Schizonepeta tenuifolia MYB transcription factor gene StMYB71 and its virus-induced gene silencing vector and application

Abstract

The present application relates to genetic engineering body, specifically discloses a schizonepeta MYB transcription factor gene SMYB71 And virus-induced gene silencing vector and application, the nucleotide sequence of the gene is shown as SEQ ID NO.1, the amino acid sequence of the coding product is shown as SEQ ID NO.2, the cloning, amplification, inhibition in schizonepeta in vivo of schizonepeta MYB transcription factor gene St MYB71 silencing fragment, schizonepeta MYB transcription factor StMYB71 inhibited schizonepeta plant is obtained, and the yeast single hybridization technology is further used to determine that StMYB71 regulates schizonepeta monoterpene compound biosynthesis by interacting with schizonepeta limonene-3-hydroxylase StL3OH.The present application relates to genetic engineering body, specifically discloses a schizonepeta MYB transcription factor gene St MYB71, the problem that the related MYB transcription factor for regulating monoterpene synthesis by interacting with StL3OH has not been separated and identified in the prior art research on schizonepeta can be solved.The present application can provide a basis for gene engineering for improving schizonepeta and improving the content of effective components such as schizonepeta pulegone and limonene.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to Schizonepeta tenuifolia MYB transcription factor gene StMYB71, a virus-induced gene silencing vector and application thereof. BACKGROUND

[0002] Schizonepeta tenuifolia is an annual herb of Labiatae and Schizonepeta. It was first recorded as “Jian Su” in Shennong Bencao Jing, and the name “Schizonepeta” was first recorded in Wu Pu Bencao. It has the effects of relieving superficies and dispelling wind, promoting rash and eliminating sore. It is commonly used for cold, headache, measles, wind rash and sore in modern times. The volatile oil of Schizonepeta has the pharmacological effects of antiviral, anti-inflammatory, analgesic, antitumor, immunoregulatory, antibacterial and hemostatic, and is mainly composed of monoterpene and sesquiterpene compounds such as p-menthane, menthone and caryophyllene. Monoterpene p-menthane is the key component of Schizonepeta medicinal materials, and has the effects of anti-inflammatory, insecticidal, antipyretic and analgesic. Exploring the biosynthesis and regulation mechanism of p-menthane in Schizonepeta has very important significance for revealing the quality change of Schizonepeta medicinal materials and screening high-quality production area and germplasm seedling.

[0003] Genome sequencing technology is becoming mature, and the genome sequencing of Schizonepeta has been completed. Based on the genome data and transcriptome data, the biosynthesis pathway of p-menthane in Schizonepeta has been resolved. Geranyl pyrophosphate (GPP) synthesized by the terpene synthesis pathway MEP / MVP is used as the substrate, and limonene is generated under the catalysis of limonene synthase. Limonene is further hydroxylated and dehydrogenated to obtain isomenthone, and limonene-3-hydroxylase StL3OH involved in this step has been isolated and identified, and it is found by virus-induced gene silencing system VIGS that it is involved in the hydroxylation and dehydrogenation of limonene in Schizonepeta and the biosynthesis of p-menthane, but the transcription factor for regulating p-menthane and limonene synthesis in Schizonepeta by regulating limonene-3-hydroxylase StL3OH has not been isolated and identified. SUMMARY

[0004] The purpose of the present application is to solve the problem that the transcription factor gene for regulating the synthesis pathway of monoterpene in Schizonepeta has not been isolated and identified in the prior art, and to provide MYB transcription factor gene StMYB71 and the product and application thereof. The transcription factor gene StMYB71 is designed to improve the cultivation of Schizonepeta and improve the synthesis of p-menthane and limonene.

[0005] In order to achieve the above-mentioned purpose, the present application discloses the nucleotide sequence of MYB transcription factor gene StMYB71, which is shown in SEQ ID NO. 1.

[0006] The application further discloses a product encoded by the Schizonepeta tenuifolia MYB transcription factor gene StMYB71, and an amino acid sequence of the encoded product is shown as SEQ ID NO. 2.

[0007] The application further discloses specific primers of the Schizonepeta tenuifolia MYB transcription factor gene StMYB71, including an upstream primer MYB71-F: 5'-cgtgagctcggtaccggatccGAGCGCCGAAGCCGAGTT-3' and a downstream primer TPS45-R: 5'-gtgagtaaggttaccgaattcTCACCAAATATCAACAACAATTCTTTC-3'.

[0008] The application further discloses a gene silencing vector containing the Schizonepeta tenuifolia MYB transcription factor gene StMYB71, and the expression vector is pTRV2.

[0009] The application further discloses application of the Schizonepeta tenuifolia MYB transcription factor gene StMYB71 in regulating monoterpenes, including the following steps: introducing the Schizonepeta tenuifolia MYB transcription factor gene StMYB71 into a Schizonepeta tenuifolia plant, inhibiting expression of the Schizonepeta tenuifolia MYB transcription factor gene StMYB71 in a host, and inhibiting synthesis of monoterpenes in the Schizonepeta tenuifolia by the Schizonepeta tenuifolia MYB transcription factor gene StMYB71.

[0010] The monoterpenes include menthone and limonene.

[0011] The application further discloses interaction verification of the Schizonepeta tenuifolia MYB transcription factor gene StMYB71 and a Schizonepeta tenuifolia limonene-3-hydroxylase StL3OH promoter, including the following steps: introducing the Schizonepeta tenuifolia MYB transcription factor gene and the Schizonepeta tenuifolia limonene-3-hydroxylase StL3OH promoter into yeast cells, and verifying point-to-point interaction between the two.

[0012] Compared with the prior art, the application has the following beneficial effects: the Schizonepeta tenuifolia MYB transcription factor StMYB71 gene provided by the application is first cloned and prepared from Schizonepeta tenuifolia plants. The Schizonepeta tenuifolia MYB transcription factor StMYB71 is a key regulation gene of a monoterpenes synthesis pathway of Schizonepeta tenuifolia, and can be used for regulating contents of menthone and limonene of Schizonepeta tenuifolia. The protein can be applied to regulation of a monoterpenes biosynthesis pathway of menthane and limonene of Schizonepeta tenuifolia based on the MEP / MVA pathway. The gene provided by the application can be used for improving contents of medicinal components of Schizonepeta tenuifolia, such as menthone and limonene, by gene engineering technology, and provides a research direction for Schizonepeta tenuifolia molecular breeding and improvement. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1Agarose gel electrophoresis diagram of the gene silencing fragment of the Schizonepeta Myb transcription factor gene StMYB71;

[0014] Figure 2 Gene silencing efficiency of the Schizonepeta Myb transcription factor gene StMYB71;

[0015] Figure 3 Content change of limonene after silencing of the Schizonepeta Myb transcription factor gene StMYB71;

[0016] Figure 4 Content change of p-menthane after silencing of the Schizonepeta Myb transcription factor gene StMYB71;

[0017] Figure 5 Expression amount change of the menthane monoterpenes biosynthesis pathway related gene after silencing of the Schizonepeta Myb transcription factor gene StMYB71;

[0018] Figure 6 Schizonepeta Myb transcription factor StMYB71 and Schizonepeta limonene-3-hydroxylase promoter StL3OHpro yeast one-hybrid. DETAILED DESCRIPTION

[0019] The above and other technical features and advantages of the present application will be more apparent from the following detailed description taken in conjunction with the accompanying drawings.

[0020] The technical means used in the examples are conventional means familiar to those skilled in the art, and the raw materials used are commercially available goods. Non-toxic Super Gel Blue TM The nucleic acid dye was purchased from Shanghai Bayscience Biotech Co., Ltd.; the gel cutting and recovery kit GeneJET Gel Extraction Kit was purchased from Thermo Fisher Scientific; 2x RapidTaq Master Mix (P222); the polysaccharide and polyphenolic plant total RNA extraction kit FastPure Plant Total RNA Isolation Kit (Polysaccharides & Polyphenolics-rich) (RC401), the reverse transcription kit HiScript III 1stStrand cDNA Synthesis Kit (+gDNA wiper) (R312-01 / 02), and DH5a chemically competent cells (C502) were purchased from Novogene Bioinformatics Co., Ltd.; GV3101 competent cells (AC1001) were purchased from Shanghai Uptide Biotech Co., Ltd.; the restriction endonucleases EcoR I (1040A) and BamH I (1010S) were purchased from TaKaRa; the sequence primers were synthesized by Shanghai Shengong Bioengineering Co., Ltd.; and other reagents were imported or domestic analytical pure reagents.

[0021] I. Cloning of the silencing fragment of StMYB71 gene of Schizonepeta tenuifolia

[0022] The silencing fragment of StMYB71 gene was cloned by PCR amplification using the full-length sequence of StMYB71 gene as a template. The amplification system was as follows: 5 μL of 2×RapidTaq Master Mix enzyme, 0.2 μL of each of primers MYB71-F and TPS45-R, 1 μL of template, and the rest was supplemented with sterile double distilled water. The reaction conditions were as follows: 2 min of pre-denaturation at 95°C, 20 s of denaturation at 95°C, 20 s of annealing at 60°C, 1 min 30 s of extension at 72°C, 35 cycles, 5 min of extension at 72°C, and storage at 4°C. Thus, the silencing fragment of StMYB71 gene was obtained.

[0023] II. Construction of the gene silencing vector of StMYB71 gene of Schizonepeta tenuifolia

[0024] The pTRV2 vector was linearized by enzyme digestion with BamH I and EcoR I restriction enzymes. The enzyme digestion reaction system was as follows: 40 μL of pTRV2 vector, 2.5 μL of each of BamH I and EcoR I restriction enzymes, and 5 μL of 10×K buffer. The reaction conditions were as follows: 3 h of enzyme digestion at 37°C. Thus, the linearized pTRV2 vector was obtained. The gene silencing vector of StMYB71 gene of Schizonepeta tenuifolia was constructed by homologous recombination. The reaction system was as follows: 4 μL of the silencing fragment of StMYB71 gene, 3 μL of linearized pTRV2 vector, 2 μL of 5×CE Buffer, and 1 μL of Exnase II. The reaction conditions were as follows: 30 min of reaction at 37°C. Thus, the gene silencing vector of StMYB71 gene of Schizonepeta tenuifolia was obtained. The gene silencing vector of StMYB71 gene of Schizonepeta tenuifolia was transformed into the competent cells of Agrobacterium GV3101. The transformation method was as follows: after the thawing of the competent cells on ice, 5 μL of the gene silencing vector of StMYB71 gene of Schizonepeta tenuifolia was added, followed by 5 min of standing on ice, 5 min of reaction in liquid nitrogen, immediate transfer to a 37°C water bath for 5 min, 2 min of standing on ice, and then 700 μL of LB liquid medium without antibiotics was added, followed by 3 h of recovery at 28°C and 200 rpm. The recovered cells were plated on LB plates containing 50 mg / L of kanamycin and 20 mg / L of rifampicin, and cultured at 28°C for 60 h.

[0025] III. Gene silencing of MYB transcription factor gene StMYB71 in Schizonepeta

[0026] The GV3101 strain transformed with StMYB71 gene silencing vector was cultured in 20 mL of LB liquid medium containing 50 mg / L kanamycin at 28°C with shaking until the OD600 was about 0.6. The bacterial solution was centrifuged at 5000 rpm for 10 min at room temperature, and the culture medium was discarded and the bacterial cells were collected. The bacterial cells were resuspended in a buffer containing 10 mM MgCl2and 10 mM MES and adjusted to an OD600 of 0.4, and acetyl eugenol was added to a final concentration of 20 μM. The activated bacterial solution was mixed with the GV3101 strain containing pTRV1 under the same conditions at a ratio of 1:1. The GV3101 strain transformed with pTRV2 without the StMYB71 silencing fragment of Schizonepeta MYB transcription factor was used as a negative control for further comparative analysis.

[0027] The ten-day-old Schizonepeta plants were used as the infection material, and the Agrobacterium solution was injected into the plants from the back of the leaves using a 1 mL syringe. The injected Schizonepeta plants were placed in the dark at 25°C for 24 h, and then cultured in a incubator for 20 days. The silenced plant leaves were collected for expression verification and component content determination.

[0028] IV. Silencing efficiency of StMYB71 MYB transcription factor gene and verification of gene expression in Schizonepeta

[0029] The silenced Schizonepeta plant leaves were quickly frozen in liquid nitrogen for RNA extraction, and total RNA was extracted according to the instructions of the plant polysaccharide polyphenol RNA extraction kit. The first-strand cDNA library was obtained by reverse transcription using total RNA as the template. The silencing efficiency of Schizonepeta MYB transcription factor StMYB71 and the expression changes of genes related to the menthone biosynthetic pathway were verified by QRT-PCR. The PCR amplification system was as follows: 2×ChamQ Blue Universal SYBR qPCR Master Mix 5 μL, cDNA template 1 μL, upstream primer: ACAATACATTCAGGCTCACG; downstream primer: GTGGGTGTTCCAGTAGTTC, each 0.2 μL, and sterile water to 10 μL. The reaction conditions were as follows: 95°C pre-denaturation for 30 s, 95°C denaturation for 10 s, 60°C extension for 30 s, and cycling for 40 times. The melting curve was the default program of the instrument. The relative expression of the gene was calculated using the 2^(-△△CT) method with β-actin in Schizonepeta as the internal reference gene.

[0030] As Figure 2As shown in FIG. 6, after the Schizonepeta tenuifolia was infected, the expression amount of StMYB71 gene decreased by about 50%, indicating that the gene silencing efficiency was high and the StMYB71 gene was successfully silenced in the Schizonepeta tenuifolia. After the StMYB71 gene was successfully silenced in the Schizonepeta tenuifolia, as shown in FIG. 7, the expression amounts of LS, L3OH, ISPD and ISPR genes related to the menthane monoterpenes biosynthesis pathway in the Schizonepeta tenuifolia were significantly increased, indicating that the StMYB71 gene was negatively correlated with the expression amount of the menthane monoterpenes biosynthesis related gene, and further indicating that the StMYB71 gene might negatively regulate the monoterpenes biosynthesis in the Schizonepeta tenuifolia. Figure 5 As shown in FIG. 7, after the StMYB71 gene was successfully silenced in the Schizonepeta tenuifolia, the expression amounts of LS, L3OH, ISPD and ISPR genes related to the menthane monoterpenes biosynthesis pathway in the Schizonepeta tenuifolia were significantly increased, indicating that the StMYB71 gene was negatively correlated with the expression amount of the menthane monoterpenes biosynthesis related gene, and further indicating that the StMYB71 gene might negatively regulate the monoterpenes biosynthesis in the Schizonepeta tenuifolia.

[0031] V. Changes in volatile oil content of Schizonepeta tenuifolia MYB transcription factor gene StMYB71 silenced plants

[0032] The Schizonepeta tenuifolia leaves after the MYB transcription factor StMYB71 was silenced were collected. 1 g was accurately weighed into a centrifuge tube, 2 steel balls with a diameter of 5 mm and n-hexane containing 30 ng / mL camphor internal standard were added. In the tissue grinder, 60 HZ grinding for 60 s, after grinding, appropriate anhydrous sodium sulfate was added to remove water and centrifuged at 12000 rpm for 5 min at room temperature, and the supernatant after centrifugation was aspirated and filtered through a 0.22 μm filter membrane. The filtered sample was analyzed by GC. The analysis conditions were as follows: sample injection amount was 1 μL, no split, carrier gas was high-purity nitrogen, injection port temperature was 220℃, FID detector temperature was 250℃, chromatographic column type was Agilent 19091S-433-HP-5, 30 m x 250 μm x 0.25 μm, and the programmed temperature conditions were as follows: 0℃ was kept for 3 min, the temperature was increased to 90℃ at a rate of 3℃ / min, then the temperature was increased to 150℃ at a rate of 5℃ / min, finally the temperature was increased to 220℃ at a rate of 10℃ / min, and kept for 5℃. The peak area of camphor was used as an internal standard to correct the peak area of limonene and menthone in the volatile oil, and the effect of StMYB71 gene silencing on the content of limonene and menthone in the volatile oil was further calculated.

[0033] As shown in FIG. 8, when the expression amount of StMYB71 gene in the Schizonepeta tenuifolia was inhibited, the contents of monoterpenes compounds limonene and menthone in the Schizonepeta tenuifolia were significantly increased, further proving that the StMYB71 gene can negatively regulate the biosynthesis of monoterpenes compounds in the Schizonepeta tenuifolia. Figure 3 、 Figure 4 As shown in FIG. 8, when the expression amount of StMYB71 gene in the Schizonepeta tenuifolia was inhibited, the contents of monoterpenes compounds limonene and menthone in the Schizonepeta tenuifolia were significantly increased, further proving that the StMYB71 gene can negatively regulate the biosynthesis of monoterpenes compounds in the Schizonepeta tenuifolia.

[0034] VI. Schizonepeta tenuifolia MYB transcription factor gene StMYB71 gene and Schizonepeta tenuifolia limonene-3-hydroxylase promoter StL3OHpro yeast one-hybrid

[0035] StMYB71 cloning primer: upstream primer: MYB71-AD-F: 5'- gccatggaggccagtgaattcATGGGAAGATCACCTTGCTGTG-3'; downstream primer: MYB71-AD-R: 5'-cagctcgagctcgatggatccTTACATGAAATCGTCAAAATCCAAA-3'. The full-length sequence of StMYB71 was used as a template for PCR amplification. The amplification system was as follows: 5 μL of 2×RapidTaq Master Mix enzyme, 0.2 μL of primer-F and primer-R, 1 μL of template, and the rest was made up with sterile double distilled water. The reaction conditions were as follows: 95°C pre-denaturation for 2 min, 95°C denaturation for 20 s, 60°C annealing for 20 s, 72°C extension for 1 min 30 s, 35 cycles, 72°C extension for 5 min, and 4°C storage. Thus, StMYB71 was obtained.

[0036] pGADT7 vector selection: restriction enzymes BamH I and EcoR I were used for enzyme digestion, and the enzyme digestion reaction system was as follows: 40 μL of pGADT7 vector, 2.5 μL of each of BamH I and EcoR I restriction enzymes, and 5 μL of 10×K buffer. The reaction conditions were as follows: 37°C enzyme digestion for 3 hours. Thus, the linearized pGADT7 vector was obtained. Then, the gene silencing vector of StMYB71 was constructed by using the method of homologous recombination. The reaction system was as follows: 4 μL of StMYB71 gene fragment, 3 μL of linearized pGADT7 vector, 2 μL of 5×CE Buffer, and 1 μL of Exnase II. The reaction conditions were as follows: 37°C reaction for 30 min. Thus, the yeast one-hybrid vector of StMYB71 was obtained.

[0037] The StL3OHpro of B. thunbergii was cloned using primers: primer-F: 5'-agtggtctctgtccagtcctTTTCAAACGGATCTGCAGGTG-3'; primer-R: 5'-ggtctcagcagaccacaagtCTCAATTAATCCTCCTAATTAATCAACTAA-3'; and B. thunbergii genomic DNA as a template for PCR amplification. The amplification system was as follows: 5 μL of 2×Rapid Taq Master Mix enzyme, 0.2 μL of primer-F and primer-R, respectively, 1 μL of template, and the rest was supplemented with sterile double distilled water. The reaction conditions were as follows: 95 °C pre-denaturation for 2 min, 95 °C denaturation for 20 s, 60 °C annealing for 20 s, 72 °C extension for 1 min 30 s, 35 cycles of 72 °C extension for 5 min, and 4 °C storage. Thus, the StL3OHpro gene fragment of B. thunbergii limonene-3-hydroxylase promoter was obtained.

[0038] The pAbAi vector was selected by BamH I and EcoR I restriction enzymes, and the enzyme reaction system was as follows: 40 μL of pAbAi vector, 2.5 μL of each of BamH I and EcoR I restriction enzymes, and 5 μL of 10×K buffer. The reaction conditions were as follows: 37 °C enzyme digestion for 3 h, and thus the linearized pAbAi vector was obtained. The yeast single-hybrid vector of StL3OHpro of B. thunbergii was constructed by using the method of homologous recombination. The reaction system was as follows: 4 μL of StL3OHpro gene fragment of B. thunbergii limonene-3-hydroxylase promoter, 3 μL of linearized pAbAi vector, 2 μL of 5×CE Buffer, and 1 μL of Exnase II. The reaction conditions were as follows: 37 °C reaction for 30 min. Thus, the yeast single-hybrid vector of StL3OHpro of B. thunbergii was obtained.

[0039] The yeast single-hybrid vector of StL3OHpro of B. thunbergii was digested by BstB I at 37 °C for 1 h to obtain a linearized vector, and the linearized vector was transformed into Y1HGold yeast competent cells according to the instructions, and the transformed competent cells were spread on an SD-Ura culture medium and cultured at 30 °C. Single colonies were picked into YPDA culture medium, and after culture, the bacterial liquid was centrifuged to collect the bacterial cells, which were diluted by 10 times, 100 times, and 100 times, respectively, with sterile water, and then spotted on an SD-Ura culture medium containing different concentrations of AbA for self-activation detection and AbA concentration screening.

[0040] The yeast cells containing the yeast single-hybrid vector of the Schizonepeta StL3OHpro are prepared into competent cells, and then the yeast single-hybrid vector of the Schizonepeta StMYB71 is transformed into the yeast cells, and the transformed yeast cells are coated on the SD-Ura / Leu culture medium and cultured at 30°C. Single colonies are picked and cultured in the YPDA culture medium, and then the bacterial liquid is centrifuged to collect the bacterial cells, which are diluted by 10 times, 100 times and 100 times respectively with sterile water, and then are spotted on the SD-Ura / Leu culture medium containing AbA and cultured at 30°C.

[0041] As shown in Figure 6 The Schizonepeta StL3OHpro has self-activation, and the self-activation of the Schizonepeta StL3OHpro can be inhibited when the concentration of AbA is 600 mg / L, and the concentration is selected as the inhibition concentration of the AbA. After the two yeast single-hybrid vectors are co-transformed into the yeast cells, it is found that the yeast cells can grow normally on the culture medium compared with the control group, which indicates that the Schizonepeta MYB transcription factor has a direct interaction with the StL3OHpro.

[0042] The above only describes the preferred embodiments of the present application, which are only illustrative but not restrictive. It is understood by those skilled in the art that many changes, modifications and even equivalents can be made to the present application within the spirit and scope defined by the claims of the present application, and all of them will fall within the protection scope of the present application.

Claims

1. The MYB transcription factor gene StMYB71 of Schizonepeta tenuifolia is characterized in that The nucleotide sequence of gene StMYB71 is shown in SEQ ID NO.

1.

2. The product encoded by the Schizonepeta tenuifolia MYB transcription factor gene StMYB71 according to claim 1, characterized in that The amino acid sequence of the product is shown in SEQ ID NO.

2.

3. Use of the gene silencing vector for the Schizonepeta tenuifolia MYB transcription factor gene StMYB71 virus-induced gene according to claim 1 in increasing the content of the monoterpenoid compounds pulegone and limonene in Schizonepeta tenuifolia.

4. The use according to claim 3, characterized in that The method includes transferring a virus-induced gene silencing vector of the MYB transcription factor gene StMYB71 of Schizonepeta tenuifolia into cells, inhibiting the expression of the MYB transcription factor gene StMYB71 of Schizonepeta tenuifolia in host cells, and regulating the synthesis of monoterpenoid compounds pulegone and limonene.

5. The method for constructing the gene silencing vector according to claim 3, characterized in that: The following steps are involved: (1) Cloning of the silencing fragment of the MYB transcription factor gene StMYB71 in Schizonepeta tenuifolia The cloning of the StMYB71 silencer fragment was performed by PCR amplification using the following primers: upstream primer: MYB71-F: 5'-cgtgagctcggtaccggatccGAGCGCCGAAGCCGAGTT-3'; downstream primer: TPS45-R: 5'-gtgagtaaggttaccgaattcTCACCAAATATCAACAACAATTCTTTC-3', with the full-length sequence of the gene encoding the MYB transcription factor gene StMYB71 of Schizonepeta tenuifolia as a template. The cloning of the StMYB71 silencer fragment of the MYB transcription factor gene of Schizonepeta tenuifolia was obtained; the nucleotide sequence of the gene StMYB71 is shown in SEQ ID NO.1; (2) Construction of gene silencing vector for the MYB transcription factor gene StMYB71 of Schizonepeta tenuifolia The pTRV2 vector was digested with BamHⅠ and EcoRⅠ restriction enzymes to obtain a linearized pTRV2 vector. A gene silencing vector for the MYB transcription factor gene StMYB71 of Schizonepeta tenuifolia was constructed by homologous recombination.

6. The method for constructing a gene silencing vector according to claim 5, characterized in that: The following steps are involved: (1) Cloning of the silencing fragment of the MYB transcription factor gene StMYB71 in Schizonepeta tenuifolia The cloning of the StMYB71 silencer fragment was performed using primers: upstream primer: MYB71-F: 5'-cgtgagctcggtaccggatccGAGCGCCGAAGCCGAGTT-3'; downstream primer: TPS45-R: 5'-gtgagtaaggttaccgaattcTCACCAAATATCAACAACAATTCTTTC-3'. The full-length sequence of the gene encoding the MYB transcription factor gene StMYB71 in Schizonepeta tenuifolia was used as a template for PCR amplification. The amplification system was as follows: 2× Rapid Taq Master 5 μL of enzyme mix, 0.2 μL each of primers MYB71-F and TPS45-R, 1 μL of template, and the remainder made up with sterile double-distilled water; reaction conditions: 95°C pre-denaturation for 2 minutes, 95°C denaturation for 20 seconds, 60°C annealing for 20 seconds, 72°C extension for 1 minute 30 seconds, 35 cycles of 72°C extension for 5 minutes, and storage at 4°C. A clone of the silencing fragment of the MYB transcription factor gene StMYB71 from Schizonepeta tenuifolia was obtained; the nucleotide sequence of the gene StMYB71 is shown in SEQ ID NO. 1; (2) Construction of gene silencing vector for the MYB transcription factor gene StMYB71 of Schizonepeta tenuifolia The pTRV2 vector was digested with BamHⅠ and EcoRI restriction enzymes. The digestion reaction system was as follows: 40 μL of pTRV2 vector, 2.5 μL each of BamHⅠ and EcoRI restriction enzymes, and 5 μL of 10×K buffer. The reaction conditions were 37°C for 3 hours to obtain a linearized pTRV2 vector. The gene silencing vector of the MYB transcription factor gene StMYB71 of Schizonepeta tenuifolia was constructed using homologous recombination. The reaction system included 4 μL of the StMYB71 gene silencing fragment, 3 μL of the linearized pTRV2 vector, 2 μL of 5×CE Buffer, and 1 μL of Exnase II. The reaction conditions were 37°C for 30 minutes.

Images