCTGTCTTGCACCCTGGTTGAAGACAAAGGTGGCCCTCCGCGTGGTAGCACCGCATCCGGTCTGGGCGCGTCTAGCTTCTGGACCACCAAAGAGTTGCTGATGCACCAGCTGATCTGCTATAGCAAAAAGCGCCTGTCCTGGAAAGCGGGTTTGTGTCTGTACAATCCGCGTATTTTTACGCACCCGCATTGTCTGAAGGACTTAGTCAAAGAAGGCGGTGCTGACCCGTTCACTCGCACGCACGGTATGAACCTGTTCGACTACATGGGTCAAGATCCACGTTTTAACGATCTGTGA
[0072] Goldfish-derived methoxytransferase gene Cacomt, nucleotide sequence (SEQ ID NO.14):
[0073] ATGGCTTATCCCTCAGTTGTCGTATTTCTAATGTTCGCCCTGGTTGCTGGCAGCGCGATCGCCCAGGCACCGGCGGCGAGCCCGACCAAGTCCCCGATGGCAAGCCCGCCTAAAGCCACCGCAACCCCGTCCGTCGCTCCGACGCCGTCCGTGAAACCGCCAACGTCTTCGCCGAAATCCTCTCCGGGTTTGACCCAGAGCTTGGCGTCTGCGAGCGTGCTGCCGATGGTTCTTAAGTCCGCGATTGAGCTGGACCTGCTGGAAATTATGGGTAAAGCAGGTCCGGGCGCATACGTTAGCCCGTCAGAAGTTGCTGCCCAACTGCCGACGAAGAACCCGGATGCGGCGGTAATGCTGGATCGTATTCTGCGCCTGCTCACCAGCAGCAGTGTCTTGAAGCCGACCTCGCCGGCGCTGAGCCCGCTCCTGTCTCCCCCGACCCCGCCTACTGGTGCGCCAGCGCCATCTCTACCGTCCTTAATGGGCTGCCCGGGTTTGGACGACGAGGTTTTGGCGACCCTGAAGCATAGCTGTAAGAGCCTGGCTGTGATCAACATCAGCAACTGCCCGAATGTGAGCCACGTGGGCCTGAGCAGCCTGCCGTATACCCGTTGA
[0074] Carassius auratus gibelio-derived methoxylase gene Cgcomt, nucleotide sequence (SEQ ID NO.15):
[0075]
[0076] The methoxyl transferase gene Sacomt from Anshui pike, nucleotide sequence (SEQ ID NO.16):
[0077]
[0078] Methoxytransferase gene Ircomt from dace, nucleotide sequence (SEQ ID NO.17):
[0079]
[0080] Rice-derived methoxytransferase gene Oscomt, nucleotide sequence (SEQ ID NO.18):
[0081]
[0082] The present invention specifically uses homologous recombination to construct the expression vector, wherein the DNA polymerase, DNA restriction endonuclease, plasmid construction DNA ligase, and homologous recombination enzyme used are all purchased from Thermo Fisher Scientific; the basic plasmids used to construct the homologous recombination vector are pETdute1 and pCS27, which are purchased from Beina Biotech Co., Ltd.; the plasmid mini-extraction kit, gel recovery kit, etc. are all purchased from Novazon Biotech Co., Ltd. The homologous recombination vector is transferred into the host bacteria to finally achieve the expression of the target gene.
[0083] Specifically, the CRISPR-Cas9 system was used to achieve knockout of target genes in host cells. The vectors expressing Cas9 protein and gRNA short peptide were purchased from Beina Biotech Co., Ltd. The gRNA sequences involved are shown in the following table.
[0084] gRNA sequences corresponding to CRISPR-Cas9 gene knockout
[0085]
[0086] Example 1 Screening of methoxytransferase
[0087] Previous studies have found that the methoxylation of N-acetyl serotonin is a rate-limiting step that seriously affects the microbial synthesis of melatonin. To solve this problem, we first screened seven methoxytransferases from different sources through literature research and database comparison, as well as a large number of experiments. They are Oscomt from rice, Mccomt from passion fruit, Egcomt from Eucalyptus, Cacomt from goldfish, Cgcomt from silver crucian carp, Sacomt from Anshui pike, and Lrcomt from dace.
[0088] In order to select the most active enzyme from these seven methoxytransferases, the seven methoxytransferase genes were respectively transferred into Escherichia coli BL21DE3, and the methoxylation activity was detected by 250ml shake flask fermentation. The shake flask medium formula is 10g / L yeast powder, 20g / L peptone, 40g / L glucose, 5g / L NaCl, and the rest is water, and the culture conditions are 30℃, 220rpm, 72h.
[0089] During the fermentation process, 0.75 g / L of substrate N-acetyl serotonin was added twice at 0 h and 12 h to reduce biological toxicity. After 72 h of fermentation, 1 ml of fermentation liquid was taken for liquid phase detection. As shown in Table 1, methoxytransferases from seven different sources showed different activities, among which the best was the methoxytransferase gene Oscomt from rice, which produced 284 mg / L of melatonin within 72 h. In addition, methoxytransferases (Lrcomt, Sacomt) from dace and Anshui pike also had good activity, producing 211 and 262 mg / L of melatonin, respectively. In contrast, methoxytransferases from passion fruit, eucalyptus, and goldfish were less active, producing only 122, 164, and 47 mg / L of melatonin, respectively, within 72 h.
[0090] Table 1 Comparison of methoxytransferase activities from different sources
[0091]
[0092] Therefore, five of the seven methoxytransferase genes from different sources, namely, the rice-derived methoxytransferase gene Oscomt, the passion fruit-derived methoxytransferase gene Mccomt, the large eucalyptus-derived methoxytransferase gene Egcomt, the Anshui pike-derived methoxytransferase gene Sacomt, and the dace-derived methoxytransferase gene Lrcomt, can enable the recombinant Escherichia coli to produce more than 150 mg / L of melatonin during shake flask fermentation, thus solving the rate-limiting effect of the methoxylation of N-acetyl serotonin during the microbial synthesis of melatonin, and can be used for gene recombination of Escherichia coli to increase the yield of melatonin produced by fermentation. Among them, the rice-derived methoxytransferase gene Oscomt and the dace-derived methoxytransferase gene Lrcomt, after being integrated into Escherichia coli, can produce more than 250 mg / L of melatonin during shake flask fermentation, and are the best choices for recombinant methoxytransferase genes in Escherichia coli.
[0093] Example 2 Cyclic Regeneration of S-adenosylmethionine (SAM) Cofactor
[0094] In the process of producing melatonin through methoxylation using N-acetyl serotonin as a substrate, S-adenosylmethionine (SAM) is a key cofactor, which acts as a methyl donor to provide methyl groups for the production of melatonin. Therefore, enhancing the accumulation and regeneration of S-adenosylmethionine (SAM) has a promoting effect on the high production of melatonin.
[0095] Through literature research and E. coli metabolic network analysis, as well as preliminary experiments, it was found that S-adenosylmethionine produced endogenously by E. coli can be degraded through multiple pathways (such as Figure 1As shown). Therefore, in order to block the degradation of S-adenosylmethionine (SAM), the adenosylmethionine decarboxylase gene sped, the cyclopropane fatty acid acylphospholipid synthase gene cfa, and the DNA-cytosine methyltransferase gene dcm, which are involved in the degradation of S-adenosylmethionine (SAM), were knocked out respectively.
[0096] As shown in Table 2, based on strain S1 in Example 1, sped, cfa, and dcm genes were knocked out respectively to form strains S8, S9, and S10, and the production of melatonin increased to 316, 328, and 303 mg / L, respectively. The experimental results show that increasing the accumulation of cofactor SAM is conducive to the production of melatonin. In view of this, the genes cfa and dcm were further knocked out to form strains S11 and S12, respectively. As shown in Table 2, the production of melatonin was superimposed in sequence, which were 356 and 385 mg / L, respectively.
[0097] Based on strain S12, gene metJ was knocked out to form strain S13. Knockout of gene metJ resulted in more cofactor SAM, and strain S13 showed higher melatonin production, reaching 421 mg / L.
[0098] After solving the problem of endogenous cofactor degradation or inhibition, the endogenous cofactor recycling pathways were strengthened one by one. Figure 1 As shown in Table 2, the cyclic regeneration of endogenous cofactor SAM involves four genes, namely, adenosylhomocysteine nucleosidase gene mtn, ribosylhomocysteine lyase gene luxS, methionine adenosyltransferase gene metK, and methionine synthase gene metH. Therefore, these four genes were expressed in sequence on the basis of strain S13. As shown in Table 2, the expression of genes mtn, luxS, metK, and metH has a superimposed promoting effect on the production of melatonin. When the four genes of strain S17 are superimposedly expressed, the melatonin production increases to 557 mg / L, which is 32.3% higher than that of strain S13.
[0099] The above experimental results show that by solving the problem of endogenous cofactor degradation or inhibition, the cofactor SAM plays a key role in the production of melatonin, and increasing its accumulation can greatly promote the production of melatonin. Therefore, in order to further enhance the accumulation of SAM, a cofactor SAM recycling pathway derived from Saccharomyces cerevisiae was introduced. Figure 1As shown in Figure 2, the exogenous SAM recycling pathway consists of three steps, firstly, S-adenosyl-L-homocysteine hydrolase SAHse catalyzes the conversion of S-adenosyl-L-homocysteine (SAH) into homocysteine (Homo), then methionine synthase METH catalyzes the conversion of homocysteine (Homo) into methionine (Met), and finally methionine adenosyltransferase METK catalyzes the conversion of methionine (Met) into S-adenosylmethionine (SAM). Compared with the endogenous pathway, this exogenous regeneration pathway has the advantages of shorter catalytic steps and higher catalytic efficiency. As shown in Table 2, on the basis of strain S17, the S-adenosyl-L-homocysteine hydrolase gene sahse from Saccharomyces cerevisiae was introduced to form strain S18, and the production of melatonin was further increased by 12.9%, reaching 629 mg / L. In addition, whether it is endogenous or exogenous SAM, ATP is required as a cofactor for the recycling and regeneration of SAM. Therefore, the adenosine kinase gene ado1 from Saccharomyces cerevisiae was further introduced into strain S18 to form strain S19. As shown in Table 2, strain S19 achieved a high yield of 668 mg / L of melatonin.
[0100] Table 2 Effect of SAM recycling on melatonin production
[0101]
[0102]
[0103] Example 3 Establishment of a high-throughput detection method for melatonin
[0104] Melatonin has certain biological toxicity to Escherichia coli, and it is speculated that this may be one of the factors limiting the high production of melatonin. In addition, when the strain S19 of Example 2 was used to ferment and produce melatonin, a large amount of substrate N-acetyl serotonin residue was observed, so it is speculated that the activity of methyltransferase is still one of the factors limiting the high production of melatonin. In view of this, based on the engineered strain S19, the strain S19 was evolved by plasma (ARTP) mutagenesis in order to obtain a strain with higher melatonin production. In order to realize the monitoring of melatonin production by the induced strain, a high-throughput detection method of melatonin was explored, as follows:
[0105] Through the analysis of the chemical structure of melatonin, it is speculated that melatonin has a certain fluorescence, so it can be used as a high-throughput detection method for high-throughput detection of induced evolution strains. In fluorescence detection, the excitation wavelength and the emission wavelength are the two most important parameters. Among them, the excitation wavelength refers to the wavelength of light used to excite substances (such as fluorescent substances, laser media, etc.) to produce specific responses (such as fluorescence emission, laser oscillation, etc.). The emission wavelength refers to the wavelength of light emitted by a substance after being excited. In the fluorescence phenomenon, the emission wavelength refers to the wavelength at which the sample molecule emits fluorescence after absorbing light energy. Therefore, in order to determine the optimal excitation and emission wavelengths for detecting melatonin fluorescence, as shown in Tables 3 and 4, single-factor experiments were conducted on the excitation wavelength and emission wavelength, respectively. As shown in Table 3, in order to determine the optimal excitation wavelength, the emission wavelength was fixed at 350 nm, and the excitation wavelength was scanned in the wavelength range of 200-380 nm (the melatonin / N-acetyl serotonin concentration was maintained between 0-600 mg / L, and the fluorescence detection volume was maintained between 0.1-0.5 ml. In the 96-well plate of this experiment, the melatonin / N-acetyl serotonin concentration was fixed at 400 mg / L, and the detection volume was fixed at 0.4 ml).
[0106] The experiment shows that the fluorescence response values of melatonin and substrate N-acetyl serotonin increase with the increase of excitation wavelength in the wavelength range of 200-310nm, and decrease with the increase of wavelength in the wavelength range of 310-380nm. Since the substrate N-acetyl serotonin also exhibits fluorescent properties, in order to reduce the interference caused by N-acetyl serotonin in high-throughput screening, high-concentration melatonin is detected with the highest efficiency. As shown in Table 3, the optimal melatonin excitation wavelength range is calculated by subtracting the N-acetyl serotonin response value from the product melatonin response value. As can be seen from Table 3, the fluorescence response of melatonin and N-acetyl serotonin shows the greatest difference in the excitation wavelength range of 270-310nm, and the fluorescence response of melatonin is significantly greater than that of N-acetyl serotonin. Therefore, it can be inferred that when the initial N-acetyl serotonin concentration is constant, the excitation wavelength is within the wavelength range of 270-310nm, and the more melatonin the strain produces, the higher the fluorescence response value of the sample will be.
[0107] Table 3 Response of melatonin fluorescence to different excitation wavelengths
[0108]
[0109] Furthermore, in order to determine the optimal fluorescence emission wavelength of melatonin, based on the data in Table 3, this study fixed the excitation wavelength at 300 nm and scanned the emission wavelength in the wavelength range of 320-470 nm. As shown in Table 4, the fluorescence response values of melatonin and substrate N-acetyl serotonin increased with the increase of emission wavelength in the wavelength range of 320-340 nm, and decreased with the increase of emission wavelength in the wavelength range of 350-470 nm. The difference between the melatonin response value and the N-acetyl serotonin response value showed the greatest difference in the emission wavelength range of 360-380 nm.
[0110] Table 4 Response of different emission wavelengths to melatonin fluorescence
[0111]
[0112] From the above experimental results, it can be seen that in order to achieve high-throughput and high-efficiency screening of high-producing melatonin strains, the excitation wavelength of melatonin should be in the range of 270-310nm, the emission wavelength should be in the range of 360-380nm, and the detection volume should be 0.1-0.5ml.
[0113] Example 4 ARTP mutagenesis screening of melatonin producing strains
[0114] Strain S19 was selected as the mutagenic strain. The S19 strain cultured overnight in an LB test tube was diluted with pure water to an OD of 600 The pH value is between 0.6-0.8, 25 μl is drawn onto the mutagenic iron sheet and placed in the ARTP instrument. Set the mutagenic parameters, the power is set to 120W, the gas volume is set to 10SLM, and the mutagenic time is set to 10s. After the mutagenesis is completed, the iron sheet containing 25 μl of bacterial solution is placed in an EP tube containing 475 μl of saline, mixed, and then 100 μl of the mutagenic bacterial solution is drawn onto the LB solid plate, spread evenly and cultured overnight. After overnight culture, the single colonies on the LB plate were picked and placed in a 96-deep-well plate for fermentation verification. In order to screen effective mutants, a total of 50X 96=4800 single colonies were picked in 50 96-well plates in this experiment. After 48 hours of fermentation, 4800 samples were evaluated for melatonin production according to the high-throughput detection method determined in Example 3, i.e., 300 nm was used as the excitation wavelength, 360 nm was used as the emission wavelength, the detection volume was fixed at 0.4 ml, and the fluorescence response value of the fermentation broth in the 96-well plate was measured, while 0-600 mg / L melatonin was used as a control.
[0115] Since ARTP mutagenesis is a random mutagenesis, the 4800 mutated strains selected in this experiment showed different effects on the production of melatonin. As shown in Table 5, this experiment successfully screened 9 strains with obvious advantages in melatonin production from 4800 mutagens, namely S20-S28 (although the remaining strains also showed stronger fluorescence intensity than the control group, considering the experimental error of 96-well plate fermentation, only the 9 mutants with the highest fluorescence intensity were selected). As shown in Table 5, in the 96-well plate, the control group S19 strain was a strain before mutagenesis, and the fluorescence response value after 48 hours of fermentation was 675.4, and the corresponding melatonin production was 78.29 mg / L. In contrast, strains S20-S28 were strains induced by ARTP and showed obvious fluorescence intensity in high-throughput fluorescence detection, all of which were 900 and above, so they were preferably positive evolution strains, and their fermentation broth was further quantified by HPLC. By HPLC quantification, in the 96-well plate, the melatonin production of the 9 mutants was significantly better than that of the control group S19, and the highest strain was S24, with a melatonin production of 166.79 mg / L, an increase of 2.1 times. However, it is worth mentioning that the fluorescence response value and the quantitative results of HPLC shown in Table 5 did not show a linear relationship that the larger the fluorescence response value, the higher the melatonin production. The specific reason is speculated to be that in the actual long-term fermentation, due to the small fermentation volume of the 96-well plate, its cell OD and fermentation volume may change differently over time, which will cause errors in fluorescence detection.
[0116] Further, strains S20-S28 were verified by shake flask fermentation. As shown in Table 5, in shake flask fermentation, due to more sufficient dissolved oxygen and more stable fermentation, strains S20-S28 all showed higher melatonin production, with the highest yield reaching 2231 mg / L, about 3 times that of the control group. However, unlike the 96-well plate fermentation, strain S22 showed a more prominent melatonin production than strain S24. In addition, the production intensity of melatonin by other strains in shake flasks is not completely consistent with that in 96-well plates. The reason is speculated to be that compared with 96-well plate fermentation, the substrate concentration, cell OD, dissolved oxygen, pH, etc. in shake flask fermentation are more stable and easier to accurately control. Therefore, the data shown in 96-well plate fermentation has a certain error.
[0117] Table 5 ARTP mutagenesis screening of melatonin high-producing strains
[0118]
[0119] From the above results, it can be seen that although the accuracy of the high-throughput detection method of melatonin of the present invention is not as good as that of the traditional method, it can roughly estimate and judge the melatonin content in the fermentation broth when accurate measurement is not possible. It has practical application value in quickly evaluating the performance of melatonin production by microorganisms fermented with glucose or glycerol as the growth carbon source and N-acetyl serotonin as the substrate.
[0120] In summary, the genetically engineered bacteria for efficiently synthesizing melatonin of the present invention knock out the Sped, cfa, dcm, and metJ genes in Escherichia coli on the basis of integrating the methyltransferase gene, and introduce an exogenous SAM recycling regeneration path, so that melatonin achieves a high yield of 668 mg / L. The melatonin production of the recombinant Escherichia coli with high melatonin production can be further improved after plasma mutagenesis, solving the problem that melatonin cannot be industrially mass-produced at present. At the same time, the present invention also creates a method for high-throughput detection of melatonin, which can roughly estimate and judge the melatonin content in the fermentation broth when accurate measurement of melatonin is not possible. It has practical application value in terms of rapid evaluation of the performance of microorganisms producing melatonin using glucose or glycerol as a growth carbon source and N-acetyl serotonin as a substrate.
Claims
1. A genetically engineered bacterium for efficiently synthesizing melatonin, characterized in that: The genetically engineered bacteria are recombinant Escherichia coli expressing any one or more of the following genes: methoxytransferase gene comt, adenosylhomocysteine nucleosidase gene mtn, ribosylhomocysteine lyase gene luxS, methionine adenosyltransferase gene metK, methionine synthase gene metH, adenosine kinase gene ado1, S-adenosyl-L-homocysteine hydrolase gene sahse; The methoxytransferase gene comt is derived from any one or more of rice, passion fruit, eucalyptus, Anshui pike, and dace; The adenosine kinase gene ado1 and the S-adenosine-L-homocysteine hydrolase gene sahse are derived from Saccharomyces cerevisiae; The nucleotide sequence of the adenosylhomocysteine nucleosidase gene mtn is shown in SEQ ID NO.2, the nucleotide sequence of the ribosylhomocysteine lyase gene luxS is shown in SEQ ID NO.3, the nucleotide sequence of the methionine adenyltransferase gene metK is shown in SEQ ID NO.4, and the nucleotide sequence of the methionine synthase gene metH is shown in SEQ ID NO.
5.
2. The genetically engineered bacterium according to claim 1, characterized in that: The nucleotide sequence of the methoxytransferase gene Oscomt from rice is shown in SEQ ID NO.18; The nucleotide sequence of the methoxytransferase gene Mccomt from passion fruit is shown in SEQ ID NO.12; The nucleotide sequence of the methoxytransferase gene Egcomt from Eucalyptus grandis is shown in SEQ ID NO.13; The nucleotide sequence of the methoxytransferase gene Sacomt from the Anshui pike is shown in SEQ ID NO.16; The nucleotide sequence of the methoxytransferase gene Lrcomt from dace is shown in SEQ ID NO.17; The nucleotide sequence of adenosine kinase gene ado1 from Saccharomyces cerevisiae is shown in SEQ ID NO.6; The nucleotide sequence of the S-adenosyl-L-homocysteine hydrolase gene sahse from Saccharomyces cerevisiae is shown in SEQ ID NO.
7.
3. The genetically engineered bacterium according to claim 1, characterized in that: The recombinant E. coli is also knocked out or knocked down any one or more of the following genes: adenosylmethionine decarboxylase gene sped, cyclopropane fatty acid acylphospholipid synthase gene cfa, DNA-cytosine methyltransferase gene dcm, DNA binding transcription repressor metJ; The nucleotide sequence of the adenosylmethionine decarboxylase gene sped is shown in SEQ ID NO.8; The nucleotide sequence of the cyclopropane fatty acid acylphospholipid synthase gene cfa is shown in SEQ ID NO.9; The nucleotide sequence of the DNA-cytosine methyltransferase gene dcm is shown in SEQ ID NO.10; The nucleotide sequence of the DNA binding transcription inhibitor metJ is as shown in SEQ ID NO.
11.
4. The genetically engineered bacterium according to any one of claims 1 to 3, characterized in that: The genetically engineered bacteria are introduced with adenosylhomocysteine nucleosidase gene mtn, ribosylhomocysteine lyase gene luxS, methionine adenosyltransferase gene metK, methionine synthase gene metH, methoxytransferase gene Oscomt from rice, adenosine kinase gene ado1 from Saccharomyces cerevisiae and S-adenosyl-L-homocysteine hydrolase gene sahse from Saccharomyces cerevisiae; As well as recombinant Escherichia coli in which the adenosylmethionine decarboxylase gene sped, cyclopropane fatty acid acylphospholipid synthase gene cfa, DNA-cytosine methyltransferase gene dcm, and DNA-binding transcription repressor metJ were knocked out.
5. The genetically engineered bacterium according to claim 4, characterized in that: The Escherichia coli is Escherichia coli BL21DE3.
6. A method for efficiently synthesizing melatonin, characterized in that: The method uses glucose or glycerol as a growth carbon source and N-acetyl serotonin as a substrate, and uses the genetically engineered bacteria described in any one of claims 1 to 6 for fermentation; the fermentation includes shake flask fermentation or fermentation tank fermentation.
7. The method according to claim 6, characterized in that: The steps of shake flask fermentation include: The genetically engineered bacteria according to any one of claims 1 to 6 are inoculated into a shake flask medium and cultured for 36 to 84 hours, during which N-acetyl serotonin is added at 0 hours and 12 hours.
8. The method according to claim 7, characterized in that: The formula of the shake flask culture medium is: 8-12 g / L yeast powder, 15-25 g / L peptone, 30-50 g / L glucose, 3-8 g / L NaCl, and the rest is water; The N-acetyl serotonin is added to a final concentration of 0.7 to 0.9 g / L; The culture conditions are stable at 30° C. and a rotation speed of 220 rpm.
9. A method for high-throughput detection of melatonin, characterized in that: The steps include: The control and the sample to be tested were placed in a 96-well plate for high-throughput fluorescence detection; the detection conditions were: The excitation wavelength is 270-310nm, the emission wavelength is 360-380nm, and the detection volume is 0.1-0.5ml.
10. The method according to claim 9, characterized in that: The sample to be tested is a fermentation broth obtained by microbial fermentation using glucose or glycerol as a growth carbon source and N-acetyl 5-hydroxytryptamine as a substrate; The strain used in the microbial fermentation includes the genetically engineered bacteria according to any one of claims 1 to 6; The reference substance is melatonin, with a concentration of 0-600 mg / L.