A VIGS silencing system for the QfPDS gene of Quercus white oak, and its construction method and application

Abstract

The present invention discloses a VIGS silencing system for the QfPDS gene of white oak, as well as a construction method and application thereof, belonging to the field of plant genetic engineering technology. The VIGS silencing system for the QfPDS gene of white oak comprises a specific fragment for silencing the QfPDS gene of white oak, the nucleotide sequence of which is shown in SEQ ID NO.7. The present invention successfully constructs a VIGS silencing system for the QfPDS gene of white oak for the first time and successfully silences the QfPDS gene of white oak. The VIGS silencing system of the present invention can effectively reduce the expression level of the QfPDS gene of white oak, and the leaves exhibit an albino phenotype.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to a Quercus alba QfPDS gene VIGS silencing system and a construction method and application thereof. Background Art

[0002] Virus-induced gene silencing (VIGS), a transient transformation technique, can produce gene-silenced plants without relying on genetic transformation systems, compared to methods such as transgenics, gene knockout, and antisense inhibition. It offers advantages such as a shorter timeframe and lower costs, facilitating research in areas previously hindered by a lack of information on gene function. VIGS involves constructing a recombinant viral vector carrying a fragment of an endogenous gene for silencing experiments. VIGS utilizes the plant's immune system to recognize the virus and the target gene, while simultaneously exploiting the plant's post-transcriptional gene silencing (PTGS) mechanism to inhibit viral infection and downregulate endogenous gene expression, resulting in loss of gene function or decreased endogenous mRNA expression levels.

[0003] The phytoene desaturase (PDS) gene is a commonly used reporter gene in VIGS silencing systems. When this gene is silenced, chlorophyll is photochemically degraded, resulting in a photobleached phenotype in the green parts of the plant. TRV-VIGS has been successfully applied to plants such as tomato, tobacco, spinach, potato, banana, corn, and Arabidopsis.

[0004] White oak (Quercus fabri Hance) is a deciduous tree of the genus Quercus in the Fagaceae family, widely distributed in the subtropical regions of my country. It is a precious timber species among oak trees. Its material is hard, wear-resistant and rot-resistant, with dense texture, and it is often used as high-end building materials and home furnishings. Although the application of TRV-VIGS technology in herbaceous and grass plants has achieved remarkable results, its application in woody plants faces many challenges. Because the regulation of gene expression in woody plants is more complex, it becomes more difficult to achieve effective gene silencing at a specific time and space; in addition, woody plants often have strong antiviral mechanisms that can identify and eliminate invading viruses, which greatly reduces the effectiveness of TRV-VIGS in woody plants. Based on this, there have been no reports on the construction of white oak VIGS silencing system. Summary of the Invention

[0005] The present invention aims to provide a VIGS silencing system for the QfPDS gene in white oak, as well as its construction method and application, to address the problems of the prior art. The VIGS silencing system of the present invention can effectively reduce the expression level of the QfPDS gene in white oak, resulting in an albino phenotype in the leaves.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a specific fragment for silencing the Quercus alba phytoene dehydrogenase gene QfPDS, the nucleotide sequence of which is shown in SEQ ID NO.7.

[0008] The present invention also provides a VIGS silencing system of the Quercus alba phytoene dehydrogenase gene QfPDS, wherein the VIGS silencing system has the specific fragment.

[0009] Optionally, the VIGS silencing system further includes a helper plasmid.

[0010] The present invention also provides a method for constructing the VIGS silencing system, comprising the following steps:

[0011] The specific fragment was amplified using the CDS sequence of the Quercus alba phytoene dehydrogenase gene QfPDS as a template;

[0012] The specific fragment is connected to a viral expression vector through the Nimble Cloning system to obtain the VIGS silencing system.

[0013] Optionally, the CDS sequence of the Quercus alba phytoene dehydrogenase gene QfPDS is shown as SEQ ID NO.3; and the primer sequences for amplifying the specific fragment are shown as SEQ ID NOs.5-6.

[0014] The present invention also provides application of the VIGS silencing system in identifying the function of the Quercus alba phytoene dehydrogenase gene QfPDS.

[0015] The present invention also provides a method for identifying the function of the Quercus alba phytoene dehydrogenase gene QfPDS, comprising the steps of down-regulating the Quercus alba phytoene dehydrogenase gene QfPDS using the VIGS silencing system;

[0016] The CDS sequence of the Quercus alba phytoene dehydrogenase gene QfPDS is shown in SEQ ID NO.3.

[0017] Optionally, the method includes the following steps:

[0018] Transforming the VIGS silencing system into Agrobacterium to obtain positive transformation;

[0019] suspending the positively transformed Agrobacterium cells in an infection solution, and infecting birch seedlings with the infection solution containing the positively transformed Agrobacterium cells;

[0020] The infected birch seedlings are continuously cultured, and after the culture is completed, the phenotypic changes of the infected birch seedlings are observed and / or the expression level of the silenced target gene is detected by fluorescence quantitative PCR.

[0021] Optionally, the infection solution comprises 0.4066 g of 10 mM magnesium chloride, 0.4265 g of 10 mM 2-morpholineethanesulfonic acid and 20 μL of 200 mg mL -1 of acetosyringone.

[0022] Optionally, the birch seedlings are birch tissue culture seedlings.

[0023] The present invention discloses the following technical effects:

[0024] The present invention successfully constructed a VIGS silencing system for the QfPDS gene of white oak for the first time and successfully silenced the QfPDS gene of white oak. The VIGS silencing system of the present invention can effectively reduce the expression level of the QfPDS gene of white oak, and the leaves show a whitening phenotype. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0026] Figure 1 The leaf albino phenotype of Quercus alba after the recombinant vector was infected with the white oak in Example 2 of the present invention, wherein (a) is the control group infected with TRV1 and TRV2; (b)-(d) are the plants in the gene silencing test group;

[0027] Figure 2 This is a diagram showing the effect of detecting the QfPDS gene silencing effect of Quercus alba using qRT-PCR in Example 2 of the present invention. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0033] Example 1 Cloning of the Quercus alba QfPDS gene and specific fragments and construction of a recombinant silencing vector

[0034] (1) RNA extraction

[0035] White oak leaf tissue was ground into a powder using liquid nitrogen, and RNA was extracted using the RN38 EASY spinplus Plant RNA Rapid Extraction Kit. First-strand cDNA synthesis was performed according to the instructions of the Goldenstar RT6 cDNA Synthesis Kit. Based on the CDS sequence of QfPDS obtained from white oak genome sequencing, the following primers were designed:

[0036] PDS-F:5'-ATGACCATTGGTGGGTTTGTT-3', SEQ ID NO.1,

[0037] PDS-R: 5'-TCAATAAACACTTGCTTGAGC-3', SEQ ID NO. 2.

[0038] The cDNA sequence of QfPDS was amplified by PCR using MCLAB high-fidelity enzyme.

[0039] The PCR reaction system is shown in Table 1.

[0040] Table 1 PCR reaction system

[0041]

[0042]

[0043] The PCR reaction procedure was as follows: pre-denaturation at 98°C for 2 minutes; 35 cycles of denaturation at 98°C for 10 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 30 seconds; and extension at 72°C for 5 minutes. The PCR product was run on an agarose gel and the target fragment was recovered using a DNA gel recovery kit. The target fragment sequence is shown in SEQ ID NO. 3, and the amino acid sequence encoded by this fragment is shown in SEQ ID NO. 4.

[0044] SEQ ID NO.3:

[0045]

[0046] SEQ ID NO.4:

[0047] .

[0048] (2) Cloning of the specific fragment of the Quercus alba QfPDS gene

[0049] Using the full-length sequence of the Quercus white oak QfPDS gene as a template, primers were designed to amplify a 250-300 bp specific fragment within the CDS domain of the QfPDS gene:

[0050] PDS-TRV2-F: 5'-agtggtctctgtccagtcctTGAAGAACAATGAGATGCTGA-3', SEQ ID NO. 5; PDS-TRV2-R: 5'-ggtctcagcagaccacaagtGAACCATTCTTCTCCTGAAGA-3', SEQ ID NO. 6.

[0051] The QfPDS gene-specific fragment was cloned by PCR using MCLAB high-fidelity enzyme. The PCR reaction system and reaction procedure were the same as above.

[0052] (3) Construction of recombinant silencing vector

[0053] The VIGS viral vector used in this invention is the tobacco mosaic virus (TRV), an RNA virus. The TRV system comprises two vectors: TRV1 and TRV2. TRV1 serves as a helper vector, while TRV2 is used to construct a recombinant vector containing the silencing fragment. TRV1 and TRV2 must be mixed to ensure optimal replication and propagation in plant cells, ensuring the stability and effectiveness of the system and achieving gene silencing.

[0054] The QfPDS gene-specific fragment was directly cloned into the circular expression vector TRV2 of the Nimble Cloning (NC cloning) system using Nimble Mix to obtain the recombinant vector pTRV2-QfPDS.

[0055] The reaction system for cloning and ligation is shown in Table 2. Add the sample at room temperature, mix gently, centrifuge briefly, and incubate at 50°C for 60 minutes to complete the ligation reaction.

[0056] Table 2 Reaction system of NC cloning

[0057] NimbleMix 5μL NC-TRV vector 20-120ng PCR product recovery 40ng <![CDATA[ddH2O]]> to10μL Total 10 μL

[0058] Add 5 μL of the ligation product to 50 μL of competent E. coli DH5α in an ice-water mixture, flick gently to mix, and place on ice for 30 minutes; heat shock at 42°C for 60 seconds; let it stand on ice for 2-3 minutes; add 700 μL of LB liquid medium without antibiotics; shake and culture at 200 rpm and 37°C for 1 hour; centrifuge at 3,000 rpm for 1 minute; discard 600 μL of the supernatant, suspend the bacteria, and apply an appropriate amount of the bacterial solution to a plate containing 50 mg·L -1 Amp was grown on LB solid medium at 37°C overnight until a single colony was grown. Positive clones were detected and sequenced to obtain a QfPDS gene-specific fragment, the nucleotide sequence of which is shown in SEQ ID NO. 7. The extracted positive plasmid was the successfully connected recombinant vector pTRV2-QfPDS.

[0059] SEQ ID NO.7:

[0060] TGAAGAACAATGAGATGCTGACTTGGCCAGATAAAGTCAAGTTTGCGATTGGACTCTTGCCGGCAATGCTTGGTGGACAGGCTTATGTTGAAGCTCAAGATGGTTTAACTGTTAAAGAGTGGATGAGAAAGCAG GGAGTACCTGATCGTGTAACTGATGAGGTATTTGTAGCCATGTCAAAGGCACTAAACTTCATTAACCCCGATGAACTTTCAATGCAATGCATATTGATTGCTTTGAATAGGTTTCTCAGGAGAAGAATGGTTC.

[0061] Example 2 Functional identification of the Quercus alba QfPDS gene

[0062] Agrobacterium GV3101 was transformed with auxiliary plasmid TRV1, plasmid TRV2 (negative control) and recombinant vector pTRV2-QfPDS, respectively. Positive monoclonal colonies were picked and added to 1 mL of LB liquid medium containing kanamycin resistance and shaken until the OD value was 0.8-1.0. Then 1 mL was added to 100 mL of LB liquid medium containing kanamycin resistance and shaken until the OD value was 0.8-1.0. The bacterial solution was centrifuged at 5000 rpm for 5 minutes and the supernatant was discarded. The cells were suspended with infection solution and centrifuged again to collect the cells. The infection solution was added and suspended to OD 600 The value is 0.8 (the turbidity level is consistent when viewed with the naked eye), and incubate in a 28°C incubator for 2-4 hours.

[0063] The infection solution (200 mL volume, pH 5.2) components: 0.4066 g 10 mM magnesium chloride (MgCl2·6H2O), 0.4265 g 10 mM 2-morpholinoethanesulfonic acid (MES) and 20 μL 200 mg·mL -1 of acetosyringone (AS).

[0064] The infection solution carrying the TRV1 vector was mixed with the infection solution carrying the TRV2 vector and the infection solution carrying the recombinant vector pTRV2-QfPDS in a volume ratio of 1:1 to prepare two mixed bacterial solutions, which were used to infect white oak tissue culture seedlings. Among them, the infection solutions carrying the TRV1 vector and the TRV2 vector were used as negative controls (WT), and the infection solutions carrying the TRV1 vector and the recombinant vector pTRV2-QfPDS were used as treatment experiments (QfPDS).

[0065] Select uniformly grown tissue culture seedlings and remove the browned base. Place the seedlings and infection solution in a 100mL syringe and manually vacuum-inject the Agrobacterium into the leaves until all leaves are completely saturated. Infected tissue culture seedlings are grown at 22°C under a 14h / 10h light / dark cycle. After 22 days, observe leaf phenotypic changes and examine QfPDS expression in the leaves.

[0066] The results are as follows Figure 1 As shown, QfPDS1, QfPDS2 and QfPDS3 are three replicates of infection solution carrying the recombinant vector pTRV2-QfPDS. Figure 1 It can be seen that the leaves of white oak infected with the recombinant vector pTRV2-QfPDS showed obvious albinism phenotype.

[0067] The leaves of birch tissue culture seedlings obtained under different treatments were taken and RNA was extracted. Actin was used as the internal reference gene to detect the expression level of the target gene after silencing by RT-PCR. The detection primers of the internal reference gene were QfActin-qRT-F: GATTCTGGT GATGGTGTGAGC (SEQ ID NO.8) and QfActin-qRT-R: ATGAGAGATGGCTGGAAGAGT (SEQ ID NO.9). The detection primers of the target gene were (F: TGAAGAACAATGAGATGCTGA, SEQ ID NO.10; R: GAACCATTCTTCTCCTGAAGA, SEQ ID NO.11). The detection results are shown in Figure 2. Figure 2 As shown by Figure 2 It can be seen that compared with the control WT, the expression level of the QfPDS gene in leaves infected with the recombinant vector pTRV2-QfPDS was significantly reduced.

[0068] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A specific fragment for silencing the white oak phytoene dehydrogenase gene QfPDS, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

7.

2. A VIGS silencing system for the white oak phytoene dehydrogenase gene QfPDS, characterized in that: The VIGS silencing system includes two TRV vectors, TRV1 and TRV2; TRV1 is an auxiliary vector, and TRV2 is a recombinant vector containing the specific fragment according to claim 1.

3. A method for constructing the VIGS silencing system according to claim 2, characterized in that: The following steps are involved: The specific fragment was amplified using the CDS sequence of the Quercus alba phytoene dehydrogenase gene QfPDS as a template; The specific fragment is connected to a viral expression vector through the Nimble Cloning system to obtain the VIGS silencing system; the VIGS silencing system includes two TRV vectors, TRV1 and TRV2; TRV1 is an auxiliary vector, and TRV2 is a recombinant vector connected with the specific fragment; The CDS sequence of the Quercus alba phytoene dehydrogenase gene QfPDS is shown in SEQ ID NO. 3; The primer sequences used to amplify the specific fragments are shown in SEQ ID NO.5-6.

Images