Broiler chicken liquid chip based on targeted capture sequencing and application thereof

Abstract

The invention relates to the technical field of molecular biology, in particular to a broiler liquid chip based on targeted capture sequencing and application of the broiler liquid chip. The broiler chicken 50K liquid phase chip prepared by using the SNP molecular marker combination provided by the invention has the following advantages: 1) optimization design: all chromosomes of a whole genome are uniformly distributed, the coverage degree is high, and the accuracy of broiler chicken genome genetic evaluation is ensured; 2) function correlation: the chip collects significant sites related to the traits such as broiler chicken production performance, disease resistance, feed utilization efficiency and the like, so that the practicability of the chip is improved; 3) applicability: a chip site comes from an independently bred commercial high-yield laying hen variety and SNP with relatively high polymorphism in local varieties in China, so that the scientific research requirements of scientific researchers are met, and the whole genome molecular breeding work of laying hen enterprises is also met; and 4) flexibility: the liquid phase chip technology has great advantages in the aspects of analysis speed, sensitivity, flux and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a broiler liquid phase chip based on targeted capture sequencing and an application thereof. Background Art

[0002] SNP refers to the polymorphism of nucleic acid sequence caused by the change of a single nucleotide base at the genome level. Its variation forms include conversion, transversion, deletion and insertion, etc. It has the characteristics of large number, wide distribution and easy detection. As a genetic marker molecule, SNP contributes to the genetic variation of quality traits, economic traits and some complex disease traits, so it is widely used in genetic research.

[0003] Commonly used SNP typing technologies can be divided into solid-phase chips and liquid-phase chips. Traditional solid-phase chips are based on fluorescence detection and react according to the intensity of fluorescence. Since the reaction sites are fixed and used in plates, the R&D cost is relatively high. Liquid-phase chips are based on DNA capture and then sequencing, which can simultaneously quantitatively detect multiple different target molecules in the same sample. Not only is the accuracy higher, but the site design is also flexible. Compared with solid-phase chips, it has the advantage of low cost and can be applied to various aspects of molecular genetic research and molecular-assisted breeding. It can provide support for upstream and downstream breeding processes, including genetic diversity analysis of germplasm resources, kinship analysis, whole-genome association analysis, quantitative trait QTL positioning analysis, and selective evolution research. Among them, a very important application is the application in whole-genome selection breeding (Genomic Selection). Whole genome selection is the main breeding technology in livestock and poultry breeding. It uses whole genome markers to estimate all possible genetic effects, explain all genetic variations, and predict whole genome breeding values ​​by statistically analyzing the genetic effects of markers. It has the advantages of high breeding value estimation accuracy and rapid genetic progress. It has been applied to the commercial strain selection practice of dairy cows, pigs, and foreign high-yield laying hens. However, there is currently a lack of a liquid phase chip for whole genome selection breeding of broilers. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a broiler liquid phase chip based on targeted capture sequencing and its application. The broiler 50K liquid phase chip prepared by the SNP molecular marker combination provided by the present invention can specifically identify the relationship between commercial broilers and local breed broilers, and can also perform whole genome association analysis, whole genome selection breeding, target trait QTL positioning analysis and population genetics analysis, which can help accelerate the rapid development of the broiler industry and has great economic and practical value and scientific research value.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides a broiler chicken whole genome SNP molecular marker combination, including 42417 SNP sites located on the chicken reference genome version 6.0, and the position information of the SNP sites is shown in Table 1:

[0007] Table 1 SNP molecular marker combinations

[0008]

[0009]

[0010]

[0011]

[0012]

[0013]

[0014]

[0015]

[0016]

[0017]

[0018]

[0019]

[0020]

[0021]

[0022]

[0023]

[0024]

[0025]

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176] Wherein, Ref is the reference genome base, Alt is the mutant base, the position is the physical position of the Ref or Alt base in the corresponding chromosome, and "-" is a deletion mutation; NO.1 is a nucleotide sequence such as the sequence shown in SEQ ID NO.1, NO.2 is a nucleotide sequence such as the sequence shown in SEQ ID NO.2, NO.3 is a nucleotide sequence such as the sequence shown in SEQ ID NO.3, NO.4 is a nucleotide sequence such as the sequence shown in SEQ ID NO.4, NO.5 is a nucleotide sequence such as the sequence shown in SEQ ID NO.5, and NO.6 is a nucleotide sequence such as the sequence shown in SEQ ID NO.6, as follows:

[0177] SEQ ID NO.1: 5'-GCCAGGCAAGGACAGCCAGGCCTGTCCAGGCAAGGCTAGGCAAGGCAA GGCCAGGAAAGGCAAAGGAAGGACATGCAAGGCAAGGGCAGGCAAGGCAAGGCCAGGCCAG TCCAGGCC-3';

[0178] SEQ ID NO.2: 5'-GCCAGGCAAGGACAGCCAGGCCTGTCCAGGCAAGGCTAGGCAAGGCAA GGCCAGGAAAGGCAAAGGAAGGACATGCAAGGCAAGGGCAGGCAAGGCAAGGCCAGGCCAG TCCAGGCC-3';

[0179] SEQ ID NO.3: 5'-ATAAGTAATAAGTTT-3'; SEQ ID NO.4: 5'-ATAAGTAATAAGTTT-3';

[0180] SEQ ID NO.5: 5'-AGTGATTCCC-3'; SEQ ID NO.6: 5'-AGTGATTCCC-3';

[0181] SEQ ID NO.7: 5'-CTTCCCGCTCA-3'; SEQ ID NO.8: 5'-CTTCCCGCTCA-3'.

[0182] The present invention provides a broiler chicken 50K liquid phase chip, wherein the genotyping sites of the broiler chicken 50K liquid phase chip include 42417 SNP sites located on the chicken reference genome version 6.0, and the SNP sites are the 42417 SNP sites in the SNP molecular marker combination described in the above technical solution.

[0183] Preferably, the broiler 50K liquid phase chip also includes probes designed based on the gene sequence covering the SNP site.

[0184] The present invention provides the SNP molecular marker combination described in the above technical scheme or the broiler 50K liquid phase chip described in the above technical scheme associated with the economic traits of broilers; the economic traits of broilers include: broiler weight, carcass rate, breast muscle rate, leg muscle rate, abdominal fat rate, breast muscle intramuscular fat content, muscle pH after slaughter, meat color and IgY antibody titer One or more.

[0185] The present invention provides the use of the SNP molecular marker combination described in the above technical solution or the broiler 50K liquid phase chip described in the above technical solution in broiler targeted capture sequencing.

[0186] The present invention provides the application of the SNP molecular marker combination described in the above technical scheme or the broiler 50K liquid phase chip described in the above technical scheme in one or more of 1) to 4): 1) broiler variety identification; 2) broiler breeding; 3) broiler germplasm resource improvement; 4) broiler population genetic diversity analysis; 5) broiler target trait QTL positioning analysis; 6) broiler association site and candidate gene identification.

[0187] Preferably, the 1) broiler breed identification includes: identification of the relationship between commercial broilers and local breed broilers.

[0188] Preferably, the 2) broiler breeding includes whole genome selection breeding.

[0189] Beneficial effects:

[0190] The present invention provides a SNP molecular marker combination comprising five types of SNP sites: the first type is a significant site related to important economic traits of laying hens (egg-laying performance, egg quality, feed efficiency, etc.) mined by genome-wide association analysis (GWAS) technology, including 977 SNP sites; the second type is a site related to economic traits of broilers reported in existing literature on relevant candidate genes and QTL databases, including 9083 SNP sites; the third type is selected from public databases related to 28-day-old body weight, 42-day-old body weight, carcass rate, breast muscle rate, leg muscle rate, abdominal fat rate, breast muscle intramuscular fat content, slaughter The fourth category is the functional SNP sites related to important traits such as hind muscle pH, meat color, and IgY antibody titer, with a total of 9654 SNP sites; the fourth category is the background skeleton sites suitable for liquid phase arrays selected based on the whole genome resequencing data of broiler chicken populations, with a total of 13345 SNP sites; the fifth category is to supplement the areas not covered by the previous categories from the SNPdatabase database (ftp: / / ftp.ncbi.nlm.nih.gov / snp / organisms / archive / chicken_9031 / ), including 9358 SNP sites.

[0191] The broiler 50K liquid phase chip prepared by using the SNP molecular marker combination provided by the present invention has the following advantages: 1) Optimized design: the chromosomes of the whole genome are evenly distributed with high coverage, which ensures the accuracy of genetic evaluation of the broiler genome; 2) Functional relevance: the chip collects significant sites related to broiler production performance, disease resistance, feed utilization efficiency and other traits, which increases the practicality of the chip; 3) Applicability: the chip sites are derived from SNPs with high polymorphism in commercial high-yield laying hens breeds independently bred and local breeds in my country, which not only meets the scientific research needs of scientific researchers but also meets the work of laying hen enterprises in whole genome molecular breeding; 4) Flexibility: liquid phase chip technology has great advantages in analysis speed, sensitivity, throughput and other aspects. BRIEF DESCRIPTION OF THE DRAWINGS

[0192] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0193] Figure 1 The distribution of the broiler liquid phase chip of the present invention in the chicken genome; wherein the abscissas are 39, 78, 118, 157, and 197200 Mb, respectively, and the ordinates represent chr1, chr2, chr3, chr4, chr5, chr6, chr7, chr8, chr9, chr10, chr11, chr12, chr13, chr14, chr15, chr16, chr17, chr18, chr19, chr20, chr21, chr22, chr23, chr24, chr25, chr26, chr27, chr28, chr30, chr31, chr32, chr33, chrW, and chrZ from top to bottom;

[0194] Figure 2 is the corresponding number of SNP sites of the broiler liquid phase chip in the present invention on each chromosome of the whole genome;

[0195] Figure 3 Violin plot of individual detection rates for two batches of samples;

[0196] Figure 4 This is the Manhattan plot of body weight at 42 days of age. DETAILED DESCRIPTION

[0197] The present invention provides a broiler whole genome SNP molecular marker combination, including 42417 SNP sites located on the chicken reference genome version 6.0 (Gallus_gallus-6.0), and the position information of the SNP sites is shown in Table 1.

[0198] The present invention provides a SNP molecular marker combination comprising five types of SNP sites: the first type is a significant site related to important economic traits of laying hens (egg-laying performance, egg quality, feed efficiency, etc.) mined by genome-wide association analysis (GWAS) technology, including 977 SNP sites; the second type is a site related to economic traits of broilers reported in existing literature on relevant candidate genes and QTL databases, including 9083 SNP sites; the third type is selected from public databases related to 28-day-old body weight, 42-day-old body weight, carcass rate, breast muscle rate, leg muscle rate, abdominal fat rate, breast muscle intramuscular fat content, slaughter The fourth category is the functional SNP sites related to important traits such as hind muscle pH, meat color, and IgY antibody titer, with a total of 9654 SNP sites; the fourth category is the background skeleton sites suitable for liquid phase arrays selected based on the whole genome resequencing data of broiler chicken populations, with a total of 13345 SNP sites; the fifth category is to supplement the areas not covered by the previous categories from the SNPdatabase database (ftp: / / ftp.ncbi.nlm.nih.gov / snp / organisms / archive / chicken_9031 / ), including 9358 SNP sites.

[0199] The present invention provides a broiler chicken 50K liquid phase chip, wherein the genotyping sites of the broiler chicken 50K liquid phase chip include 42417 SNP sites located on the chicken reference genome version 6.0, and the SNP sites are the 42417 SNP sites in the SNP molecular marker combination described in the above technical solution.

[0200] As an embodiment, the broiler 50K liquid phase chip also includes a probe designed based on the gene sequence covering the SNP site.

[0201] The broiler 50K liquid phase chip prepared by using the SNP molecular marker combination provided by the present invention can specifically identify the relationship between commercial broilers and local breeds of broilers, can evaluate the germplasm resources of Chinese and foreign broiler breed resources, and can also perform whole-genome association analysis, whole-genome selection breeding, as well as target trait QTL positioning analysis and population genetics analysis. It can help accelerate the rapid development of the broiler industry and has great economic and practical value and scientific research value.

[0202] The present invention provides the SNP molecular marker combination described in the above technical scheme or the broiler 50K liquid phase chip described in the above technical scheme associated with the economic traits of broilers; the economic traits of broilers include: broiler weight, carcass rate, breast muscle rate, leg muscle rate, abdominal fat rate, breast muscle intramuscular fat content, muscle pH after slaughter, meat color and IgY antibody titer One or more.

[0203] Based on the above advantages, the present invention provides the use of the SNP molecular marker combination described in the above technical solution or the broiler 50K liquid phase chip described in the above technical solution in broiler targeted capture sequencing.

[0204] Based on the above advantages, the present invention provides the application of the SNP molecular marker combination described in the above technical scheme or the broiler 50K liquid phase chip described in the above technical scheme in one or more of 1) to 6): 1) broiler variety identification; 2) broiler breeding; 3) broiler germplasm resource improvement; 4) broiler population genetic diversity analysis; 5) broiler target trait QTL positioning analysis; 6) broiler association site and candidate gene identification.

[0205] As an embodiment, the 1) broiler breed identification includes: identification of the relationship between commercial broilers and local breed broilers. As an embodiment, the 2) broiler breeding includes whole genome selection breeding.

[0206] In order to further illustrate the present invention, a broiler liquid phase chip based on targeted capture sequencing and its application provided by the present invention are described in detail below in combination with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0207] Example 1 Preparation of 50K liquid phase chip for broiler chicken

[0208] The first type of probes of the present invention are obtained: This type of probes are screened based on the applicant's previous genome-wide association analysis of important economic traits of laying hens, and are divided into two parts: the first part is to use 385 white Leghorn and 361 bantam laying hens from 40 families to conduct association analysis on egg-laying performance (egg number and egg weight) and egg quality; the second part is to use the F2 generation resource population obtained by positive and negative crosses between white Leghorn and Dongxiang green shell laying hens to conduct genome-wide association analysis on the egg-laying performance, feed utilization efficiency, egg quality and reproductive performance of 1,512 F2 generation hens. The SNP sites associated with important economic traits of laying hens obtained above are analyzed and removed by biostatistics methods, and 977 functional sites are added to the chip.

[0209] The second type of probe of the present invention is obtained by searching the candidate genes related to broiler growth traits in published literature and the online QTLdatabase database (https: / / www.animalgenome.org / cgi-bin / QTLdb / GG / index) to obtain QTLs related to broiler economic traits, and eliminating QTLs with large confidence intervals and insignificant P values ​​(P>0.05). Finally, 1500 candidate QTL intervals were obtained, and then the SNPs obtained by whole genome resequencing data were intersected with the candidate genes and QTLs to screen out 9083 SNPs as candidate sites related to the traits.

[0210] The third type of probe of the present invention was obtained by searching the chicken SNP database of NCBI (https: / / www.ncbi.nlm.nih.gov / snp) for functional SNP sites related to important traits of broiler chickens such as 28-day-old body weight, 42-day-old body weight, carcass rate, breast muscle rate, leg muscle rate, abdominal fat rate, breast muscle intramuscular fat content, muscle pH after slaughter, meat color, and IgY antibody titer, and finally 9654 SNPs were selected to supplement the chip.

[0211] The fourth type of probe of the present invention is obtained by performing whole genome resequencing on a certain strain of commercial broiler chickens independently bred in China provided by Beijing Huadu Yukou Poultry Co., Ltd., eliminating SNP sites with a minimum allele frequency of less than 0.05 (MAF<0.05) for each strain, and selecting 13,345 background skeleton sites suitable for liquid phase chips.

[0212] The fifth type of probes of the present invention are obtained from the SNP database (ftp: / / ftp.ncbi.nlm.nih.gov / snp / organisms / archive / chicken_9031 / ) to supplement the regions that the first types fail to cover in the whole genome.

[0213] SNP site identification process: Considering that the sizes of different chromosome fragments in chickens vary greatly and the recombination rates of mutation sites on different chromosomes are inconsistent, the first step is to use plink software to detect the linkage disequilibrium level (LD) on each chromosome, so as to set the optimal window / interval size for each chromosome (the window size is set to 100bp). These windows / intervals are used to evenly distribute SNPs on each chromosome. For each interval, one SNP probe common to all strains of the first category is preferentially selected. If there are less than one, the SNP in the second category of probes is selected. The third category of probes is the SNP that is forced to be placed in the chip. If the window cannot be covered after the first and second category probes are selected, the SNP of the fourth category of probes is selected. The fifth category of probes is to supplement the intervals that cannot be covered by the above-mentioned categories of probes.

[0214] The identified SNP sites were submitted to Shijiazhuang Boredi Biotechnology Co., Ltd., and the company's scoring system was used to score, and all sites with a score of <0.8 were removed. For the deleted unqualified SNP sites, the nearest SNP sites were selected for supplementation and scored again. According to the above steps, a total of 42,417 SNP sites were identified and screened, and the location information of the SNP sites is shown in Table 1.

[0215] According to the location of the above 42417 SNP sites, Shijiazhuang Boridi Biotechnology Co., Ltd. was commissioned to prepare a 50K liquid phase chip covering the above 42417 SNP sites. The distribution of the 50K liquid phase chip SNP sites in the chicken genome is shown in Figure 1 The number of SNP sites on each chromosome in the whole genome is shown in Figure 2 .

[0216] Figure 3 To test the detection rate of the chip site, two batches of broiler chickens were tested (D1 and D2). In the first batch of 5902 samples and the second batch of 3064 samples, the average detection rate of the chip was 99.96%, proving that the liquid phase chip has a high detection rate and strong applicability in actual use.

[0217] Table 2 Average distance of 50K liquid phase chip sites on each chromosome of the present invention

[0218] chromosome Average distance between adjacent sites (kb) chromosome Average distance between adjacent sites (kb) 1 24.1585 18 22.7019 2 24.411 19 20.856 3 23.1357 20 19.6022 4 22.4537 21 20.373 5 23.6036 22 29.196 6 22.8208 23 20.2299 7 23.6599 24 20.7397 8 24.3519 25 34.3166 9 22.3236 26 22.5969 10 22.35 27 32.194 11 23.3267 28 22.3455 12 20.8682 30 69.9442 13 22.2104 31 146.502 14 22.9745 32 45.3654 15 21.4849 33 62.0777 16 91.7623 Z 55.2419 17 21.4831 / /

[0219] As can be seen from Table 2, the 50K liquid phase chip provided by the present invention can make the SNP sites evenly distributed on all chromosomes.

[0220] Example 2 Application of the broiler 50K liquid phase chip of the present invention in genome-wide association analysis

[0221] The broiler 50K liquid phase chip provided by the present invention was used to perform genotyping on 460 white Rock chickens provided by Beijing Huadu Yukou Poultry Co., Ltd., and the phenotypic data of the weight of these roosters before slaughter (BW) at 42 days of age were collected. The quality control standard of SNP genotyping: the sample detection rate is greater than 95% (sample Call rate>95%), MAF>0.01, and the remaining 421 individuals and 41207 SNPs after quality control are used for the subsequent whole genome association (GWAS) analysis. The analysis model adopts a linear mixed model, and the P values ​​of 1.6e-05 and 3.2e-04 of the SNP independent number test are used as the thresholds for whole genome significance and potential significance. The Manhattan plot of the GWAS results is shown in Figure 4The results showed that there was a significant region on chromosome 4 that was associated with body weight, which was consistent with previous reports [Gu X, Feng C, Ma L, Song C, Wang Y, Da Y, LiH, Chen K, Ye S, Ge C, Hu X, Li N. Genome-wide association study of body weight inchicken F2 resource population. PLoS One. 2011; 6(7): e21872. doi: 10.1371 / journal.pone.0021872. Epub 2011Jul 14. PMID: 21779344; PMCID: PMC3136483.].

[0222] Example 3 Application of the 50K liquid phase chip of the present invention in genomic selection breeding of broiler chickens - genetic parameter estimation

[0223] The broiler 50K liquid phase chip provided by the present invention was used to perform genotyping on 460 White Rock chickens provided by Beijing Huadu Yukou Poultry Co., Ltd., and the phenotypic data of body weight (BW), residual feed intake (FRI), and liver weight (LW) of these roosters at 42 days of age before slaughter were collected, and their heritability was estimated using GCTA software. The results showed that the heritability of the three traits was 0.37, 0.19, and 0.17, respectively. The heritability obtained by this chip was consistent with the results of previous studies [Yuan J, Dou T, Ma M, Yi G, Chen S, Qu L, Shen M, Qu L, Wang K, Yang N. Genetic parameters offeed efficiency traits in laying period of chickens. Poult Sci. 2015 Jul; 94 (7): 1470-5. doi: 10.3382 / ps / pev122. Epub 2015 May 25. PMID: 26009751; PMCID: PMC4991064.].

[0224] Example 4 Industrial Applicability

[0225] The SNP sites on the broiler 50K liquid phase chip provided by the present invention are respectively derived from SNP sites related to the economic traits of laying hens; SNP sites related to the economic traits of broilers are screened out from the known QTL database; and liquid phase chip skeleton sites are obtained by screening the whole genome resequencing data of broiler groups. The broiler 50K liquid phase chip provided by the present invention can specifically identify the relationship between commercial broilers and local breed broilers, and can also perform whole genome association analysis, whole genome selection breeding, and target trait QTL positioning analysis and population genetics analysis. It has the universality of Chinese and foreign chicken breeds, can help accelerate the rapid development of the broiler industry, and has great economic and practical value and scientific research value.

[0226] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A broiler chicken whole genome SNP molecular marker combination, characterized in that: It includes 42417 SNP sites located on the chicken reference genome version 6.0, and the location information of the SNP sites is shown in the following table: Wherein, Ref is the reference genome base, Alt is the mutant base, the position is the physical position of the Ref or Alt base in the corresponding chromosome, "-" is a deletion mutation; NO.1 is a nucleotide sequence such as the sequence shown in SEQ ID NO.1, NO.2 is a nucleotide sequence such as the sequence shown in SEQ ID NO.2, NO.3 is a nucleotide sequence such as the sequence shown in SEQ ID NO.3, NO.4 is a nucleotide sequence such as the sequence shown in SEQ ID NO.4, NO.5 is a nucleotide sequence such as the sequence shown in SEQ ID NO.5, and NO.6 is a nucleotide sequence such as the sequence shown in SEQ ID NO.6, as follows: SEQ ID NO.1: 5'-GCCAGGCAAGGACAGCCAGGCCTGTCCAGGCAAGGCTAGGCAAGGCAAGGCCAGGAA AGGCAAAGGAAGGACATGCAAGGCAAGGGCAGGCAAGGCAAGGCCAGGCCAGTCCAGGCC-3'; SEQ ID NO.2: 5'-GCCAGGCAAGGACAGCCAGGCCTGTCCAGGCAAGGCTAGGCAAGGCAAGGCCAGGAA AGGCAAAGGAAGGACATGCAAGGCAAGGGCAGGCAAGGCAAGGCCAGGCCAGTCCAGGCC-3'; SEQ ID NO.3: 5'-ATAAGTAATAAGTTT-3'; SEQ ID NO.4: 5'-ATAAGTAATAAGTTT-3'; SEQ ID NO.5: 5'-AGTGATTCCC-3'; SEQ ID NO.6: 5'-AGTGATTCCC-3'; SEQ ID NO.7: 5'-CTTCCCGCTCA-3'; SEQ ID NO. 8: 5'-CTTCCCGCTCA-3'.

2. A broiler 50K liquid phase chip, characterized in that: The genotyping sites of the broiler 50K liquid phase chip include 42,417 SNP sites located on the chicken reference genome version 6.0, and the SNP sites are the 42,417 SNP sites in the SNP molecular marker combination of claim 1.

3. The broiler 50K liquid phase chip according to claim 2, characterized in that: The broiler 50K liquid phase chip also includes probes designed according to the gene sequence covering the SNP site.

4. The SNP molecular marker combination of claim 1 or the broiler 50K liquid phase chip of claim 2 or 3 is associated with the economic traits of broilers; the economic traits of broilers include: One or more of broiler weight, carcass percentage, breast muscle percentage, leg muscle percentage, abdominal fat percentage, breast muscle intramuscular fat content, muscle pH after slaughter, meat color and IgY antibody titer.

5. Use of the SNP molecular marker combination described in claim 1 or the broiler 50K liquid phase chip described in claim 2 or 3 in broiler targeted capture sequencing.

6. Use of the SNP molecular marker combination according to claim 1 or the broiler 50K liquid phase chip according to claim 2 or 3 in one or more of 1) to 4): 1) Identification of broiler breeds; 2) broiler breeding; 3) Improvement of broiler germplasm resources; 4) Analysis of genetic diversity of broiler populations; 5) QTL location analysis of target traits in broiler chickens; 6) Identification of broiler chicken associated loci and candidate genes.

7. The use according to claim 6, characterized in that: The 1) broiler breed identification includes: identification of the relationship between commercial broilers and local breed broilers.

8. The use according to claim 6, characterized in that: The 2) broiler breeding includes whole genome selection breeding.

Images