An sgRNA combination with efficient targeting to the sheep P53 gene and its application

Abstract

The present invention relates to an efficient targeting sheep in the field of mutation or genetic engineering P53 sgRNA combination of genes and its application. The present invention provides the application of substances that regulate the activity or content of P53 in the preparation of products for improving the cell mutation efficiency; wherein P53 The nucleotide sequence of the coding gene is Gene ID: 443421, and the update date is March 5, 2024; the substance that regulates the activity or content of P53 is a molecule containing SEQ ID No: 3 or / and SEQ ID No: 4, which can improve the sheep cell mutation efficiency by targeting P53 the coding gene and can be applied to the construction of cell models.

Description

Technical Field

[0001] The present invention relates to a combination of sgRNAs for efficiently targeting sheep P53 genes and its application in the field of mutation or genetic engineering. Background Art

[0002] The CRISPR / Cas9 system is a genome-directed editing technology developed in recent years. This system consists of three parts: Cas9 endonuclease, CRISPR RNA (crRNA, which is identical to the genomic target site sequence), and trans-activating CRISPR RNA (tracrRNA). Among them, crRNA and tracrRNA can be fused and simplified into single-guide RNA (sgRNA). The Cas9 protein can scan the PAM sequence (5'-NGG-3') in the genome under the guidance of sgRNA, identify and cleave the single-stranded DNA that is identical and complementary to the crRNA sequence, thereby inducing double-stranded DNA breaks at the target site and activating two repair mechanisms of the cell, namely non-homologous end joining (NHEJ) and homology-directed repair (HDR), to achieve precise editing of the target gene. The CRISPR / Cas9 system has the characteristics of being easy to operate and highly efficient, and is widely used in the research of biology, medicine, agriculture and other fields. In large animals, the main uses of the CRISPR / Cas9 system include creating large animal models of human diseases, improving production traits, disease-resistant breeding, and preparing large animal bioreactors, etc.

[0003] P53 is an important transcription factor and is recognized as the "genome guard" of cells. P53 regulates the transcription of numerous target genes and coordinates multiple signaling pathways. Its classical functions mainly include inducing apoptosis, controlling the cell cycle process, promoting DNA damage repair, etc. In addition, P53 also plays important non-classical functions in aspects such as tissue regeneration and cell proliferation induced by apoptosis, coordinated growth, cell senescence, cell competition, autophagy, and the adaptive response to nutritional stress at the organism level. P53 It is also an important tumor suppressor gene that inhibits the transformation of normal cells into cancer cells. In more than 50% of all human cancers, mutations in this gene occur, and in human malignant tumors, this proportion can reach more than 80%. It is the gene with the highest correlation with human tumors discovered so far.

[0004] Based on the CRISPR / Cas9 system P53 Mutation gene editing cell models and animal models are powerful tools for cancer basic and clinical research. The team of Academician Zhou Qi from the Institute of Zoology, Chinese Academy of Sciences, targeted rhesus monkeys P53Six sgRNAs were designed for the gene, and the results of T7EI detection showed that P53 the gene editing efficiency was 17 - 34%; Professor We Hongjiang's team at Yunnan Agricultural University designed corresponding sgRNAs for the 4th and 5th exons of the P53 gene respectively, P53 and the gene editing efficiencies were 61.9% and 50% respectively. The team of Takeshige Otoi at Tokushima University, Japan, designed two sgRNAs for the 3rd and 4th exons of the P53 gene, and 6 out of the 9 obtained offspring carried P53 mutations, with a gene editing efficiency of 66.7%. From the above examples, it can be seen that with the continuous maturity and improvement of the CRISPR gene editing technology, P53 the gene editing efficiency is also gradually increasing. However, considering the long creation cycle and high cost of gene - edited large animals, further screening for P53 sgRNAs with higher gene targeting efficiency to prepare P53 gene - mutated large - animal cancer models for humans more quickly, efficiently, and at low cost still has important research value. Summary of the Invention

[0005] The main problem to be solved by the present invention is how to improve P53 the gene editing efficiency.

[0006] To solve the above problem, the present invention provides an application of a substance for regulating the activity or content of P53.

[0007] The present invention provides an application of a substance for regulating the activity or content of P53 in the preparation of a product for improving the cell mutation efficiency; the P53 nucleotide sequence of the encoding gene is Gene ID: 443421, updated on March 5, 2024; the product is an RNA molecule containing SEQ ID No: 3 or / and SEQ ID No: 4.

[0008] In the above application, the regulation of the activity or content of P53 can be to down - regulate or inhibit or reduce the activity or content of P53.

[0009] In the above application, the substance for regulating the activity or content of P53 can be a substance containing any one of the following:

[0010] g1) A single - stranded RNA molecule with a nucleotide sequence of SEQ ID No: 3;

[0011] g2) A single - stranded RNA molecule with a nucleotide sequence of SEQ ID No: 4;

[0012] g3) A double-stranded DNA molecule consisting of nucleotide sequences SEQ ID No:5 and SEQ ID No:6;

[0013] g4) A double-stranded DNA molecule consisting of nucleotide sequences SEQ ID No:7 and SEQ ID No:8.

[0014] In the above applications, the improvement of cell mutation efficiency can be the improvement of sheep cell mutation efficiency.

[0015] In the above applications, the manifestation of the improvement of cell mutation efficiency can be any one of the following:

[0016] B1) Improvement of monoclonal cell level P53 Gene mutation efficiency;

[0017] B2) Improvement of biallelic homozygous mutation efficiency.

[0018] The single-stranded RNA molecules described above also fall within the scope of protection of the present invention.

[0019] The present invention also provides products for improving cell mutation efficiency, and the products can be any one of the following:

[0020] g1) A single-stranded RNA molecule with a nucleotide sequence of SEQ ID No:3;

[0021] g2) A single-stranded RNA molecule with a nucleotide sequence of SEQ ID No:4;

[0022] g3) A double-stranded DNA molecule consisting of nucleotide sequences SEQ ID No:5 and SEQ ID No:6;

[0023] g4) A double-stranded DNA molecule consisting of nucleotide sequences SEQ ID No:7 and SEQ ID No:8.

[0024] The present invention also provides biological materials, and the biological materials can be any one of the following:

[0025] 1) A recombinant vector containing the single-stranded RNA molecule described above;

[0026] 2) A recombinant microorganism containing the recombinant vector described in 1);

[0027] 3) A recombinant cell containing the recombinant vector described in 1);

[0028] 4) An animal cell line containing the recombinant vector described in 1);

[0029] 5) An animal tissue containing the recombinant vector described in 1);

[0030] 6) An animal organ containing the recombinant vector described in 1).

[0031] In a specific embodiment, the recombinant vector may be recombinant plasmids pX458-P53 sgRNA1 and pX458-P53 sgRNA2.

[0032] The structure of the recombinant plasmid pX458-P53 sgRNA1 is described as follows: The fragment between 5'-caccgggtcttcgagaagacct-3' and 5'-aaacaggtcttctcgaagaccc-3' of the pX458 vector is replaced with the Mix1 sticky-end sequence formed after annealing SEQ ID No:5 and SEQ ID No:6, and the other sequences of the pX458 vector are kept unchanged to obtain the recombinant vector, which is named recombinant plasmid pX458-P53 sgRNA1.

[0033] pX458-P53 sgRNA1 contains an sgRNA1 gene expression cassette with the nucleotide sequence 5'-gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgGACCTGCCCAGTGCAGCTATgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt-3' (SEQ ID No:9). The sgRNA1 gene is shown as the nucleotides at positions 251-346 of SEQ ID No:9. The nucleotides at positions 1-241 are the promoter for initiating the transcription of the sgRNA1 gene, and the nucleotides at positions 347-352 are the termination sequence for terminating the transcription of the sgRNA1 gene.

[0034] The structure of the recombinant plasmid pX458-P53 sgRNA2 is described as follows: The fragment between 5’-caccgggtcttcgagaagacct-3’ and 5’-aaacaggtcttctcgaagaccc-3’ of the pX458 vector was replaced with the sticky-end sequence of Mix2 formed by annealing SEQ ID No:7 and SEQ ID No:8, and other sequences of the pX458 vector were kept unchanged to obtain a recombinant vector, which was named recombinant plasmid pX458-P53 sgRNA2.

[0035] pX458-P53 sgRNA2 contains an sgRNA2 gene expression cassette with the nucleotide sequence of 5’-gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgGAAGCTGGAGCACATGACGGgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt-3’ (SEQ ID No:10). The sgRNA2 gene is shown as the nucleotides at positions 251-346 of SEQ ID No:10. The nucleotides at positions 1-241 are the promoter for initiating the transcription of the sgRNA2 gene, and the nucleotides at positions 347-352 are the termination sequence for terminating the transcription of the sgRNA2 gene.

[0036] The present invention also provides the application of the aforementioned biomaterial in improving the cell mutation efficiency.

[0037] In the aforementioned biomaterial or the aforementioned application, the cell can be a monoclonal cell.

[0038] Furthermore, the cell can be an ovine fetal fibroblast cell.

[0039] The object of the present invention is to provide a combination of sgRNAs that can efficiently target ovine P53 genes and its application, so as to solve the problem that the gene editing efficiency of large animals P53 is not high enough, and to provide P53Provide technical support for the efficient creation of gene-edited sheep (human large animal cancer models). BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 For sheep P53 Schematic diagram of gene structure and sgRNA target sites. sgRNA target site 1 (sgRNA1) is located at P53 Gene ( P53 The nucleotide sequence of the gene is Gene ID: 443421, updated on March 5, 2024), at positions 9252-9271, and sgRNA target site 2 (sgRNA2) is located at P53 Positions 9327-9346 of the gene.

[0041] Figure 2 For the sheep monoclonal cell level P53 Table of gene mutation efficiency statistics.

[0042] Figure 3 Figure 24 is a PCR gel electrophoresis diagram of 27 monoclonal cells identified by PCR using primer sets PCR-F: 5'-tgtacattcgacccttgggtact-3' and PCR-R: 5'-ccaccgctcaccatcgctatagt-3'. Among them, + / + represents wild type, - / - represents homozygous mutation of both alleles, and l / l represents mutation of at least one allele.

[0043] Figure 4 For P53 Representative sequencing results of homozygous mutation of both alleles and mutation of at least one allele. Among them, A is the sequencing of 15 homozygous mutations and the corresponding base deletion types (15 mutation types are exactly the same); B is a representative sequencing result selected from 11 single allele mutations or double allele mutations (double peaks represent mutations, and all 11 sequencing results are double peaks). DETAILED DESCRIPTION OF THE INVENTION

[0044] The present invention will be further described in detail below in conjunction with the specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0045] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0046] The primary fetal fibroblasts of sheep in the following examples have been described in: Han Hongbing, M. A. Yonghe, Wang Tao, Lian Ling, Tian Xiuzhi, H. U. Rui, Deng Shoulong, L. I. Kongpan, Wang Feng, L. I. Ning, Liu Guoshi, Zhao Yaofeng and Lian Zhengxing, One-Step Generation of Myostatin Gene Knockout Sheep Via the CRISPR / Cas9 System, Frontiers of Agricultural Science and Engineering, 2014, 1(1): 2. The public can obtain the biological material from the applicant. The biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0047] Example 1: Screening and Application of sgRNA for P53 Gene Editing

[0048] 1. Design P53- crRNA1 and P53- crRNA2

[0049] Log in to the NCBI database (www.ncbi.nlm.nih.gov), search for and download the sheep P53 gene sequence (GeneID: 443421). The full length of the sheep P53 gene is 12903 bp, consisting of 11 exons and 10 introns ( Figure 1 ). According to the sgRNA design principles such as "the length is generally 20 nt; the GC content is preferably between 40 - 60%, avoiding ending with more than 4 Ts; if constructing a U6 promoter-driven sgRNA expression vector, the 5' base of the sgRNA needs to be G or GG to improve its transcription efficiency; designed on an independent exon, as close as possible to the N-terminal position of the protein", for P53Exon 5 of the gene (CDS-4), two crRNAs were artificially designed. The lengths of crRNA1 and crRNA2 are both 20 nt, and the GC content is 60%. The specific sequences are crRNA1: 5'-GACCUGCCCAGUGCAGCUAU-3' (SEQ ID No:1), and the target sequence corresponding to crRNA1 is: 5’-GACCTGCCCAGTGCAGCTAT-3’, crRNA2: 5'-GAAGCUGGAGCACAUGACGG-3' (SEQ ID No:2), and the target sequence corresponding to crRNA2 is: 5’- GAAGCTGGAGCACATGACGG-3’ ( Figure 1 ).

[0050] Based on the above two crRNA sequences, two sgRNA sequences were designed. The sgRNA sequence consists of a 20-nt crRNA (variable sequence) and a 76-nt tracrRNA (fixed sequence). The sequence information of sgRNA1 and sgRNA2 is as follows:

[0051] P53 sgRNA1: 5'-GACCUGCCCAGUGCAGCUAUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc-3' (SEQ ID No:3)

[0052] P53 sgRNA2: 5'-GAAGCUGGAGCACAUGACGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc-3' (SEQ ID No:4)

[0053] 2. Construction of pX458-sgRNA1 and pX458-sgRNA2 plasmids

[0054] Two pairs of primers required for the synthesis and construction of pX458-sgRNA1 and pX458-sgRNA2 plasmids were sent to Tsingke Biotechnology. The specific experimental steps are as follows:

[0055] The synthesis primers for crRNA1 are as follows:

[0056] crRNA1-F: 5'-caccg GACCTGCCCAGTGCAGCTAT -3' (SEQ ID No:5);

[0057] crRNA1-R: 5'-aaacatagctgcactgggcaggtcc-3' (SEQ ID No:6);

[0058] The synthesis primers for crRNA2 are as follows:

[0059] crRNA2-F: 5'-caccg gaagctggagcacatgacgG -3' (SEQ ID No:7);

[0060] crRNA2-R: 5'-aaacccgtcatgtgctccagcttcc-3' (SEQ ID No:8).

[0061] After the above oligos were synthesized, first, phosphorylation treatments were carried out on the two pairs of primers crRNA1-F / crRNA1-R and crRNA2-F / crRNA2-R respectively. The 10 μL system was: 1 μL upstream primer (100 μM), 1 μL downstream primer (100 μM), 1 μL T4 ligation buffer (10×), 1 μL T4 PNK, 6 μL ddH2O. Subsequently, annealing was performed: 30 min at 37 °C, and then cooled from 95 °C to 25 °C at a rate of 5 °C / min to obtain annealing Mix1 and annealing Mix2.

[0062] Subsequently, the commercial pX458 empty plasmid (Addgene plasmid #48138) was digested with BbsI alone. After gel cutting and purification recovery, T4 ligase was used to ligate annealing Mix1 or annealing Mix2 and the gel-cut and recovered pX458 linear plasmid. The ligation conditions were as follows: 1 μL annealing Mix1 or annealing Mix2, 1 μL pX458 digestion product, 1 μL T4 ligation buffer (10×), 1 μL T4 ligation, 6 μL ddH2O, and overnight ligation in a metal bath at 16 °C.

[0063] Finally, the above two ligation products were transformed using DH5α competent cells. After plating for 12 h, single colonies were picked and plasmids were extracted, and then sent to the company for sequencing verification of whether the ligation was correct. Recombinant plasmids pX458-P53 sgRNA1 and pX458-P53 sgRNA2 were obtained respectively.

[0064] The structure of the recombinant plasmid pX458-P53 sgRNA1 is described as follows: The fragment between 5'-caccgggtcttcgagaagacct-3' and 5'-aaacaggtcttctcgaagaccc-3' of the pX458 vector was replaced with the Mix1 sticky-end sequence formed after annealing SEQ ID No:5 and SEQ ID No:6, and the other sequences of the pX458 vector were kept unchanged. The resulting recombinant vector was named recombinant plasmid pX458-P53 sgRNA1.

[0065] pX458-P53 sgRNA1 contains an sgRNA1 gene expression cassette with the nucleotide sequence of 5'-gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgGACCTGCCCAGTGCAGCTATgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt-3' (SEQ ID No:9). The sgRNA1 gene is shown as the nucleotides at positions 251-346 of SEQ ID No:9. The nucleotides at positions 1-241 are the promoter for initiating the transcription of the sgRNA1 gene, and the nucleotides at positions 347-352 are the termination sequence for terminating the transcription of the sgRNA1 gene.

[0066] The structure of the recombinant plasmid pX458-P53 sgRNA2 is described as follows: The fragment between 5'-caccgggtcttcgagaagacct-3' and 5'-aaacaggtcttctcgaagaccc-3' of the pX458 vector was replaced with the Mix2 sticky-end sequence formed after annealing SEQ ID No:7 and SEQ ID No:8, and the other sequences of the pX458 vector were kept unchanged. The resulting recombinant vector was named recombinant plasmid pX458-P53 sgRNA2.

[0067] The pX458-P53 sgRNA2 contains an sgRNA2 gene expression cassette with a nucleotide sequence of 5’-gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgGAAGCTGGAGCACATGACGGgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt-3’ (SEQ ID No:10). The sgRNA2 gene is as shown by the nucleotides at positions 251-346 of SEQ ID No:10. The nucleotides at positions 1-241 are the promoter for initiating the transcription of the sgRNA2 gene, and the nucleotides at positions 347-352 are the termination sequence for terminating the transcription of the sgRNA2 gene.

[0068] 3. Cell transfection

[0069] The constructed pX458-P53 sgRNA1 and pX458-P53 sgRNA2 plasmids were extracted using the Tiangen Plasmid Maxi Kit (DP120), and the concentration had to reach above 1000 ng / μL to be qualified. The preserved ovine primary fetal fibroblasts were revived and passaged for culture. The basic culture medium was DMEM / F12 (gibco, 11320033), supplemented with 10% FBS (gibco, A5256701) and 1% double antibody (gibco, 15070063).

[0070] After the cells grew stably, 1×10 6 cells were taken after trypsin digestion and transfected using the Nucleofector TM 2b electroporator of Lonza company, with the A033 electroporation program and the supporting Basic Nucleofector ®Kit for Primary Mammalian Fibroblasts (VPI-1002) Electroporation Solution Kit. 7.5 μg of pX458-P53 sgRNA1 and 7.5 μg of pX458-P53 sgRNA1 plasmids were electroporated into ovine fetal fibroblasts. 48 h after electroporation, the EGFP-positive single cells (the pX458 plasmid contains a co-expression structure of Cas9 / EGFP / u6-sgRNA) were sorted into two 96-well plates using a BD FACSAria TM III flow cytometer. The basic culture medium was still DMEM / F12, the FBS was increased to 20%, and the antibiotic was changed to 1% triple antibody.

[0071] The sorted 96-well plates were placed in a cell culture incubator for culture. After 10 d, 41 monoclonal colonies were observed under a microscope, and the formation rate was 21.35% ( Figure 2 ).

[0072] 4. Cell Lysis

[0073] Prepare cell lysis buffer: 2 mL of Tris-HCl (1 M, pH = 8.0), 0.45 mL of Triton X-100, 0.45 mL of NP-40, 0.02 g of proteinase K. Add deionized water to dissolve and make up to 50 mL, filter through a 0.22 μm filter, and store at 4°C. Select 27 monoclonal cell lines with good growth. After trypsin digestion, half were continued to be cultured and cryopreserved, and half were lysed using the cell lysis buffer.

[0074] 5. Verification of the preparation efficiency and gene mutation efficiency of ovine fibroblast cell lines

[0075] Design a PCR identification primer set PCR-F / PCR-R, where PCR-F: 5'-tgtacattcgacccttgggtact-3', PCR-R: 5'-ccaccgctcaccatcgctatagt-3', and send it to the company for synthesis. Use PrimeSTAR Max DNA Polymerase (Takara) to amplify the lysis buffer. The PCR reaction system is as follows: 25 μL of PrimeSTAR Max Premix (2×), 1 μL of PCR-F, 1 μL of PCR-R, 1 μL of lysis buffer, 22 μL of ddH2O; the amplification program is as follows: 98°C for 1 min 30 s, 98°C for 10 s + 60°C for 15 s + 72°C for 10 s (35 cycles), 72°C for 10 s, and store at 4°C. After amplification, observe the band size by gel electrophoresis ( Figure 3 ), and send the remaining PCR products to the company for Sanger sequencing to detect whether the monoclonal colonies are mutated.

[0076] The results are as Figure 4 shown: Among the 27 monoclonal cell lines (C1 - C27), gene editing occurred in 26 of them. Among these, 15 monoclonal cells were homozygous mutants (C2 / C3 / C5 / C6 / C8 / C9 / C10 / C11 / C13 / C17 / C21 / C22 / C25 / C26 / C27), and the mutation types were the same. P53 Compared with wild - type cells, both homologous chromosomes of the gene homozygous mutants had the following mutations: P53 In the gene, both genes had the following mutations: P53 A 75 - bp deletion mutation occurred in "5’ - tatgggtcgactcgccgcccccgcccggcacccgcgtccgcgccatggccatctacaagaagctggagcacatga - 3’" (at positions 9269 - 9343 of the gene), resulting in a change in P53 amino acids, thus knocking out the gene. P53 In the gene, both genes had the following mutations: P53 A 75 - bp deletion mutation occurred in "5’ - tatgggtcgactcgccgcccccgcccggcacccgcgtccgcgccatggccatctacaagaagctggagcacatga - 3’" (at positions 9269 - 9343 of the gene), resulting in a change in P53 amino acids, thus knocking out the gene. P53 A 75 - bp deletion mutation occurred in "5’ - tatgggtcgactcgccgcccccgcccggcacccgcgtccgcgccatggccatctacaagaagctggagcacatga - 3’" (at positions 9269 - 9343 of the gene), resulting in a change in P53 amino acids, thus knocking out the gene. Figure 4 In A, a representative sequencing result and the corresponding mutation type were selected from the 15 homozygous mutations; the sequencing results of 11 monoclonal cells were bimodal (C1 / C4 / C7 / C14 / C15 / C16 / C18 / C19 / C20 / C23 / C24), that is, at least one allele had a mutation. Figure 4 In B, a representative sequencing result was selected from the 11 mono - allelic or bi - allelic gene mutations. P53 The preparation efficiency of gene - mutated sheep fibroblast cell lines was as high as 96.3%, and the efficiency of bi - allelic gene homozygous mutation reached 55.56% ( Figure 2 ).

[0077] The above has described the present invention in detail. For those skilled in the art, without departing from the gist and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any changes, uses, or improvements to the present invention, including changes made using conventional techniques known in the art that depart from the scope disclosed in this application.

Claims

1. Use of a substance that regulates P53 activity in the preparation of a product for increasing the mutation efficiency of sheep cells, wherein P53 the nucleotide sequence of the encoding gene is Gene ID: 443421, and the update date is March 5, 2024; The substance for regulating P53 activity is a combination of g1) and g2): g1) A single-stranded RNA molecule with a nucleotide sequence of SEQ ID No: 3; g2) A single-stranded RNA molecule with a nucleotide sequence of SEQ ID No:

4.

2. The application according to claim 1, wherein The improvement in the mutation efficiency of sheep cells is manifested as an increase in the level of monoclonal cells P53 Gene mutation efficiency.

3. The application according to claim 1, wherein The improvement in the mutation efficiency of sheep cells is manifested as an increase in P53 the homozygous mutation efficiency of the P53 gene's double alleles.

4. The combination of single-stranded RNA molecules in the application described in claim 1.

5. Recombinant vector, characterized in that, The recombinant vector is a recombinant vector containing the combination of single-stranded RNA molecules expressed in claim 1.

6. Recombinant microorganism, characterized in that, The recombinant microorganism is a recombinant microorganism containing the recombinant vector described in claim 5.

7. A recombinant cell, characterized in that, The recombinant cell is a recombinant cell containing the recombinant vector described in claim 5; the cell is an ovine fetal fibroblast cell.

8. An animal cell line, characterized in that, The animal cell line is an animal cell line containing the recombinant vector described in claim 5; the cell is an ovine fetal fibroblast cell.

Images