Method suitable for detecting deletion mutation of nicotinic acetylcholine receptor alpha6 subunit of Frankliniella occidentalis on site in field

Abstract

The invention belongs to the technical field of biology, and particularly relates to an on-site rapid detection method for field Frankliniella occidentalis nicotinic acetylcholine receptor alpha6 subunit mutation. The method comprises the following steps: 1) DNA extraction: collecting Frankliniella occidentalis, and carrying out DNA extraction to obtain a DNA extracting solution; (2) adding a sample: transferring the DNA extracting solution into a premixed solution containing an upstream primer, a downstream primer, a buffer A and a buffer B to form a reaction system, sufficiently mixing, transferring into a tube filled with a micro-freeze-drying reagent ball, and lightly and uniformly mixing; and (3) lightly and uniformly mixing, reacting in a portable constant-temperature heater, adding a fluorescent nucleic acid dye into the tube, and performing corresponding light irradiation and fluorescent color development to obtain a positive result, namely that a mutant individual is inserted into the gene or the gene has resistance to spinosad medicaments.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a rapid on-site detection method for mutations in alpha 6 subunits of nicotinic acetylcholine receptors of western flower thrips in the field. Background Art

[0002] Pesticides are an important material basis for ensuring food security. According to FAO statistics, the use of pesticides can recover 30-40% of the world's crop yield losses. However, due to the long-term and large-scale use of pesticides, many major agricultural pests have developed serious resistance to pesticides, and the speed of resistance evolution is very fast. This not only seriously affects the efficient prevention and control of pests, leading to a sharp increase in the use of pesticides and pest outbreaks, but also causes a series of problems such as damage to the pest control function of natural enemies, pesticide residues and food safety. Effectively controlling pest resistance is a key measure to reduce the use of pesticides. However, due to the lack of a scientific early monitoring and early warning system for resistance, the evolution of pest resistance has further accelerated, so it is urgent to develop and research resistance monitoring technology. Understanding the resistance level of the target is a prerequisite for chemical pest control and resistance management. Pest resistance monitoring generally adopts bioassay method, but this method has the following limitations: (1) The detection effect is good when the frequency of resistant individuals is high, but when a few resistant individuals first appear in some populations, the results obtained always lag behind the development speed of resistance and are not suitable for early detection; (2) A large number of live insects are required, which takes a long time and occupies a large space; (3) It is difficult to achieve true standardization from insect source, breeding to determination. In recent years, with the rapid development of molecular biology, a series of molecular detection technologies for drug resistance have been produced, such as allele-specific PCR (ARMS), competitive allele-specific PCR (KASP), TaqMan probe method and high-resolution melting curve (HRM). However, the operation of the above detection technologies requires precise instruments and a relatively stable experimental environment, and is still limited to the laboratory, and cannot achieve rapid detection in the field.

[0003] Western flower thrips belongs to the order Thysanoptera and is a highly destructive invasive pest on crops and horticultural crops worldwide. Due to its significant economic importance, it will be included in my country's "List of Class I Crop Pests and Diseases" (Announcement No. 654 of the Ministry of Agriculture and Rural Affairs of the People's Republic of China) in 2023. Spinosad is a biological insecticide extracted from the fermentation broth of Saccharopolysaccharides polysaccharides. It mainly acts on nicotinic acetylcholine receptors (nAChR) and has extremely high activity against a variety of agricultural pests including western flower thrips. Long-term resistance monitoring shows that field populations of western flower thrips have developed varying degrees of resistance to spinosad, and cases of field control failure are increasing. Summary of the invention

[0004] The present invention has found through research that single nucleotide mutation and deletion mutation of the α6 subunit of the nicotinic acetylcholine receptor, the target receptor of spinosad, are the main mechanisms for the resistance of western flower thrips to spinosad agents. The DNA insertion mutation of 230bp on intron 3 of the α6 subunit of the nicotinic acetylcholine receptor is the cause of the generation of the deletion transcript of the α6 subunit, and the proportion of 230bp DNA insertion mutation in the population of western flower thrips is positively correlated with the resistance level of the population to spinosad. Therefore, by detecting the genotype ratio of the insertion mutation of 230bp in the intron of the α6 subunit of the nicotinic acetylcholine receptor of western flower thrips, the resistance level of the population of western flower thrips to spinosad agents can be quickly understood.

[0005] The present invention is based on the constant temperature recombinase polymerase amplification technology (RPA) and the data of the mutation site of the spinosad resistance gene of western flower thrips mined by the inventors, and RPA specific primers are designed. A rapid visual detection method for the spinosad resistance of western flower thrips is established by optimizing the reaction system. The method can specifically detect whether an individual western flower thrips carries the spinosad resistance mutation gene site, thereby completing the present invention.

[0006] The present invention provides a method for rapidly detecting mutation sites of the nicotinic acetylcholine receptor α6 subunit of single-headed western flower thrips, which comprises the following steps:

[0007] 1) DNA extraction: collecting western flower thrips, extracting DNA, and obtaining a DNA extract;

[0008] 2) Sample addition: Transfer the DNA extract to the premix containing upstream primers, downstream primers, A buffer and B buffer to form a reaction system, mix thoroughly, transfer to the tube containing the micro-lyophilized reagent ball, and gently tap to mix;

[0009] 3) After gently flicking to mix, place in a portable constant temperature heater for reaction, add fluorescent nucleic acid dye into the tube, irradiate with corresponding light, and the result of fluorescence is positive, which means that the individual has an insertion mutation in its gene or is resistant to spinosad drugs.

[0010] The primer is directed to the 230 bp after nucleotide 1686 of intron 3 of the α6 subunit of the nicotinic acetylcholine receptor of western flower thrips (nucleotide sequence is

[0011] ) are designed for insertion mutagenesis.

[0012] Specifically, the western flower thrips are collected in the field, specifically, the western flower thrips are collected on field crops using a sucker tube or by directly shaking off, and are placed in insect jars or plastic bottles, and a small amount of host plants are picked for the test insects to avoid feeding.

[0013] Preferably, in step 1), a single western flower thrips is taken for DNA extraction.

[0014] More preferably, the primer is

[0015] Upstream primer α6-RPA-F1: CCCCACTGTTAAAGCTGCGGTCGTCCAGGTTGCC

[0016] Downstream primer α6-RPA-R2: CCGATTCACGTTTAAACGAATATGACACAACATTC.

[0017] Specifically, the reaction system in step 2) includes: adding 29.4 μl Abuffer to each dry powder reaction tube; 2) adding 2 μl upstream primer and 2 μl downstream primer to each reaction tube; 3) adding 5 μl nucleic acid template and 9.1 μl ddH2O to the reaction tube in sequence, and finally adding 2.5 μl B buffer to the reaction tube and mixing thoroughly.

[0018] The reaction condition in step 3) is incubation at 37° C. for 10 min in a constant temperature device.

[0019] The present invention also provides a primer designed for the insertion mutation of the 230 bp after nucleotide 1686 of intron 3 of the α6 subunit of the nicotinic acetylcholine receptor of western flower thrips (nucleotide sequence: CACTGTTATTCAACGATTGTGACGTCACATTCGTTTCAATGTAAATC GTGTCACATTCGTTTGAATGTTGTGTCATATTCGTTTAAACGTGAATCGGCCAAGCCTGGCGCCATTAGAGCATCAATTCACCTCAAGTCACGTTTAAATGAATGTGACACAATATTCGAACGAATGTGACACATTTCACATTGAAATGAATGTGACGTCACATATCTTGAATAACAGTGCAA) in detecting the resistance of western flower thrips to spinosad agents.

[0020] Preferably, the primer is

[0021] Upstream primer α6-RPA-F1: CCCCACTGTTAAAGCTGCGGTCGTCCAGGTTGCC

[0022] Downstream primer α6-RPA-R2: CCGATTCACGTTTAAACGAATATGACACAACATTC.

[0023] The detection method of the present invention is based on specific primer design and combined with an optimized reaction system to establish a rapid visual detection method for the spinosad resistance of western flower thrips. It can specifically detect whether an individual western flower thrips carries a spinosad resistance mutation gene site and then draw a conclusion on whether it is resistant to spinosad, which has practical significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 , the results of detecting the amplified product by 2% agarose gel electrophoresis.

[0025] Figure 2 The specificity of the primers was verified by agarose gel electrophoresis.

[0026] Figure 3 Field testing results of fluorescence under blue light irradiation.

[0027] Figure 4 Field test agarose gel electrophoresis test results. DETAILED DESCRIPTION

[0028] Example 1. Design of RPA-specific primers

[0029] Through the genomic sequence of the nicotinic acetylcholine receptor α6 subunit published by the inventor, amplification primers were designed upstream of the intron 3 insertion mutation sequence and at the 230bp insertion site. According to the RPA primer design principles: 1) The length of the amplified primer is generally 30-35 bases; 2) The first 3-5 nucleotides at the 5' end of the primer should avoid polyguanine G, and try to use cytosine C that can promote fragment recombination; 3) The best choice for the last 3 nucleotides at the 3' extension end is guanine G and cytosine C; 4) The GC content of the primer needs to be controlled at 40-60%; 5) The length of the RPA amplification product should not exceed 500bp as much as possible, and the amplification efficiency of the amplification product of 100-300bp is the highest; 6) The primer design also needs to avoid the appearance of hairpin structures, primer dimers and other special structures.

[0030] According to the above conditions, only 3 pairs of qualified candidate RPA primers were obtained, which were synthesized by Shanghai Sangon Biotechnology Co., Ltd. and then subjected to RPA reaction to further screen specific primers.

[0031] Referring to the instructions for the high-efficiency version of the DNA nucleic acid releaser (Beijing Libo Taiye Technology Co., Ltd.), the spinosad-resistant western flower thrips population was used as the test insect, and single-head western flower thrips DNA was extracted. A single test insect was placed in a 1.5 ml centrifuge tube, 10 μl of DNA extraction solution was added, and the test insect was ground with a disposable plastic grinding rod and allowed to stand for 5 minutes, and the extraction was completed.

[0032] Refer to the instructions of the basic DNA constant temperature rapid amplification kit (Beijing Libo Taiye Technology Co., Ltd.) for RPA reaction. The specific method is as follows: 1) Add 29.4μl Abuffer to each dry powder reaction tube; 2) Add 2μl upstream primer and 2μl downstream primer to each reaction tube; 3) Add 5μl nucleic acid template and 9.1μld HO to the reaction tube in sequence, and finally add 2.5μl B buffer to the reaction tube and mix thoroughly; 4) Place the reaction tube in a constant temperature device and incubate at 37°C for 10 minutes. After the reaction is completed, the reaction product is recovered using a DNA product recovery kit, and the amplified product is detected by 2% agarose gel electrophoresis. The results are as follows: Figure 1 As shown, both pairs of primers in lanes 1 and 2 showed non-specific amplification, and the product band in lane 3 was single and bright, and the band size was in line with the expected 323pb. Finally, a set of primers with good specificity was selected, and its nucleotide sequence is as follows:

[0033] Table 1. Primer sequences required for RPA reaction

[0034]

[0035] Example 2 Primer specificity verification:

[0036] A spinosad-resistant population with an insertion sequence in intron 3 of the α6 subunit of the nicotinic acetylcholine receptor of western flower thrips and a single-headed western flower thrips from a sensitive population without an insertion were selected as test insects to test the specificity and amplification efficiency of the α6-RPA primers.

[0037] Refer to the instructions for the high-efficiency DNA nucleic acid releaser (Beijing Libo Taiye Technology Co., Ltd.) and the instructions for the basic DNA constant temperature rapid amplification kit (Beijing Libo Taiye Technology Co., Ltd.) to perform the single-head DNA extraction machine RPA reaction. After the reaction is completed, the reaction product is recovered using a DNA product recovery kit. The amplification product is detected by 2% agarose gel electrophoresis. The results are as follows Figure 2As shown: Lane 1 is DNA Maker, Lane 2 and Lane 3 are the amplification products of single test insects of the spinosad sensitive population without insertion sequence and the resistant population with 230bp insertion sequence of the nicotinic acetylcholine receptor α6 subunit intron 3 of western flower thrips, respectively. The results showed that the amplified product was in line with the expected size, the spinosad resistant population with insertion sequence intron 3 of the nicotinic acetylcholine receptor α6 subunit was 323pb in size, and the sensitive population without insertion sequence had no amplified band.

[0038] Example 3: Establishment of field detection method

[0039] 1. Field collection: Collect western flower thrips from field crops using a sucker tube or by shaking them off directly, place them in insect jars or plastic bottles, and pick a small amount of host plants for the test insects to avoid feeding on.

[0040] 2. DNA extraction: Collect the test insects, use a fluke tube or a small brush to take a single head and place it in a 1.5ml centrifuge tube, add 10μl of the above DNA extraction solution, grind the test insects with a disposable plastic grinding rod and let it stand for 5 minutes.

[0041] 3. Sample addition: Transfer all DNA extracts to the primers and A buffer and B buffer premix (29.4 μl Abuffer, 2 μl upstream primer and 2 μl downstream primer, 2.5 μl B buffer), mix thoroughly and transfer to the eight-tube tube containing the micro-lyophilized reagent ball, and gently tap to mix.

[0042] 4. After flicking to mix, place in a portable constant temperature heater at 37°C for 10 minutes, then add 1 μl of SYBR-Green nucleic acid dye to the eight-tube concatenation, use a blue light pen to illuminate the eight-tube concatenation, and the result of fluorescence coloration is positive. To further verify the accuracy of the color development result, the reaction product was recovered and subjected to agarose gel electrophoresis. The results are as follows Figure 3 and Figure 4 As shown, the results showed that the first three tubes of reaction solution had no obvious fluorescence signal and the electrophoresis results showed no obvious amplification bands, which were sensitive individuals without insertion mutations. The last three tubes of reaction solution had obvious fluorescence signals and the electrophoresis results showed obvious amplification bands, which were resistant individuals with insertion mutations.

Claims

1. A rapid on-site detection method for mutations in the nicotinic acetylcholine receptor α6 subunit of western flower thrips or resistant individuals of western flower thrips, characterized in that: 1) DNA extraction: Collect western flower thrips, extract DNA, and obtain DNA extract; 2) Sample addition: Transfer the DNA extract to the premix containing upstream primers and downstream primers and A buffer and B buffer to form a reaction system, mix thoroughly and transfer to the tube containing the micro-lyophilized reagent ball, and gently tap to mix; 3) After gently flicking to mix, place in a portable constant temperature heater for reaction, add fluorescent nucleic acid dye into the tube, irradiate with corresponding light, and the result of fluorescence is positive, which means that the individual has an insertion mutation in its gene or is resistant to spinosad drugs; The primers are designed for a 230 bp insertion fragment after the 1686th nucleotide of intron 3 of the nicotinic acetylcholine receptor α6 subunit of western flower thrips, and the nucleotide sequence of the insertion version is CACTGTTATTCAACGATTGTGACGTCACATTCGTTTCAATGTAAATCGTGTCACATTCGTTTGAATGTTGTGTCATATTCGTTTAAACGTGAATCGGCCAAGCCTGGCGCCATTAGAGCATCAATTCACCTCAAGTCACGTTTAAATGAATGTGACACAATATTCGAACGAATGTGACACATTTCACATTGAAATGAATGTGACGTCACATATCTTGAATAACAGTGCAA.

2. The detection method according to claim 1, characterized in that The western flower thrips are collected in the field, specifically, the western flower thrips are collected on the field crops by using a sucker tube or by directly shaking off, and the crops are put into insect jars or plastic bottles, and a small amount of host plants are picked for the test insects to avoid feeding.

3. The detection method according to claim 1, characterized in that In step 1), a single western flower thrips was taken for DNA extraction.

4. The detection method according to claim 1, characterized in that The primers are Upstream primer α6-RPA-F1: CCCCACTGTTAAAGCTGCGGTCGTCCAGGTTGCC Downstream primer α6-RPA-R2: CCGATTCACGTTTAAACGAATATGACACAACATTC.

5. The detection method according to claim 4, characterized in that: The reaction system in step 2) includes: 29.4 μl Abuffer is added to each dry powder reaction tube; 2) 2 μl upstream primer and 2 μl downstream primer are added to each reaction tube; 3) 5 μl nucleic acid template and 9.1 μl dd H2O are added to the reaction tube in sequence, and finally 2.5 μl B buffer is added to the reaction tube and mixed thoroughly.

6. The detection method according to claim 4, characterized in that: In step 3), the reaction conditions are incubation at 37°C for 10 min in a constant temperature device.

7. Use of primers designed for the mutation of the 230 bp insertion fragment after nucleotide 1686 of intron 3 of the nicotinic acetylcholine receptor α6 subunit of western flower thrips in detecting the resistance of western flower thrips to spinosad agents, characterized in that: The nucleotide sequence of the inserted fragment is CACTGTTATTCAACGATTGTGACGTCACATTCGTTTCAATGTAAATCGTGTCACATTCGTTTGAATGTTGTGTCATATTCGTTTAAACGTGAATCGGCCAAGCCTGGCGCCATTAGAGCATCAATTCACCTCAAGTCACGTTTAAATGAATGTGACACAATATTCGAACGAATGTGACACATTTCACATTGAAATGAATGTGACGTCACATATCTTGAATAACAGTGCAA.

8. The use according to claim 7, characterized in that The primers are Upstream primer α6-RPA-F1: CCCCACTGTTAAAGCTGCGGTCGTCCAGGTTGCC Downstream primer α6-RPA-R2: CCGATTCACGTTTAAACGAATATGACACAACATTC.

Images