Schizonepeta MYB transcription factor gene StMYB71 and virus-induced gene silencing vector and application thereof

Abstract

The invention relates to a gene engineering body, and particularly discloses a schizonepeta MYB transcription factor gene SMYB71 and a virus-induced gene silencing vector and application thereof. The nucleotide sequence of the gene is as shown in SEQ ID NO.1, and the amino acid sequence of a coded product is as shown in SEQ ID NO.2. A nepeta cataria MYB transcription factor gene StMYB71 is cloned and amplified and is inhibited in a nepeta cataria body, so that a nepeta cataria plant in which the nepeta cataria MYB transcription factor StMYB71 is inhibited is obtained, and the nepeta cataria MYB transcription factor StMYB71 is inhibited. And a yeast one-hybridization technology is used for further determining that StMYB71 interacts with schizonepeta limonene-3-hydroxylase StL3OH to regulate and control the biosynthesis of the schizonepeta monoterpene compound. The schizonepeta MYB transcription factor gene StMYB71 can solve the problem that related MYB transcription factors in schizonepeta, which are synthesized by regulating monoterpene through interaction with StL3OH, are not separated and identified in the existing research. According to the invention, a basis can be provided for genetic engineering for improving schizonepeta and increasing the content of effective components such as pulegone and limonene in schizonepeta.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a schizonepeta MYB transcription factor gene StMYB71 and a virus-induced gene silencing vector and application thereof. Background Art

[0002] Schizonepeta tenuifolia is a plant of the Lamiaceae family and the genus Nepeta, an annual herb. It was first called "false Su" and recorded in "Shennong's Herbal Classic", and the name "Schizonepeta" was first recorded in "Wu Pu's Herbal Classic". It has the effects of dispelling wind, clearing rashes, and eliminating sores. It is commonly used for colds, headaches, measles, rubella, and the initial stage of sores. Schizonepeta volatile oil has pharmacological effects such as antiviral, anti-inflammatory, analgesic, anti-tumor, immunomodulatory, antibacterial, and hemostatic. It is mainly composed of monoterpenes and sesquiterpenoids, such as pulegone, menthone, and caryophyllene. The monoterpenoid compound pulegone is a key component of the medicinal material index of Schizonepeta, which has anti-inflammatory, insecticidal, antipyretic and analgesic effects. Exploring the biosynthesis and regulatory mechanism of pulegone in Schizonepeta is of great significance for revealing the quality changes of Schizonepeta medicinal materials and the screening of high-quality production areas and germplasm seedlings.

[0003] Genome sequencing technology is becoming more and more mature, and the genome sequencing of Nepeta tenuifolia has been completed. Based on genome data and transcriptome data, the biosynthetic pathway of pulegone in Nepeta tenuifolia has been elucidated. Limonene is produced under the catalysis of limonene synthase, using geranyl pyrophosphate (GPP) synthesized by the terpenoid synthesis pathway MEP / MVP as a substrate. Limonene is further hydroxylated and dehydrogenated to obtain isomenthenone. The limonene-3-hydroxylase StL3OH involved in this step has been isolated and identified, and the virus-induced gene silencing system VIGS has been used to find that it is involved in the hydroxylation and dehydrogenation of limonene in Nepeta tenuifolia and the biosynthesis of pulegone. However, the transcription factor that regulates the synthesis of pulegone and limonene in Nepeta tenuifolia by regulating the limonene-3-hydroxylase StL3OH has not yet been isolated and identified. Summary of the invention

[0004] Purpose of the invention: The purpose of the present invention is to solve the problem that the transcription factor gene regulating the monoterpene synthesis pathway in Nepeta has not been isolated and identified in the existing research, and to provide a MYB transcription factor gene StMYB71 and its encoded product and application. The design of the transcription factor gene StMYB71 is of great significance for improving the cultivation of Nepeta and increasing the synthesis of menthane monoterpenes and limonene.

[0005] Technical solution: In order to achieve the above-mentioned purpose, the present invention discloses the nucleotide sequence of the MYB transcription factor gene StMYB71 gene as shown in SEQ ID NO.1.

[0006] The present invention also discloses a product encoded by the above-mentioned schizonepeta MYB transcription factor gene StMYB71, and the amino acid sequence of the encoded product is shown as SEQ ID NO.2.

[0007] The invention also discloses the above-mentioned schizonepeta MYB transcription factor gene StMYB71-specific primers, including an upstream primer: MYB71-F: 5'-cgtgagctcggtaccggatccGAGCGCCGAAGCCGAGTT-3'; and a downstream primer: TPS45-R: 5'-gtgagtaaggttaccgaattcTCACCAAATATCAACAACAATTCTTTC-3'.

[0008] The invention also discloses a gene silencing vector comprising the above-mentioned schizonepeta MYB transcription factor gene StMYB71, and the expression vector is pTRV2.

[0009] The present invention also discloses the application of the above-mentioned schizonepeta MYB transcription factor gene StMYB71 in regulating monoterpenoid compounds, including transferring the schizonepeta MYB transcription factor gene StMYB71 into schizonepeta plants, inhibiting the expression of the schizonepeta MYB transcription factor gene StMYB71 in the host, and the schizonepeta MYB transcription factor gene StMYB71 inhibiting the synthesis of monoterpenoid compounds in schizonepeta.

[0010] The monoterpenoid compounds include pulegone and limonene.

[0011] The present invention also discloses the verification of the interaction between the above-mentioned schizonepeta MYB transcription factor gene StMYB71 and the schizonepeta limonene-3-hydroxylase StL3OH promoter, including transferring the schizonepeta MYB transcription factor gene and the schizonepeta limonene-3-hydroxylase StL3OH promoter into yeast cells, and point-to-point verification of the interaction between the two.

[0012] Compared with the prior art, the beneficial effect of the present invention is that the MYB transcription factor StMYB71 gene of Nepeta provided by the present invention is cloned and prepared from Nepeta plants for the first time. Nepeta MYB transcription factor StMYB71 is a key regulatory gene in the monoterpene synthesis pathway of Nepeta, which can be used to regulate the content of pulegone and limonene in Nepeta, and the protein can be applied to the regulation of the monoterpene biosynthesis pathway of menthanoids and limonene in Nepeta based on the MEP / MVA pathway. The gene provided by the present invention can be used to increase the content of monoterpene compounds such as pulegone and limonene, the active ingredients in Nepeta, through genetic engineering technology, providing a research direction for molecular breeding and improvement of Nepeta. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1This is the agarose gel electrophoresis diagram of the gene silencing fragment of the MYB transcription factor gene StMYB71 of Nepeta tenuifolia;

[0014] Figure 2 is the gene silencing efficiency of the MYB transcription factor gene StMYB71 of Nepeta tenuifolia;

[0015] Figure 3 The changes of limonene content after silencing of the MYB transcription factor gene StMYB71 in Nepeta tenuifolia;

[0016] Figure 4 The change of pulegone content after silencing of the MYB transcription factor gene StMYB71 in Nepeta tenuifolia;

[0017] Figure 5 The expression changes of genes related to the biosynthesis pathway of menthane monoterpenoids after silencing of the MYB transcription factor gene StMYB71 in Nepeta tenuifolia;

[0018] Figure 6 It is a yeast one-hybrid of the MYB transcription factor StMYB71 of Nepeta tenuifolia and the promoter of limonene-3-hydroxylase of Nepeta tenuifolia StL3OHpro. DETAILED DESCRIPTION

[0019] The above and other technical features and advantages of the present invention are described in more detail below in conjunction with the accompanying drawings.

[0020] The technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products. TM Nucleic acid dyes were purchased from Shanghai Biosai Biotechnology Co., Ltd.; GeneJET Gel Extraction Kit was purchased from Thermo Fisher Scientific; 2×RapidTaq Master Mix (P222); FastPure Plant Total RNA Isolation Kit (Polysaccharides & Polyphenolics–rich) (RC401), HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (R312-01 / 02), and DH5α chemically competent cells (C502) were purchased from Novazonic Biotechnology Co., Ltd.; GV3101 competent cells (AC1001) were purchased from Shanghai Weidi Biotechnology Co., Ltd.; restriction endonucleases such as EcoRⅠ (1040A) and BamHⅠ (1010S) were purchased from TaKaRa; sequence primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.; other reagents were imported or domestic analytical grade reagents.

[0021] 1. Cloning of the Silencing Fragment of the MYB Transcription Factor Gene StMYB71 from Nepeta tenuifolia

[0022] The cloning of the StMYB71 silencer fragment used primers: upstream primer: MYB71-F: 5'-cgtgagctcggtaccggatccGAGCGCCGAAGCCGAGTT-3'; downstream primer: TPS45-R: 5'-gtgagtaaggttaccgaattcTCACCAAATATCAACAACAATTCTTTC-3'. The full-length sequence of the gene encoding the MYB transcription factor gene StMYB71 in Nepeta was used as a template for PCR amplification. The amplification system is as follows: 5μL of 2×RapidTaq MasterMix enzyme, 0.2μL of primers MYB71-F and TPS45-R, 1μL of template, and the rest was supplemented with sterile double distilled water. Reaction conditions: 95℃ pre-denaturation for 2min, 95℃ denaturation for 20s, 60℃ annealing for 20s, 72℃ extension for 1min30s, 72℃ extension for 5min after 35 cycles, and storage at 4℃. So far, the silencing fragment of the MYB transcription factor gene StMYB71 in Nepeta tenuifolia has been cloned.

[0023] 2. Construction of gene silencing vector for the MYB transcription factor gene StMYB71 of Nepeta tenuifolia

[0024] The pTRV2 vector was digested with BamHⅠ and EcoRⅠ restriction enzymes. The digestion reaction system was as follows: 40μL pTRV2 vector, 2.5μL BamHⅠ and EcoRⅠ restriction enzymes, and 5μL 10×K buffer. Reaction conditions: digestion at 37℃ for 3 hours. Thus, the linearized pTRV2 vector was obtained. The gene silencing vector of the MYB transcription factor gene StMYB71 of Nepeta tenuifolia was constructed by homologous recombination. Reaction system: 4μL StMYB71 gene silencing fragment, 3μL linearized pTRV2 vector, 2μL 5×CE Buffer, and 1μL Exnase II. Reaction conditions: 37℃ reaction for 30min. Thus, the gene silencing vector of Nepeta tenuifolia StMYB71 was obtained. The gene silencing vector of Nepeta StMYB71 was transformed into Agrobacterium GV3101 competent cells. The transformation method was as follows: after the competent cells were melted on ice, 5 μL of the gene silencing vector of Nepeta StMYB71 was added thereto, followed by standing on ice for 5 min, reacting the standing cells in liquid nitrogen for 5 min, immediately transferred to a 37°C water bath for 5 min, standing on ice for 2 min, adding 700 μL of antibiotic-free LB liquid culture medium thereto, and resuscitated at 28°C 200 rpm for 3 h. The resuscitated cells were spread on LB plates containing 50 mg / L kanamycin and 20 mg / L rifampicin, and cultured at 28°C for 60 h.

[0025] 3. Gene silencing of the MYB transcription factor gene StMYB71 in Nepeta tenuifolia

[0026] The GV3101 strain transformed with the StMYB71 gene silencing vector was cultured in 20 mL of LB liquid medium containing 50 mg / L kanamycin at 28 ° C with shaking until the OD600 was about 0.6. The bacterial solution was centrifuged at 5000 rpm for 10 min at room temperature, the culture medium was discarded to collect the bacteria, the bacteria were resuspended in a buffer containing 10 mM MgCl2 and 10 mM MES and the OD600 was adjusted to 0.4, and acetosyringone was added to it to a final concentration of 20 μM. It was left to stand for activation at 25 ° C in the dark for 3 hours. The activated bacterial solution was mixed with the GV3101 bacterial solution containing pTRV1 activated under the same conditions at a ratio of 1:1. The GV3101 bacterial solution transformed with pTRV2, which does not contain the silencing fragment of the MYB transcription factor StMYB71 of Nepeta, was used as a negative control for further comparative analysis.

[0027] Ten-day-old Nepeta plants were used as infection materials, and the Agrobacterium solution was injected into the Nepeta plants from the back of the leaves using a 1mL syringe. The injected Nepeta was left to stand at 25°C for 24 hours in the dark, and then cultured normally in an incubator for 20 days. The silenced plant leaves were then collected for expression verification and component content determination.

[0028] 4. Verification of Silencing Efficiency and Gene Expression of MYB Transcription Factor Gene StMYB71 in Schizonepeta tenuifolia

[0029] The leaves of the silencing plants were quickly frozen in liquid nitrogen and used for RNA extraction. Total RNA was extracted according to the instructions of the plant polysaccharide and polyphenol RNA extraction kit, and the first-strand cDNA library was obtained by reverse transcription using total RNA as a template. QRT-PCR was used to verify the silencing efficiency of the MYB transcription factor StMYB71 in Nepeta and the expression changes of genes related to the pulegone biosynthesis pathway. The PCR amplification system was: 2×ChamQ Blue Universal SYBR qPCRMaster Mix 5μL, cDNA template 1μL, upstream primer: ACAATACATTCAGGCTCACG; downstream primer: GTGGGTGTTCCAGTAGTTC 0.2μL each, and sterile water was used to make up 10μL. The reaction conditions were: 95℃ pre-denaturation for 30s, 95℃ denaturation for 10s, 60℃ extension for 30s, and 40 cycles; the melting curve was the default program of the instrument. β-actin in Nepeta was used as the internal reference gene, and the relative expression of the gene was calculated using the 2^(-△△CT) method.

[0030] like Figure 2As shown in Figure 2, after infection with Nepeta tenuifolia, the expression level of StMYB71 gene decreased by about 50%, indicating that the gene silencing efficiency was high and the StMYB71 gene was successfully silenced in Nepeta tenuifolia. Figure 5 The expression levels of genes LS, L3OH, ISPD, and ISPR related to the biosynthesis pathway of menthane monoterpenes in Nepeta tenuifolia showed a significant increase, indicating that the StMYB71 gene was negatively correlated with the expression levels of genes related to the biosynthesis of menthane monoterpenes, further indicating that it may negatively regulate the biosynthesis of monoterpenes in Nepeta tenuifolia.

[0031] 5. Changes in volatile oil content in plants with MYB transcription factor gene StMYB71 silenced in Schizonepeta tenuifolia

[0032] Collect the leaves of Nepeta plants after silencing the Nepeta MYB transcription factor StMYB71. Accurately weigh 1g into a centrifuge tube, add 2 5mm diameter steel balls and n-hexane containing 30ng / mL camphor internal standard. In a tissue grinder, grind at 60HZ for 60s, add an appropriate amount of anhydrous sodium sulfate to the ground sample to remove moisture and centrifuge at 12000rpm for 5min at room temperature, aspirate the supernatant of the centrifuged sample and filter through a 0.22μm filter membrane. The filtered sample is analyzed by GC. The analysis conditions were as follows: sample injection volume was 1 μL, no splitting, carrier gas was high-purity nitrogen, injection port temperature was 220°C, FID detector temperature was 250°C, chromatographic column model was Agilent 19091S-433-HP-5, 30m×250μm×0.25μm, and program temperature conditions were as follows: 0°C for 3 min, heating to 90°C at a rate of 3°C / min, then heating to 150°C at a rate of 5°C / min, and finally heating to 220°C at a rate of 10°C / min and maintaining at 5°C. The peak area of ​​camphor was used as the internal standard to correct the peak area of ​​limonene and pulegone in the volatile oil, and the effect of silencing the MYB transcription factor gene StMYB71 on the content of limonene and pulegone in the volatile oil was further calculated.

[0033] like Figure 3 , Figure 4 As shown in the data, when the expression of StMYB71 gene in Nepeta tenuifolia was inhibited, the contents of monoterpenoid compounds limonene and pulegone in Nepeta tenuifolia increased significantly, further proving that the StMYB71 gene can negatively regulate the biosynthesis of monoterpenoid compounds in Nepeta tenuifolia.

[0034] 6. Yeast single hybridization of the MYB transcription factor gene StMYB71 of Nepeta tenuifolia and the promoter of limonene-3-hydroxylase StL3OHpro of Nepeta tenuifolia

[0035] StMYB71 cloning primers: upstream primer: MYB71-AD-F: 5'-gccatggaggccagtgaattcATGGGAAGATCACCTTGCTGTG-3'; downstream primer: MYB71-AD-R: 5'-cagctcgagctcgatggatccTTACATGAAATCGTCAAAATCCAAA-3'. The full-length sequence of the gene encoding the MYB transcription factor gene StMYB71 in Nepeta was used as a template for PCR amplification. The amplification system is as follows: 5μL of 2×RapidTaq MasterMix enzyme, 0.2μL of primers primer-F and primer-R, 1μL of template, and the rest is supplemented with sterile double distilled water. Reaction conditions: 95℃ pre-denaturation for 2min, 95℃ denaturation for 20s, 60℃ annealing for 20s, 72℃ extension for 1min30s, 72℃ extension for 5min after 35 cycles, and storage at 4℃. Thus, the Nepeta MYB transcription factor gene StMYB71 was obtained.

[0036] pGADT7 vector selection BamHⅠ and EcoRⅠ restriction endonucleases were selected for digestion. The digestion reaction system was as follows: 40μL pGADT7 vector, 2.5μL BamHⅠ and EcoRⅠ restriction endonucleases, 5μL 10×K buffer. Reaction conditions: 37℃ digestion for 3 hours to obtain the linearized pGADT7 vector. Then the gene silencing vector of the MYB transcription factor gene StMYB71 of Nepeta tenuifolia was constructed by homologous recombination. Reaction system: 4μL StMYB71 gene fragment, 3μL linearized pGADT7 vector, 2μL 5×CE Buffer, 1μL Exnase II. Reaction conditions: 37℃ reaction for 30min. The yeast single hybrid vector of Nepeta tenuifolia StMYB71 was obtained.

[0037] The cloning of the promoter StL3OHpro of limonene-3-hydroxylase in Nepeta tenuifolia was carried out using primers: upstream primer primer-F: 5'-agtggtctctgtccagtcctTTTCAAACGGATCTGCAGGTG-3'; downstream primer primer-R: 5'-ggtctcagcagaccacaagtCTCAATTAATCCTCCTAATTAATCAACTAA-3'; PCR amplification was performed using genomic DNA of Nepeta tenuifolia as a template. The amplification system was as follows: 5μL of 2×Rapid Taq Master Mix enzyme, 0.2μL of primers primer-F and primer-R, 1μL of template, and the rest was supplemented with sterile double distilled water. Reaction conditions: 95℃ pre-denaturation for 2min, 95℃ denaturation for 20s, 60℃ annealing for 20s, 72℃ extension for 1min30s, 72℃ extension for 5min after 35 cycles, and 4℃ storage. Thus, the gene fragment of the promoter StL3OHpro of limonene-3-hydroxylase in Nepeta tenuifolia was obtained.

[0038] pAbAi vector selection BamHⅠ and EcoRⅠ restriction endonucleases were selected for digestion. The digestion reaction system was as follows: 40μL pAbAi vector, 2.5μL BamHⅠ and EcoRⅠ restriction endonucleases, 5μL 10×K buffer. Reaction conditions: digestion at 37℃ for 3 hours to obtain the linearized pAbAi vector. The yeast one-hybrid vector of Nepeta StL3OHpro was constructed by homologous recombination. Reaction system: 4μL Nepeta limonene-3-hydroxylase promoter StL3OHpro gene fragment, 3μL linearized pAbAi vector, 2μL 5×CE Buffer, 1μL Exnase II. Reaction conditions: 37℃ reaction for 30min. The yeast one-hybrid vector of Nepeta StL3OHpro was obtained.

[0039] The yeast one-hybrid vector of Nepeta StL3OHpro was digested with BstBI at 37°C for 1h to obtain a linearized vector, and the linearized vector was transformed into the Y1HGold yeast competent state according to the instructions, and the transformed competent state was spread on SD-Ura medium and cultured at 30°C. Single colonies were picked into YPDA medium, and the bacterial liquid was centrifuged to collect the cells after culture, and diluted 10 times, 100 times, and 100 times with sterile water, respectively, and spotted on SD-Ura medium containing different concentrations of AbA for self-activation detection and AbA concentration screening.

[0040] The yeast cells containing the Nepeta StL3OHpro yeast one-hybrid vector were prepared into competent cells and then transformed into the yeast one-hybrid vector of Nepeta StMYB71, and the transformed yeast cells were spread on SD-Ura / Leu medium and cultured at 30°C. Single colonies were picked and cultured in YPDA medium with shaking. After culture, the bacterial liquid was centrifuged to collect the cells, and diluted 10 times, 100 times, and 100 times with sterile water, respectively, and spotted on SD-Ura / Leu medium containing AbA and cultured at 30°C.

[0041] like Figure 6 As shown, Nepeta StL3OHpro has self-activation, and when the AbA concentration is 600 mg / L, it can inhibit the self-activation of Nepeta StL3OHpro. This concentration is selected as the inhibitory concentration of aureobasidin (AbA). When the two yeast one-hybrid vectors were co-transformed into yeast cells, it was found that the yeast cells could grow normally on the culture medium compared with the control group, indicating that the Nepeta MYB transcription factor has a direct interaction with StL3OHpro.

[0042] The above description is only a preferred embodiment of the present invention, which is only illustrative and not restrictive of the present invention. Those skilled in the art understand that many changes, modifications, and even equivalences may be made to the present invention within the spirit and scope defined by the claims of the present invention, but all of them will fall within the scope of protection of the present invention.

Claims

1. A MYB transcription factor gene from Nepeta tenuifolia, characterized in that: Gene St The nucleotide sequence of MYB71 is shown in SEQ ID NO.

1.

2. The MYB transcription factor gene of claim 1 St The product encoded by MYB71 is characterized in that The amino acid sequence of the product is shown in SEQ ID NO.

2.

3. The product according to claim 2, characterized in that The products include RNA, polypeptides or proteins.

4. The MYB transcription factor gene of claim 1 St The specific primer of MYB71 is characterized in that: The upstream primer included: MYB71-F: 5'-cgtgagctcggtaccggatccGAGCGCCGAAGCCGAGTT-3'; the downstream primer: TPS45-R: 5'-gtgagtaaggttaccgaattcTCACCAAATATCAACAACAATTCTTTC-3'.

5. A method comprising the MYB transcription factor of claim 1 St Virus-induced gene silencing vector for MYB71.

6. The MYB transcription factor gene of claim 1 St Application of MYB71 and its virus-induced gene silencing vector in regulating monoterpenoid compounds in Nepeta tenuifolia.

7. The use according to claim 6, characterized in that Including the introduction of the MYB transcription factor gene into cells St MYB71 or virus-induced gene silencing vector, expressing the MYB transcription factor gene of Nepeta tenuifolia in host cells St MYB71 may inhibit MYB transcription factor genes in Nepeta tenuifolia St MYB71 expression regulates the synthesis of monoterpenoids.

8. The method for constructing the gene silencing vector according to claim 5, characterized in that: The following steps are involved: (1) Nepeta MYB transcription factor gene St Cloning of the MYB71 silencing fragment St The MYB71 silencer fragment was cloned using the following primers: upstream primer: MYB71-F: 5'-cgtgagctcggtaccggatccGAGCGCCGAAGCCGAGTT-3'; downstream primer: TPS45-R: 5'-gtgagtaaggttaccgaattcTCACCAAATATCAACAACAATTCTTTC-3', based on the MYB transcription factor gene of Nepeta tenuifolia. St The full-length sequence of MYB71 encoding gene was used as a template for PCR amplification to obtain the MYB transcription factor gene of Nepeta tenuifolia. St Cloning of MYB71 silencing fragment; gene St The nucleotide sequence of MYB71 is shown in SEQ ID NO .1; (2) Construction of gene silencing vector for the MYB transcription factor gene StMYB71 in Nepeta tenuifolia pTRV2 vector selection Bam HI and Eco The linearized pTRV2 vector was obtained by restriction endonuclease RⅠ, and the MYB transcription factor gene of Nepeta tenuifolia was constructed by homologous recombination. St The gene silencing vector of MYB71 was constructed to obtain Nepeta tenuifolia St Gene silencing vector for MYB71.

9. The method for constructing a gene silencing vector according to claim 8, characterized in that: The following steps are involved: (1) Nepeta MYB transcription factor gene St Cloning of the MYB71 silencing fragment St The MYB71 silencer fragment was cloned using primers: upstream primer: MYB71-F: 5'-cgtgagctcggtaccggatccGAGCGCCGAAGCCGAGTT-3'; downstream primer: TPS45-R: 5'-gtgagtaaggttaccgaattcTCACCAAATATCAACAACAATTCTTTC-3', based on the MYB transcription factor gene of Nepeta tenuifolia. St The full-length sequence of the MYB71 coding gene was used as a template for PCR amplification. The amplification system was as follows: 5 μL of 2× Rapid Taq Master Mix enzyme, 0.2 μL of primers MYB71-F and TPS45-R, 1 μL of template, and the rest was supplemented with sterile double distilled water; reaction conditions: 95°C pre-denaturation for 2 min, 95°C denaturation for 20 s, 60°C annealing for 20 s, 72°C extension for 1 min 30 s, 72°C extension for 5 min after 35 cycles, and 4°C storage to obtain the MYB transcription factor gene of Nepeta tenuifolia. St Cloning of MYB71 silencing fragment; gene St The nucleotide sequence of MYB71 is shown in SEQ ID NO .1; (2) Construction of gene silencing vector for the MYB transcription factor gene StMYB71 in Nepeta tenuifolia pTRV2 vector selection Bam HI and Eco The enzyme digestion reaction system was as follows: 40 μL of pTRV2 vector, Bam HI and Eco 2.5 μL of each RⅠ restriction endonuclease and 5 μL of 10×K buffer; reaction conditions: 37℃ digestion for 3 hours, thus obtaining the linearized pTRV2 vector, and constructing the MYB transcription factor gene of Nepeta tenuifolia by homologous recombination St MYB71 gene silencing vector; reaction system: St MYB71 gene silencing fragment 4μL, linearized pTRV2 vector 3μL, 5×CEBuffer 2μL, Exnase II 1μL, reaction conditions: 37 ℃ reaction for 30min.

10. The application of the MYB transcription factor gene StMYB71 in regulating the biosynthesis of limonene in Nepeta by interacting with Nepeta limonene-3-hydroxylase StL3OH.

Images