Method for rapidly identifying chromosome karyotype of hybrid deer

Abstract

The invention is suitable for the technical field of livestock molecular marker breeding, and provides a method for rapidly identifying chromosome karyotype of hybrid deer. The invention provides two SNP sites related to the chromosome karyotype of the hybrid deer, and one site can be used for quickly and accurately identifying the chromosome karyotype of the hybrid deer and is used as a molecular marker breeding means for accelerating breeding; the SNP site is KSRID1 or KSRID2, and the SNP site is KSRID2; the nucleotide sequence of the KSRID1 is as shown in SEQ ID NO.1, and s in the sequence is C or G; the nucleotide sequence of the KSRID2 is as shown in SEQ ID NO.2, and y in the sequence is C or T. Meanwhile, a PCR-RFLP genotyping method is established, large-scale and efficient hybrid deer karyotype detection can be achieved through the method, bad individuals with 67 chromosomes in a breeding group can be eliminated, the breeding performance of the group can be improved, and variety genetic improvement or new strain breeding can be accelerated.

Description

Technical Field

[0001] The invention belongs to the technical field of livestock molecular marker breeding, and in particular relates to a method for rapidly identifying chromosome karyotypes of hybrid deer. Background Art

[0002] Red deer and sika deer are two different species of the genus Cervus in the family Cervidae of the order Artiodactyla of the order Mammalia. They are widely domesticated and raised at home and abroad because of their important medicinal or nutritional value in antlers and meat. They are significantly different in body size, growth and development speed, and appearance characteristics. Red deer are larger, grow faster, and have a higher output of related products. There is a difference in the number of chromosomes in the somatic cells of red deer and sika deer, with red deer having 68 chromosomes and sika deer having 66 chromosomes. This difference stems from the high homology between chromosome 1 of sika deer and chromosomes 4 and 23 of red deer, that is, during the evolution of the species, the ancestors of sika deer formed a larger chromosome (chromosome 1) by fusion of chromosomes 4 and 23 at the centromere (Robertsonian translocation).

[0003] Despite the difference in chromosome numbers, red deer and sika deer can still hybridize to produce offspring with 67 chromosomes. Hybrid offspring usually have significant hybrid advantages, such as body shape, growth and development rate, adaptability and disease resistance are better than purebred sika deer. In order to improve the production performance of sika deer, red deer and sika deer are often hybridized to produce F1 generation, and the F1 generation is backcrossed with sika deer to produce F2 generation, and the F2 generation is selected for commercial deer production; at the same time, the F2 generation can also be used as breeding deer and backcrossed with sika deer to produce F3 generation. It is currently believed that these F1 offspring are fertile, and mating with each other will produce F2 offspring with three karyotypes of 66, 67 and 68. If F1 and sika deer are backcrossed, F2 offspring with two karyotypes of 67 or 66 will be produced. Conversely, if F1 and red deer are backcrossed, F2 offspring with 67 or 68 chromosomes will be produced. However, the number of chromosomes in some individuals of the hybrid offspring F2 is an odd number, which may lead to unbalanced gametes due to the inability of chromosomes to pair and separate normally during meiosis, reducing the reproductive performance of individuals, especially breeding males, so karyotype screening is very necessary. In addition, chromosomes are the carriers of genetic material. The stability of chromosome morphology and number is a prerequisite for the normal growth and development of a species and the continuation of the species. Therefore, it is very important to analyze the chromosome number of hybrid deer individuals through relevant cytogenetic techniques.

[0004] Karyotype analysis of mammals, especially large animals, usually relies on peripheral blood lymphocyte culture technology. Lymphocyte proliferation is stimulated by plant lectin PHA, and then metaphase cells treated with colchicine are collected. Then, the cells are subjected to hypotonicity, pre-fixation, fixation, dripping and staining, and finally the number of chromosomes is counted. However, this traditional chromosome karyotype analysis method is relatively cumbersome, costly, long cycle, time-consuming and labor-intensive, and is particularly difficult to detect in large groups. However, in addition to traditional cell culture methods, there is currently no alternative method that can quickly detect the karyotype of hybrid deer. For this reason, the present invention proposes a method for quickly identifying the chromosome karyotype of hybrid deer. Summary of the invention

[0005] The purpose of the present invention is to provide a method for quickly identifying the chromosome karyotype of hybrid deer, aiming to solve the problems raised in the above background technology.

[0006] The purpose of the present invention is achieved through the following technical solutions: The SNP site associated with the chromosome karyotype of a hybrid deer is KSRID1 or KSRID2; the nucleotide sequence of KSRID1 is shown in SEQ ID NO.1, and s in the sequence is C or G; the nucleotide sequence of KSRID2 is shown in SEQ ID NO.2, and y in the sequence is C or T.

[0007] The primers used to amplify the SNP sites as described above, the primer pair used to amplify KSRID1 includes KSRID1-F and KSRID1-R, and the nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively; the primer pair used to amplify KSRID2 includes KSRID2-F and KSRID2-R, and the nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6 respectively.

[0008] An application of the above-mentioned SNP sites or primers in rapid identification of hybrid deer chromosome karyotypes.

[0009] A method for rapidly identifying the chromosome karyotype of a hybrid deer, comprising: performing PCR amplification on a target genome using the primers described above, detecting the amplified product, and the presence of one band indicates that the hybrid deer has 66 chromosomes, and the presence of three bands indicates that the hybrid deer has 67 chromosomes.

[0010] Furthermore, the primer pair of KSRID1: if the amplified product shows a 482 bp band, the target genome is a hybrid deer with 66 chromosomes; if the amplified product shows three bands of 482 bp, 311 bp, and 171 bp, the target genome is a hybrid deer with 67 chromosomes.

[0011] Furthermore, the primer pair of KSRID2: if the amplified product shows a 492 bp band, the target genome is a hybrid deer with 66 chromosomes; if the amplified product shows three bands of 492 bp, 297 bp, and 195 bp, the target genome is a hybrid deer with 67 chromosomes.

[0012] Furthermore, the PCR amplification system is 30 µL, including: 15 µL of 2× PCR Master Mix, 1 µL of DNA template, 0.25 µL each of the forward and reverse primers of the primer pair, and ddH2O is added to make up to 30 µL.

[0013] Furthermore, the PCR amplification conditions are: pre-denaturation at 95°C for 2 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; and finally extension at 72°C for 5 min.

[0014] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides two SNP sites related to the chromosome karyotype of hybrid deer. Any one of the two sites can be used to quickly and accurately identify the chromosome karyotype of hybrid deer, and can be used as a molecular marker breeding method to accelerate breeding. At the same time, a PCR-RFLP genotyping method is established, which can achieve large-scale and efficient hybrid deer karyotype detection, help eliminate poor individuals with 67 chromosomes in the breeding population, improve population reproduction performance, and accelerate genetic improvement of varieties or cultivation of new strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The results of PCR amplification and electrophoresis; A is the amplification result of KSRID1 site, and B is the amplification result of KSRID2 site; M in the figure: DL2000 DNA Marker; 1-4: Sika deer (2n=66); 5-8: Hybrid deer (2n=67); 9-12: Hybrid deer (2n=66); 13-16: Red deer (2n=68).

[0016] Figure 2 The results of restriction enzyme electrophoresis of PCR products; A is the chromosome number of an individual determined by the size of the restriction enzyme fragment at the KSRID1 site, and B is the chromosome number of an individual determined by the size of the restriction enzyme fragment at the KSRID2 site; M in the figure: DL2000 DNAMarker; 1-4: sika deer (2n=66); 5-8: hybrid deer (2n=67); 9-12: hybrid deer (2n=66); 13-16: red deer (2n=68).

[0017] Figure 3These are the sequencing peak graphs of three genotypes at two sites; A is the sequencing peak graph of three genotypes at the KSRID1 site, and B is the sequencing peak graph of three genotypes at the KSRID2 site.

[0018] Figure 4 The figures are the group genotyping results; A is the group genotyping result based on the KSRID1 locus, and B is the group genotyping result based on the KSRID2 locus; M in the figure: DL2000 DNA Marker; 1-12: F2 individuals; 13-24: F3 individuals.

[0019] Figure 5 Chromosome number analysis for hybrid deer. DETAILED DESCRIPTION

[0020] In order to have a clearer understanding of the technical features, purposes and beneficial effects of the present invention, the technical solution of the present invention is now described in detail below, but it should not be construed as limiting the applicable scope of the present invention.

[0021] The specific implementation of the present invention is described in detail below in conjunction with specific embodiments.

[0022] Example 1: Screening and identification of SNP markers related to chromosome number in hybrid individuals of sika deer and red deer; SNP (single nucleotide polymorphism) mainly refers to the polymorphism of nucleic acid sequence caused by single base variation at the DNA level, which is widely present in the genomes of animals and plants. With the continuous development of high-throughput sequencing technology and the reduction of sequencing costs, it has become a reality to identify SNP markers at the whole genome level. It has been widely used in the fields of genetic diversity analysis, major gene mining and species system evolution analysis. At present, there is a reference genome of red deer in the NCBI nucleic acid database. The present invention screens SNP markers related to chromosome number on chromosome 4 or 23 based on the whole genome sequences of red deer (2n=68), sika deer (2n=66) and hybrid deer (2n=66 or 67), and then establishes a PCR-RFLP genotyping method, which can quickly and efficiently detect the karyotype of hybrid deer on a large scale, eliminate individuals with 67 chromosomes in the breeding population, improve the reproductive performance of the population, and accelerate the genetic improvement of varieties or the cultivation of new strains.

[0023] (1) Screening of SNP markers related to chromosome number; Fastp software was used to filter the whole genome resequencing data of red deer (2n=68), sika deer (2n=66) and hybrid deer (2n=67 or 66) to obtain Clean Data. Clean Data was aligned to the red deer reference genome mCerEla1.1 using BWA software, and then sorted and marked for duplication using Picard software. SNPs were merged and genotyped using the GATK official website recommended process, and the two allele loci on chromosomes 4 and 23 were extracted, and filtered according to the minimum allele frequency and deletion rate to obtain high-quality SNP loci. The Fst values ​​of SNP loci on chromosomes 4 and 23 of red deer and sika deer were calculated using vcftools software, and the loci with an Fst value of 1 were counted; then, among these loci, the loci that were heterozygous in hybrid individuals with 67 chromosomes and homozygous in hybrid deer with 66 chromosomes were selected; and then the SNP loci were screened according to the flanking DNA sequence characteristics and the type of endonuclease at the polymorphic loci. Finally, two loci were selected for subsequent analysis and named KSRID1 (Chr4:g. 6100023 C>G) and KSRID2 (Chr4:g. 13980871C>T). Detailed information is shown in Table 1: Table 1. Information on SNP loci related to chromosome number in hybrid individuals of sika deer and red deer Site name chromosome number Serial Number Location Allele 1 Allele 2 KSRID1 4 NC_057818.1 6100023 C G KSRID2 4 NC_057818.1 13980871 C T (2) Primer design and PCR amplification; 400 bp sequences on both sides of the two SNP sites were extracted from the reference genome, and two pairs of primers were designed using Primer Premier 5.0 software. The sequence information and amplification length of the primers are shown in Table 2: Table 2. PCR amplification primer sequences

[0024] The DNA sequences of the amplified regions and the polymorphic sites are as follows: KSRID1: TGCTGCTGGAAATTGGCAAGTGCCCTGGGGAAAACCAGCTCATTCCTGCCCTTCCTATGAATAAATGTGTATTTCCCCCCAGAAAAGGTCCCTCCTTCCATGAGAAACCAATTAGCAGCTATTTCTGGCAGAAGTTAGTAACTTCCTCTTGACCTACTGTGGACATCTG(C / G)AGTCTAATGTGCACCCATTTCCCCTAGATAGAAACTACCACAGGGCTACACTGAATATCTGAAAAGGAGAAGGCAGAAACTTTTGGTAACCCAGCATTAAAAACAGAGGAAGCTAAGCCAGTTCTGCTGTTTAAAGAAGCAGTTATATTTGAATCCACTAAACCCATTCAGTACTATGCAAACAAATGCTAGTGGGATGAGGCCGTTTCTGCCCCAGGAATGTGGACTTGTCGAGGCCCTAGCTTGCTCCAGGACAGAAACTGTACCCCAGGGGCCAGGTGTTGTCTGCA TGAGGGACTTGGAGGACTGACC (as shown in SEQ ID NO.1).

[0025] KSRID2: ACGCCTTCCAGTGGTTTATCAG GGTCCACTTTAAGTTCCTGCGTTCTGGCAAAAACCTCGAGGTCTCTGATGTTTTGGCAAGCCAGATAAGAGCCCTGGTTAGGTACAAAGACAGAGGTGCACTTACTTCAAGGACGAAGAAACGGGCATTTTTCTGGGGAGCATCAGGGTTGACTTTAATGGTTCTGGCCATTTTGAACGCCTGCAAACCTGGGAAATGCTCAGCGGCCCGAGAAGCACCCTGTTTTTAAATGCAAGTGCAGGTTACCAAGAGGCCACTGCCCTGAGCCACCTG(C / T)AGCCTGACGCTCCAGCACCACCCCCTCACAAGCACGGGGGCCAGTTCTGAGACCAGGTCTGGGGTCACCCGAGACATGTCTAAGGGGGCAGCCAGGGTACAAAGGTCTTAGAAGCCAGCCCCACTGGCTGGGGCTCCTTCTCAGAGTACGTTGGCCCTTAGGAGCCAGCTGTGT GAAAAGGCACCACAAGGATCAA(As shown in SEQ ID NO.2).

[0026] Note: The underlined sequence is the primer position; the two alleles of SNP are in brackets.

[0027] The length of PCR fragments was 300-500 bp, and the primers were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0028] Four red deer (2n=68), four sika deer (2n=66), and eight hybrid F2 deer (2n=67 and 2n=66, 4 each) with known karyotypes (chromosome numbers) were selected for PCR amplification. A total of 16 samples were selected for PCR amplification. The PCR amplification system was 30 µL, including: 15 µL of 2×PCR Master Mix, 1 µL of DNA template, 0.25 µL of forward and reverse primers, and finally made up to 30 µL with ddH2O. The PCR amplification conditions were: 95℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; and finally 72℃ extension for 5 min. The PCR products were subjected to 2.5% agarose gel electrophoresis, and the two pairs of primers amplified 482 and 492 bp bands, respectively, which were consistent with expectations ( Figure 1 ).

[0029] (3) Enzyme digestion and genotype determination; The PCR products were used Pst I endonuclease was used for digestion. The digestion system was 15 µL: 10×buffer 1.5 µL, endonuclease 0.5 µL, PCR product 6 µL, and then ddH2O was used to make up to 15 µL. Digestion was carried out overnight at 37°C. The digestion products were then detected by 2.5% agarose gel electrophoresis, and the chromosome number of the individual was determined based on the size of the digestion fragment. At the two loci, all red deer individuals (2n=68) produced 2 bands, and sika deer individuals (2n=66) produced 1 band, while hybrid deer with 67 chromosomes (2n=67) had 3 bands, and hybrid deer with 66 chromosomes (2n=66) had 1 band ( Figure 2 ).

[0030] The information of the size of the enzyme-cut fragments of different genotypes at the two sites is shown in Table 3: Table 3. PCR-RFLP restriction fragment information

[0031] The PCR products of three genotype individuals were selected for first-generation sequencing, and the results showed that the DNA sequence of the SNP site was consistent with the expected ( Figure 3 ).

[0032] (4) Hybrid population detection and analysis; PCR-RFLP genotyping: In order to verify the applicability of the two SNP loci, PCR-RFLP was used to genotype 24 hybrid deer individuals (F2 or F3), of which 12 F2 individuals were produced by backcrossing between hybrid F1 and sika deer; and the other 12 F3 individuals were produced by backcrossing between F2 hybrid deer and sika deer. The gel electrophoresis results showed that ( Figure 4 ): Among the 12 F2 generations, 5 F2 individuals have 3 bands, and 7 F2 individuals have only 1 band; among the 12 F3 generations, only 1 F3 individual has 3 bands, and the remaining 11 F3 individuals have 1 band. 3 bands indicate that the number of chromosomes is 67 (2n=67), while 1 band represents the number of chromosomes is 66 (2n=66). Therefore, among the 24 hybrid deer individuals, 6 individuals have 67 chromosomes, while the remaining 18 individuals have 66 chromosomes.

[0033] Traditional chromosome karyotype analysis: Jugular vein blood was collected from the above 24 hybrid deer individuals, and 0.5 mL was added to 5 mL RPMI 640 culture medium containing double antibodies and serum. Phytohemagglutinin (PHA) was used as a stimulus to stimulate the proliferation of peripheral blood lymphocytes. After about 68 hours, an appropriate amount of colchicine was added and cultured for another 4 hours. The cells were harvested for chromosome preparation and staining. The results showed that the number of stainings for 6 individuals was 67, while the number of stainings for the remaining 18 individuals was 66 ( Figure 5 and Table 4), which were completely consistent with the PCR-RFLP genotyping results.

[0034] Table 4. Chromosome number and genotype statistics of hybrid deer Individual number Chromosome number (2n) KSRID1 genotype KSRID2 genotype 1 67 CG CT 2 67 CG CT 3 67 CG CT 4 67 CG CT 5 66 GG TT 6 66 GG TT 7 66 GG TT 8 66 GG TT 9 66 GG TT 10 66 GG TT 11 66 GG TT 12 67 CG CT 13 66 GG TT 14 66 GG TT 15 66 GG TT 16 67 CG CT 17 66 GG TT 18 66 GG TT 19 66 GG TT 20 66 GG TT 21 66 GG TT 22 66 GG TT 23 66 GG TT 24 66 GG TT The above results show that the two SNPs of the present invention and the established PCR-RFLP genotyping method can be used for molecular markers of chromosome number of hybrid deer and applied in actual production practice.

[0035] The above are only preferred embodiments of the present invention. It should be pointed out that, for those skilled in the art, several modifications and improvements can be made without departing from the concept of the present invention. These should also be regarded as the protection scope of the present invention. These will not affect the effect of the implementation of the present invention and the practicality of the patent.

Claims

1. A SNP site associated with a hybrid deer chromosome karyotype, characterized in that: The SNP site is KSRID1 or KSRID2; the nucleotide sequence of KSRID1 is shown in SEQ ID NO.1, and s in the sequence is C or G; the nucleotide sequence of KSRID2 is shown in SEQ ID NO.2, and y in the sequence is C or T.

2. A primer for amplifying the SNP site according to claim 1, characterized in that: The primer pair used to amplify KSRID1 includes KSRID1-F and KSRID1-R, and the nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively; the primer pair used to amplify KSRID2 includes KSRID2-F and KSRID2-R, and the nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6 respectively.

3. Use of the SNP site according to claim 1 or the primer according to claim 2 in rapid identification of chromosome karyotype of hybrid deer.

4. A method for rapid identification of hybrid deer chromosome karyotype, characterized in that: The target genome is amplified by PCR using the primers as described in claim 2, and the amplified products are detected. If one band appears, it is a hybrid deer with 66 chromosomes, and if three bands appear, it is a hybrid deer with 67 chromosomes.

5. The method according to claim 4, characterized in that Primer pair of KSRID1: If the amplified product shows a 482 bp band, the target genome is a hybrid deer with 66 chromosomes; if the amplified product shows three bands of 482 bp, 311 bp, and 171 bp, the target genome is a hybrid deer with 67 chromosomes.

6. The method according to claim 4, characterized in that Primer pair of KSRID2: If the amplified product shows a 492 bp band, the target genome is a hybrid deer with 66 chromosomes; if the amplified product shows three bands of 492 bp, 297 bp, and 195 bp, the target genome is a hybrid deer with 67 chromosomes.

7. The method according to claim 4, characterized in that The PCR amplification system is 30 µL, including: 2× PCR Master Mix 15 µL, DNA template 1 µL, forward and reverse primers of the primer pair 0.25 µL each, and ddH2O is added to 30 µL.

8. The method according to claim 4, characterized in that The PCR amplification conditions were as follows: pre-denaturation at 95°C for 2 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; and finally extension at 72°C for 5 min.

Images