Genetically engineered bacteria and use thereof in preparing ergothioneine

By using genetically engineered bacteria to carry ergothioneine synthases egtB, egtD, and egtE, and assembling them using protein scaffold components (SGP), the complexity of enzyme-catalyzed conversion in ergothioneine biosynthesis was solved, achieving efficient and simplified ergothioneine production.

CN121343864BActive Publication Date: 2026-03-20BEIJING KANSENBIO TECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511943184.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-22
Publication Date
2026-03-20
Estimated Expiration
2045-12-22

AI Technical Summary

Technical Problem

Existing biosynthetic methods for ergothionein suffer from problems such as complex enzyme-catalyzed conversion processes, difficulties in the synergistic supply and pathway balance of precursor substances, and low ergothionein yield.

Method used

Genetically engineered bacteria carrying the genes egtB, egtD, and egtE encoding ergothionein synthase were used and assembled using protein scaffold components (including GBD, SH3, and PDZ) to improve enzyme adaptability and expression intensity and simplify the process.

Benefits of technology

It significantly improved the production efficiency and yield of ergothioneine, simplified downstream processes, and achieved efficient ergothioneine synthesis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The application discloses genetically engineered bacteria and application thereof in preparation of ergothioneine. The genetically engineered bacteria carry genes egtB, egtD and egtE encoding ergothioneine synthetase, and the genes egtB, egtD and egtE are assembled with a protein scaffold assembly SGP. The protein scaffold assembly SGP comprises a protein scaffold GBD, a protein scaffold SH3 and a protein scaffold PDZ. The inventor finds that by using the protein scaffold assembly SGP to assemble the ergothioneine synthetase egtB, egtD and egtE, ergothioneine can be efficiently synthesized, and the application has important application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological chemical industry, in particular to a genetically engineered bacterium and its use in preparing ergothioneine. BACKGROUND

[0002] Ergothioneine is a unique cell physiological protective agent, which has a wide application prospect in food, beverage, cosmetics and medicine industries. It has multiple functions such as free radical scavenging, detoxification, maintaining DNA biosynthesis, promoting normal cell growth, enhancing cell immunity, anti-radiation, whitening and anti-aging, especially in antioxidant and energy regulation, and is a multifunctional cell physiological protective agent. Ergothioneine has a significant effect on food preservation, can prolong the shelf life of food, and can be used as a food additive. In addition, ergothioneine also shows potential in the treatment of chronic inflammation, eclampsia, cardiovascular disease, etc. Therefore, ergothioneine has been widely used in food, cosmetics, medical and other fields. At present, the production methods of ergothioneine mainly include natural biological extraction method, chemical synthesis method and biosynthesis method. Compared with the former two methods, the biosynthesis method has become the main development direction of industrial production of ergothioneine due to its low cost, easy availability of raw materials and easy expansion of production capacity.

[0003] However, the natural synthesis pathway of ergothioneine is complex, which involves a series of complex enzyme-catalyzed conversion processes, making it difficult to supply precursors in coordination and balance the pathway, thus limiting the construction of high-efficiency ergothioneine-producing strains. Previous studies have found that introducing ergothioneine synthetase from different sources into Escherichia coli can result in a huge difference in ergothioneine yield due to the difference in adaptation mechanism. Therefore, it is crucial to improve the adaptation of exogenous ergothioneine synthetase in Escherichia coli and its expression intensity.

[0004] There is an urgent need in the art for a new biosynthesis method for preparing ergothioneine. SUMMARY

[0005] Based on this, the present application at least provides a genetically engineered bacterium and its use in preparing ergothioneine.

[0006] In the first aspect of the present application, a genetically engineered bacterium is provided, which carries genes egtB, egtD and egtE encoding ergothioneine synthetase, and the genes egtB, egtD and egtE are assembled with a protein scaffold component SGP;

[0007] The protein scaffold component SGP comprises a protein scaffold GBD, a protein scaffold SH3 and a protein scaffold PDZ.

[0008] In a second aspect of the present application, a recombinant expression vector is provided, which comprises genes egtB, egtD and egtE encoding ergot alkaloid synthesis enzymes, and a nucleic acid fragment encoding a protein scaffold component SGP.

[0009] In a third aspect of the present application, a method for preparing ergot alkaloids is provided, which comprises:

[0010] culturing the genetically engineered bacteria as described in the first aspect to prepare a culture solution;

[0011] isolating ergot alkaloids from the culture solution. BRIEF DESCRIPTION OF DRAWINGS

[0012] In order to more clearly illustrate the technical solutions in the embodiments and examples of the present application, and more completely understand the present application and its beneficial effects, the drawings needed to be used in the description of the embodiments or examples will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without any creative effort on the basis of these drawings. It should be noted that the drawings are drawn in a simplified form and are only used to conveniently and clearly assist in the description of the present application.

[0013] Figure 1 Figure 1 is a growth curve of a strain in an embodiment of the present application.

[0014] Figure 2 Figure 2 is a strain ergot alkaloid production in an embodiment of the present application. DETAILED DESCRIPTION

[0015] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the relevant drawings. The preferred embodiments of the present application are shown in the drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.

[0016] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terminology used in the specification of the present application is only for the purpose of describing specific embodiments and is not intended to limit the present application. The term "and / or" used herein includes any and all combinations of one or more of the associated listed items.

[0017] In the present application, "one or more" means any one of the listed items or any combination of the listed items, unless otherwise specified. Similarly, "one or more" and the like otherwise indicate "one or more" are also understood in the same way, unless otherwise specified.

[0018] As used in this application, "combinations", "any combination", "any combination manner", and the like include all suitable combinations of any two or more of the listed items.

[0019] In this application, "suitable combinations", "suitable manners", "any suitable manner", and the like, "suitable" is subject to the implementation of the technical solutions of the present application, solving the technical problems of the present application, and achieving the intended technical effects of the present application.

[0020] In this application, "further", "still further", "in particular", "for example", "such as", "example", "for instance" and the like are used for description purposes, indicating that the preceding and subsequent technical solutions have a correlation in terms of coverage, but should not be understood as a limitation on the previous technical solution, nor as a limitation on the scope of protection of the present application. In this application, unless otherwise stated, A (such as B) means that B is a non-limiting example of A, and it can be understood that A is not limited to B.

[0021] The terms "contain", "include", and "comprise" used in this application are synonymous terms, which are inclusive or open-ended, and do not exclude additional, unmentioned members or features. Members or features, such as materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features also include actions, conditions, timing, states, etc.

[0022] In this application, the technical features or technical solutions described in open-ended language include both closed technical features or technical solutions composed of listed contents, and open technical features or technical solutions containing listed contents.

[0023] In this application, the exemplary description involving "in some embodiments (or examples)", "in one embodiment (or example)", and the like, can cover but is not limited to the following meanings: these solutions can be combined with other solutions in a suitable manner to form new technical solutions.

[0024] In this application, in "first aspect", "second aspect", and the like, the terms "first", "second", and the like are only used for description purposes, and cannot be understood as indicating or implying relative importance or quantity, nor can it be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", and the like only serve the purpose of non-exhaustive enumeration description, and should be understood as not constituting a closed limitation on the quantity.

[0025] In this application, when a numerical interval (i.e. a numerical range) is involved, the distribution of the optional numbers in the numerical interval is considered to be continuous and includes both numerical endpoints (i.e. the minimum value and the maximum value) of the numerical interval and each number between the two numerical endpoints, unless otherwise specified. When a numerical interval refers only to integers in the numerical interval, including both endpoint integers and each integer between the two endpoints, it is equivalent to directly listing each integer, unless otherwise specified. When multiple numerical ranges are provided to describe a feature or a characteristic, these numerical ranges can be combined. In other words, unless otherwise specified, the numerical ranges disclosed herein are to be interpreted to include any and all sub-ranges therein. The "numbers" in the numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. The "numerical interval" is intended to broadly include numerical interval types such as percentage interval, ratio interval, ratio interval, etc.

[0026] In this application, unless otherwise specified, the execution of the steps involved in the method flow does not have strict order restrictions, and these steps can be executed in other orders than described. Moreover, any step can include multiple sub-steps or multiple stages, which do not necessarily be executed at the same time, but can be executed at different times, and the execution order is not necessarily sequential, but can be alternated or simultaneously executed with other steps or sub-steps or stages of other steps.

[0027] Protein scaffold assembly SGP is designed as a core assembly tool due to its specific molecular recognition ability. Protein scaffold assembly SGP is composed of SH3, GBD and PZD, GBD is responsible for receiving and responding to upstream activation signals; SH3: responsible for recruiting downstream effector proteins to perform specific functions; PZD: responsible for forming stable dimers to provide assembly platforms and positioning anchors for complexes. The inventors of the present application found that the SPG scaffold system can precisely position, immobilize and enhance the synergistic effect of multiple enzymes in the ergothioneine synthesis pathway, greatly improving production efficiency and yield, and simplifying downstream processes. Illustratively, the inventors found that by using protein scaffold assembly SGP to assemble ergothioneine synthesis enzymes egtB, egtD and egtE (for example, derived from Mycobacterium smegmatis), ergothioneine can be efficiently synthesized, which has important application prospects.

[0028] In one aspect of the present application, a genetically engineered bacterium is provided, which carries genes egtB, egtD and egtE encoding ergothioneine synthesis enzymes, and the genes egtB, egtD and egtE are assembled with protein scaffold assembly SGP;

[0029] The protein scaffold component SGP comprises a protein scaffold GBD, a protein scaffold SH3 and a protein scaffold PDZ.

[0030] In some embodiments, the genes egtB, egtD and egtE are derived from Mycobacterium smegmatis.

[0031] Exemplarily, the egtB comprises a nucleic acid fragment with a sequence as set forth in SEQ ID NO: 1.

[0032] In some embodiments, the sequence of the egtB is as set forth in SEQ ID NO: 1.

[0033] Exemplarily, the egtD comprises a nucleic acid fragment with a sequence as set forth in SEQ ID NO: 2.

[0034] In some embodiments, the sequence of the egtD is as set forth in SEQ ID NO: 2.

[0035] Exemplarily, the egtE comprises a nucleic acid fragment with a sequence as set forth in SEQ ID NO: 3.

[0036] In some embodiments, the sequence of the egtE is as set forth in SEQ ID NO: 3.

[0037] In the present application, unless otherwise specified, "nucleic acid" has the standard definition in the technical field, also known as "polynucleotide", is a kind of biological macromolecule polymerized by multiple nucleotide monomers through phosphodiester bond, which carries genetic information and is an important component in living organisms. Nucleic acid can be divided into two categories: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

[0038] In some embodiments, the protein scaffold GBD in the protein scaffold component SGP comprises an amino acid fragment with a sequence as set forth in SEQ ID NO: 4 or with a sequence identity of more than 85%, more than 90%, more than 95%, more than 98% or more than 99% thereof; exemplarily, the sequence of the protein scaffold GBD is as set forth in SEQ ID NO: 4.

[0039] In some embodiments, the protein scaffold SH3 comprises an amino acid fragment with a sequence as set forth in SEQ ID NO: 5 or with a sequence identity of more than 85%, more than 90%, more than 95%, more than 98% or more than 99% thereof; exemplarily, the sequence of the protein scaffold SH3 is as set forth in SEQ ID NO: 5.

[0040] In some embodiments, the protein scaffold PDZ comprises a sequence as set forth in SEQ ID NO: 6 or a fragment of an amino acid sequence having more than 85%, more than 90%, more than 95%, more than 98% or more than 99% sequence identity thereto; illustratively, the sequence of the protein scaffold PDZ is as set forth in SEQ ID NO: 6.

[0041] “Identity” (percent (%) sequence identity) of an amino acid sequence or a nucleic acid sequence is defined as the percentage of amino acid residues (or nucleotides) in a candidate sequence that coincide with those of a reference sequence, upon alignment of the candidate sequence and the reference sequence (introducing gaps, if necessary, to achieve the maximum number of identical amino acids or nucleic acids). In other words, the percent (%) sequence identity of an amino acid sequence (or nucleic acid sequence) can be calculated by dividing the number of amino acid residues (or bases) that are identical to those of the reference sequence against which it is compared by the total number of amino acid residues (or bases) in the candidate sequence or the reference sequence (whichever is shorter). Conservative substitutions of amino acid residues can or can not be considered identical residues. Alignment for determining percent (%) sequence identity can be achieved, for example, using publicly available tools such as BLASTN, BLASTp (available on the website of the U.S. National Center for Biotechnology Information (NCBI), see also Altschul S.F. et al., J. Mol. Biol. 215:403-410 (1990); Stephen F. et al., Nucleic Acids Res., 25:3389-3402 (1997)), ClustalW2 (available on the website of the European Bioinformatics Institute, see also Higgins D.G. et al., Methods in Enzymology, 266:383-402 (1996); Larkin M.A. et al. Bioinformatics (Cambridge, England), 23(21):2947-8 (2007)), and ALIGN or Megalign (DNASTAR) software. The default parameters provided by the tools or can be appropriately tailored to the needs of the alignment by the person skilled in the art, for example by choosing a suitable algorithm.

[0042] As used herein, the term “amino acid” refers to an organic compound that includes an amino (-NH2) and carboxyl (-COOH) functional group, as well as a side chain that is specific to each amino acid. Amino acid names are also denoted in the present application as standard one-letter or three-letter codes, summarized as follows.

[0043]

[0044] In some embodiments, in the manner that the protein scaffold assembly SGP assembles the gene encoding ergot alkaloid biosynthetic enzymes, the nucleic acid fragment encoding the protein scaffold GBD is located upstream of the egfB, and the two constitute a first nucleic acid fragment.

[0045] In some embodiments, in the manner that the protein scaffold assembly SGP assembles the gene encoding ergot alkaloid biosynthetic enzymes, the nucleic acid fragment encoding the protein scaffold SH3 is located upstream of the egfD, and the two constitute a second nucleic acid fragment.

[0046] In some embodiments, in the manner that the protein scaffold assembly SGP assembles the gene encoding ergot alkaloid biosynthetic enzymes, the nucleic acid fragment encoding the protein scaffold PDZ is located downstream of the egfE, and the two constitute a third nucleic acid fragment.

[0047] Without wishing to be bound by any theory, it is believed that one or more of the first nucleic acid fragment, the second nucleic acid fragment, and the third nucleic acid fragment can be integrated in the genome of the genetically engineered bacteria, or included in the same or different recombinant expression vectors.

[0048] Unless otherwise indicated, the term "vector" in the present application refers to a vehicle into which a genetic element (e.g., the aforementioned nucleic acid molecule) can be operatively inserted and expressed. The vector can be, for example, a plasmid, a cosmid, a virus (e.g., a lentivirus, a retrovirus, an adenovirus, and an adeno-associated virus), an RNA vector, or a linear or circular DNA or RNA molecule, which can include chromosomal, non-chromosomal, semi-synthetic, or synthetic nucleic acid molecules. The term includes both vectors that are self-replicating nucleic acid structures as well as vectors that are incorporated into the genome of the host cell into which they have been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked.

[0049] In some embodiments, the backbone of the recombinant expression vector comprises pTrc99A.

[0050] wherein one or more of the first nucleic acid fragment, the second nucleic acid fragment, and the third nucleic acid fragment can be integrated into the genome by linear plasmid transformation, and each of the first nucleic acid fragment, the second nucleic acid fragment, and the third nucleic acid fragment can be independently comprised in different expression cassettes of the same linear plasmid.

[0051] In some embodiments, the first nucleic acid fragment, the second nucleic acid fragment, and the third nucleic acid fragment are simultaneously comprised in the same recombinant expression vector.

[0052] In some embodiments, the same recombinant expression vector contains, from the 5' end to the 3' end, the first nucleic acid fragment, the second nucleic acid fragment, and the third nucleic acid fragment in sequence.

[0053] In some embodiments, the chassis bacteria of the genetically engineered bacteria include, but are not limited to, Escherichia coli, such as MG1655.

[0054] In some embodiments, ergothioneine synthases egtB, egtD, and egtE derived from M. smegmatis are linked to plasmid pTrc99A; (2) a protein scaffold GBD is linked before egtB; (3) a protein scaffold SH3 is linked before egtD; (4) a protein scaffold PDZ is linked after egtE; (5) the above strains are fermented and cultured to detect cell growth and ergothioneine yield.

[0055] Another aspect of this application provides a recombinant expression vector comprising the genes egtB, egtD, and egtE encoding ergothionein synthase, and a nucleic acid fragment encoding a protein scaffold component SGP.

[0056] The genes egtB, egtD, and egtE, the protein scaffold assembly SGP, and their positional relationships are as defined above.

[0057] In some embodiments, the recombinant expression vector comprises, from the 5' end to the 3' end, the first nucleic acid fragment, the second nucleic acid fragment, and the third nucleic acid fragment.

[0058] In some embodiments, the recombinant expression vector is a combination product, each of which independently comprises one or more of the first nucleic acid fragment, the second nucleic acid fragment, and the third nucleic acid fragment.

[0059] In some embodiments, the plasmid backbone available for the recombinant expression vector is, for example, pTrc99A.

[0060] Another aspect of this application provides a method for preparing ergothioneine, comprising:

[0061] Culture the genetically engineered bacteria as described above and prepare a culture medium;

[0062] Ergothionein was isolated from the culture medium.

[0063] In some embodiments, in the step of preparing the culture solution, the culture medium used comprises: 15 g / L to 20 g / L glucose, 0.7 g / L to 0.9 g / L magnesium sulfate heptahydrate, 3 g / L to 5 g / L diammonium phosphate, 6 g / L to 7 g / L potassium dihydrogen phosphate, 1 g / L to 1.5 g / L potassium citrate, 20 g / L to 21 g / L 3-morpholinosulfonic acid, 2 g / L to 3 g / L yeast powder, 45 mg / L to 55 mg / L ferrous sulfate heptahydrate, 9 mg / L to 11 mg / L calcium chloride dihydrate, 10 mg / L to 12 mg / L zinc sulfate heptahydrate, 2 mg / L to 3 mg / L manganese sulfate tetrahydrate, 4 mg / L to 6 mg / L copper sulfate pentahydrate, 0.45 mg / L to 0.55 mg / L ammonium molybdate, 0.08 mg / L to 0.12 mg / L sodium borate decahydrate, 0.8 g / L to 1.2 g / L histidine, 1.2 g / L to 1.8 g / L cysteine, and 4 g / L to 6 g / L methionine.

[0064] In some embodiments, the concentration of glucose in the culture medium is 15 g / L, 16 g / L, 17 g / L, 18 g / L, 19 g / L, 20 g / L, or a range between any two of the values.

[0065] For example, the culture medium comprises: 20 g / L glucose, 0.8 g / L magnesium sulfate heptahydrate, 4 g / L diammonium phosphate, 6.67 g / L potassium dihydrogen phosphate, 1.35 g / L potassium citrate, 20.9 g / L 3-morpholinosulfonic acid, 2.5 g / L yeast powder, 50 mg / L ferrous sulfate heptahydrate, 10 mg / L calcium chloride dihydrate, 11 mg / L zinc sulfate heptahydrate, 2.5 mg / L manganese sulfate tetrahydrate, 5 mg / L copper sulfate pentahydrate, 0.5 mg / L ammonium molybdate, 0.1 mg / L sodium borate decahydrate, 1 g / L histidine, 1.5 g / L cysteine, and 5 g / L methionine.

[0066] In some embodiments, in the process of preparing the culture solution, the culture conditions comprise: 37°C, and culture at 180 rpm to 220 rpm.

[0067] In some embodiments, the culture is performed to OD 600 For example, the culture is performed to OD

[0068] Unless otherwise specified, the term "OD" in the present application is the abbreviation of optical density. The energy difference before and after the light passing through the detected object is the energy absorbed by the detected object. At a specific wavelength, the concentration of the same detected object and the absorbed energy are in a quantitative relationship. OD 600OD600 is the optical density value measured at wavelength of 600 nm, which is a standard index to track the density of microorganism in liquid culture, and is usually used to indicate the density of bacterial cells. It is a conventional method in the art to detect OD value to indicate the concentration of bacterial cells, and the OD value is linearly related to the concentration of bacterial cells.

[0069] In some embodiments, the culture conditions during the preparation of the culture solution include 37°C and 200 rpm culture.

[0070] Exemplarily, IPTG (isopropyl-β-D-thiogalactoside) is used to induce the culture.

[0071] Some examples are provided below.

[0072] The embodiments of the present application will be described in detail below with reference to examples. It should be understood that the examples are only used to illustrate the present application and not to limit the scope of the present application. The experimental methods not specified in the following examples are preferably referred to the guidance given in the present application, and can also be performed according to the experimental manuals or conventional conditions in the art, or according to the conditions suggested by the manufacturers, or according to the known experimental methods in the art.

[0073] Example 1 Linking ergothioneine synthetase genes egtB, egtD and egtE derived from M. smegmatis to plasmid pTrc99A

[0074] In this example, ergothioneine synthetase egtB (the sequence is shown as SEQ ID NO: 1), egtD (the sequence is shown as SEQ ID NO: 2) and egtE (the sequence is shown as SEQ ID NO: 3) derived from M. smegmatis are linked to plasmid pTrc99A.

[0075] PCR is performed with egtB-F (aattgtgagcggataacaatttaagaaggagatatacatatgatcgcccgtgaaacactt, SEQ ID NO: 7) and egtB-R (caatgaaagggtcatatgtatatctccttcttaaattatacgtcccatgctaaacgcacg, SEQ ID NO: 8) as primers to obtain a gene fragment egtB of about 1500 bp and perform PCR product purification.

[0076] PCR was performed with primers egtD-F (atgggacgtataatttaagaaggagatatacatatgaccctttcattggcaaactacc, SEQ ID NO: 9) and egtD-R (ttgttgtgctaacatcatatgtatatctccttcttaaatcagcgaacggcaagggaaa, SEQ ID NO: 10) to obtain a gene fragment egtD of about 1000 bp and PCR product purification was performed.

[0077] PCR was performed with primers egtE-F (gccgttcgctgatttaagaaggagatatacatatgatgttagcacaacaatggcgt, SEQ ID NO: 11) and egtE-R (ccaagcttgcatgcctgcaggtcgactctagaggatccaggggcttcacgtaacgcg, SEQ ID NO: 12) to obtain a gene fragment egtE of about 1200 bp and PCR product purification was performed. The fragments egtB, egtD, egtE were ligated to the vector pTrc99A to obtain a recombinant plasmid named pTrc99A-egtBDE. The recombinant plasmid pTrc99A-egtBDE was transformed into Escherichia coli MG1655 (hereinafter referred to as "MG1655") by electroporation (Jiang, et al. 2015) to obtain a recombinant strain named MG1655 / pTrc99A-egtBDE.

[0078] Example 2 Linking the protein scaffold GBD to the ergot alkaloid biosynthesis enzyme gene egtB

[0079] In this example, the protein scaffold GBD (sequence shown as SEQ ID NO: 4, optimized codon sequence shown as SEQ ID NO: 20) was linked to the ergot alkaloid biosynthesis enzyme egtB.

[0080] The gene fragment GBD of about 240 bp was obtained by PCR using GBD-F (tgagcggataacaatttaagaaggagatatacataccaaggcagatattggaacaccaag, SEQ ID NO: 13) and GBD-R (aagagcaagctcgtcagcaagtgtttcacgggcgatcattggtgcttgccttcggagtt, SEQ ID NO: 14) as primers, and PCR product purification was performed. The fragment SH3 was ligated to the vector pTrc99A, and the obtained recombinant plasmid was named pTrc99A-G-egtBDE. The recombinant plasmid pTrc99A-G-egtBDE was transformed into MG1655 by electroporation (conditions as in Example 1), and the obtained recombinant strain was named MG1655 / pTrc99A-G-egtBDE.

[0081] Example 3 Connecting the protein scaffold SH3 before the ergot alkaloid synthase gene egtD

[0082] In this example, the protein scaffold SH3 (sequence as shown in SEQ ID NO: 5, and the optimized codon sequence as shown in SEQ ID NO: 19) was connected before the ergot alkaloid synthase egtD.

[0083] The gene fragment SH3 of about 170 bp was obtained by PCR using SH3-F (tttagcatgggacgtataatttaagaaggagatatacatgcagagtatgtgcgggccc, SEQ ID NO: 15) and SH3-R (cagccaggtagtttgccaatgaaagggtcatatacttctccacgtaagggacaggaatc, SEQ ID NO: 16) as primers, and PCR product purification was performed. The fragment GBD was ligated to the vector pTrc99A-G-egtBDE, and the obtained recombinant plasmid was named pTrc99A-G-egtB-S-egtDE. The recombinant plasmid pTrc99A-G-egtB-S-egtDE was transformed into MG1655 by electroporation (conditions as in Example 1), and the obtained recombinant strain was named MG1655 / pTrc99A-G-egtB-S-egtDE.

[0084] Example 4 Connecting the protein scaffold PZD after the ergot alkaloid synthase egtE

[0085] In this example, the protein scaffold PZD (sequence as shown in SEQ ID NO: 6, codon sequence after optimization as shown in SEQ ID NO: 21) is connected after ergothioneine synthetase egtE.

[0086] PCR is performed with primers PZD-F (cttgaacaatttgctgccgcgttacgtgaagcccctctccagcggcgccgc, SEQ ID NO: 17) and PZD-R (catgcctgcaggtcgactctagaggatcctcacttgaaatagggtgagacctccttcatgt, SEQ ID NO: 18) to obtain a gene fragment PZD of about 290 bp and the PCR product is purified. The fragment PZD is connected to the vector pTrc99A-G-egtB-S-egtDE to obtain a recombinant plasmid named pTrc99A-G-egtB-S-egtD-egtE-P. The recombinant plasmid pTrc99A-G-egtB-S-egtD-egtE-P is transformed into MG1655 by electroporation (conditions as in Example 1) to obtain a recombinant strain named MG1655 / pTrc99A-G-egtB-S-egtD-egtE-P.

[0087] Example 5 Fermentation of recombinant E. coli to produce ergothioneine

[0088] The recombinant strains MG1655, MG1655 / pTrc99A-egtBDE and MG1655 / pTrc99A-G-egtB-S-egtD-egtE-P are incubated on LB plates overnight. A single colony from the fresh plate is inoculated into a test tube containing 5 ml LB medium, incubated at 37°C, 200 rpm for 12 h.

[0089] Inoculated into a 500 ml baffled flask containing 50 ml fermentation medium at an inoculation amount of 5%, incubated at 37°C, 200 rpm until OD 600 is 0.6, 0.1 mM IPTG is added, and incubated for 48 h in total.

[0090] The fermentation medium formula includes (g / L): glucose 20 g, magnesium sulfate heptahydrate 0.8 g, diammonium phosphate 4 g, potassium phosphate monobasic 6.67 g, potassium citrate 1.35 g, 3-morpholino propanesulfonic acid 20.9 g, yeast powder 2.5 g, ferrous sulfate heptahydrate 50 mg, calcium chloride dihydrate 10 mg, zinc sulfate heptahydrate 11 mg, manganese sulfate tetrahydrate 2.5 mg, copper sulfate pentahydrate 5 mg, ammonium molybdate 0.5 mg, sodium borate decahydrate 0.1 mg, histidine 1 g, cysteine 1.5 g, methionine 5 g.

[0091] The product concentration and the growth of the strain were detected by liquid chromatography during the fermentation process, and the results are shown in Table 1, Table 2, and Figure 1 and Figure 2 The results show that after the ergothioneine synthase assembly protein scaffold, the strain MG1655 / pTrc99A-G-egtB-S-egtD-egtE-P has a large accumulation of ergothioneine without affecting the bacterial body compared with the control strains MG1655, MG1655 / pTrc99A-egtBDE.

[0092] Table 1. Growth of different strains (OD 600 )

[0093]

[0094] Table 2. Ergothioneine yield of different strains (mg / L)

[0095]

[0096] It can be seen that the ergothioneine synthase EgtBDE assembly protein scaffold component SGP can efficiently synthesize ergothioneine.

[0097] Each technical feature of the above-described embodiments can be combined arbitrarily, and in order to make the description simple, each technical feature in the above-described embodiments is not described in all possible combinations, however, as long as the combination of these technical features does not exist contradictory, it should be considered as the scope of the present application.

[0098] The above-described embodiments only express several implementation manners of the present application, and the description is more specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be noted that for ordinary skilled in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are all within the scope of the present application. Therefore, the scope of the patent protection of the present application should be subject to the appended claims, and the description and drawings can be used to explain the content of the claims.

Claims

1. A genetically engineered bacterium, characterized in that, It carries genes egtB, egtD, and egtE that encode ergothionein synthase, and said genes egtB, egtD, and egtE are assembled with a protein scaffold assembly SGP. The protein scaffold assembly SGP includes protein scaffold GBD, protein scaffold SH3, and protein scaffold PDZ. The genes egtB, egtD, and egtE are derived from Mycobacterium smegmatis. The nucleic acid fragment encoding the protein scaffold GBD is located upstream of egtB, and the two constitute the first nucleic acid fragment; the nucleic acid fragment encoding the protein scaffold SH3 is located upstream of egtD, and the two constitute the second nucleic acid fragment; the nucleic acid fragment encoding the protein scaffold PDZ is located downstream of egtE, and the two constitute the third nucleic acid fragment. The sequence of egtB is shown in SEQ ID NO: 1; The sequence of egtD is shown in SEQ ID NO: 2; The sequence of egtE is shown in SEQ ID NO: 3; The sequence of the protein scaffold GBD is shown in SEQ ID NO: 4; The sequence of the protein scaffold SH3 is shown in SEQ ID NO: 5; The sequence of the protein scaffold PDZ is shown in SEQ ID NO: 6; The first nucleic acid fragment, the second nucleic acid fragment, and the third nucleic acid fragment are contained in the same recombinant expression vector; and the recombinant expression vector contains the first nucleic acid fragment, the second nucleic acid fragment, and the third nucleic acid fragment sequentially from the 5' end to the 3' end; The chassis bacteria of the genetically engineered bacteria include Escherichia coli.

2. A recombinant expression vector, characterized in that, It contains genes egtB, egtD, and egtE that encode ergothionein synthase, as well as nucleic acid fragments that encode the protein scaffold component SGP; The genes egtB, egtD, and egtE are as defined in claim 1; The protein scaffold assembly SGP is as defined in claim 1; The relative positions of the genes egtB, egtD, and egtE with the protein scaffold assembly SGP in the recombinant expression vector are as defined in claim 1; and... The recombinant expression vector contains a first nucleic acid fragment, a second nucleic acid fragment, and a third nucleic acid fragment sequentially from the 5' end to the 3' end.

3. A method for preparing ergothioneine, characterized in that, It includes: Culture medium is prepared by culturing the genetically engineered bacteria as described in claim 1; Ergothionein was isolated from the culture medium.

4. The method as described in claim 3, characterized in that, The culture medium used in the preparation of the culture medium includes: 15 g / L~20 g / L glucose, 0.7 g / L~0.9 g / L magnesium sulfate heptahydrate, 3 g / L~5 g / L diamine hydrogen phosphate, 6 g / L~7 g / L potassium dihydrogen phosphate, 1 g / L~1.5 g / L potassium citrate, and 20 g / L~21 g / L... 3-Morpholine propanesulfonic acid, 2 g / L~3 g / L yeast extract, 45 mg / L~55 mg / L ferrous sulfate heptahydrate, 9 mg / L~11 mg / L calcium chloride dihydrate, 10 mg / L~12 mg / L zinc sulfate heptahydrate, 2 mg / L~3 mg / L manganese sulfate tetrahydrate, 4 mg / L~6 mg / L copper sulfate pentahydrate, 0.45 mg / L~0.55 mg / L ammonium molybdate, 0.08 mg / L~0.12 mg / L sodium borate decahydrate, 0.8 g / L~1.2 g / L histidine, 1.2 g / L~1.8 g / L cysteine, and 4 g / L~6 g / L methionine.

5. The method as described in claim 3 or 4, characterized in that, The culture conditions for preparing the culture medium include: 37℃, 180rpm~220rpm; and culture until OD... 600 When the concentration is 0.55~0.65, induction culture is performed.

Citation Information

Patent Citations

  • Construction method of metabolic engineering escherichia coli for producing ectoine

    CN116656587A

  • Bacterial strain for producing ergothioneine, biological material, production method and application

    CN119101636A