KASP molecular marker closely linked with BNS series wheat male sterility major gene locus and application of KASP molecular marker

Abstract

The invention discloses KASP molecular markers closely linked with BNS series wheat male sterility major gene loci and application of the KASP molecular markers, the BNS series wheat male sterility major gene loci are located on a wheat 2A chromosome, and the KASP molecular markers closely linked with the BNS series wheat male sterility major gene loci are AX-174216228 and AX-109413735; the two KASP markers AX-174216228 and AX-109413735 provided by the invention are used for verifying 97 parts of wheat materials, and the results of the two KASP markers AX-174216228 and AX-109413735 completely meet the expectation. The KASP marker provided by the invention has the characteristics of rapidness, simplicity, convenience, high specificity, good accuracy and the like, and the screening and phenotype prediction work of the male sterility major gene locus in a large batch of materials can be completed in a relatively short time.

Description

Technical Field

[0001] The invention belongs to the technical fields of biotechnology and molecular breeding, and particularly relates to a KASP molecular marker closely linked to a BNS series wheat male sterility major gene locus and an application thereof. Background Art

[0002] The use of wheat photothermosensitive male sterility (PTSMS) is a major advance in hybrid wheat research. Wheat photothermosensitive male sterility lines discovered in my country, such as ES, C49S, ZP, BS, YS and BNS, have become important test materials for hybrid wheat research.

[0003] Thermosensitive nuclear male sterile wheat BNS was successfully bred by Ru Zhengang in 2002. BNS has the characteristics of complete sterility and complete fertility conversion. The fertility change trend is: complete sterility-semi-sterility-complete fertility. Low temperature is the main reason affecting the fertility conversion of BNS, which is manifested as low temperature sterility and high temperature fertility. The sensitive part of BNS that senses low temperature is the developing young spikelet. The sensitive period of fertility conversion of BNS is 5-18 days before heading, that is, from the differentiation period of pistil to the formation period of tetrad. During the temperature sensitive period, when the daily minimum temperature is lower than 8℃, it is completely sterile and forms a sterile line; 8-12℃ is the fertility conversion temperature; when it is higher than 12℃, it is completely fertile, and the fertile line is the maintenance line. In northern Henan, sowing from September 23 to October 17 shows complete sterility and can be used to produce hybrids; sowing after November 18 shows complete fertility, and sterile seeds can be self-pollinated. The BNS sterile line has excellent characteristics of good sterility, easy conversion, and specific recovery in the main wheat producing areas of Huanghuai, my country. It is a very valuable sterile line material that can be used for hybrid wheat. BNS366 is bred by saturation backcrossing of BNS and Zhengmai 366. It has the same sterility characteristics and fertility conversion rules as BNS, and the sterility characteristics are more stable. With BNS and BNS366 and other series of similar thermosensitive nuclear sterile materials (collectively referred to as BNS series) as parents, more new sterile lines can be created through breeding, providing rich germplasm resources for the efficient seed production system of hybrid wheat.

[0004] In the process of creating new sterile lines with BNS series wheat as parents, traditional hybridization and backcross selection can be performed between BNS series wheat and other parents, which often requires large-scale populations and a large amount of phenotypic investigation work. In addition, due to the performance of thermosensitive male sterility, a large amount of bagging and self-pollination fruiting rate detection work is required, which greatly increases the workload and cost of breeding. The precise positioning of the sterile gene of BNS series wheat, the development of molecular markers strongly linked to the functional sites of BNS sterile genes, the detection of the gene combination types of sterile characteristics in breeding materials, the introduction of sterile genes according to the breeding improvement goals of creating sterile lines, and the creation of new thermosensitive nuclear sterile germplasm resources have important application value. In the breeding process, sterile traits are easily affected by environmental temperature and are not easy to accurately investigate. However, the identification of allele variant combinations that control the strong linkage of sterile genes can replace the phenotypic investigation of sterile traits and is not affected by the environment, which increases the accuracy of selection, improves the selection efficiency, and accelerates the breeding process.

[0005] Traditional linkage markers are complex to operate, have low throughput, and consume a lot of labor. KASP genotyping technology is a unique competitive allele-specific PCR that can perform high-precision biallelic typing of SNPs and Indels (insertion deletion) on various genomic nucleic acid samples. KASP technology is simple to operate, stable and accurate in analysis, and has low cost. With BNS366 (male sterile) as the female parent and Zhoumai 18 (male fertile) as the male parent, the seeds after hybridization had an international self-pollination fruit setting rate [= (number of grains per ear / (2*number of spikelets)*100%) of less than 5% under normal autumn sowing conditions (sown in Xinxiang, Henan Province from October 10 to October 13) and late sowing conditions (December 1 to December 3) after F1 self-pollination, and it was even lower under normal autumn sowing conditions, close to zero, indicating that there was no BNS366 restoration gene in Zhoumai 18, and then the seeds produced by the F1 generation were collected and planted to form different individual plants of the F2 generation, and the leaves were preserved to extract DNA and detect their international self-pollination fruit setting rate. After the seeds formed by the F2 generation were collected per plant and per ear, they were planted under normal autumn sowing conditions to form F3 generation plants, and the international self-pollination fruit setting rate of each individual plant in the F3 generation ear row was detected to determine whether the male fertile phenotype of the F2 generation individual plant would be separated in the next generation. The DNA of the male sterile individual plants, male fertile individual plants (the corresponding individual plants of the F3 generation all maintained the male fertile phenotype), BNS366 and Zhoumai 18 were constructed into four samples, namely, the male sterile pool, the male fertile pool, the male sterile parent and the male fertile parent. The samples were tested using a 660K chip, and the SNP sites that were consistent with the male sterile parent and inconsistent with the male fertile parent, namely, data 1, were detected. At the same time, the SNP sites that were consistent with the male fertile parent and inconsistent with the male sterile parent, namely, data 2, were detected. Then, the intersection of data 1 and data 2, namely, data 3, was obtained, and then the design was performed based on data 3. KASP primers, designed KASP primers are used to detect their typing in BNS366, Zhoumai 18, male sterile plants, and male fertile plants, and functional molecular markers closely linked to a set of BNS366 male sterility major effect genes are screened out. The BNS366 male sterility major effect gene loci can be located and detected, and the sterility genes of the BNS series wheat or the intermediate materials in the process of breeding new sterile lines with it as the original material can be identified, and the sterility genes can be transferred and aggregated. This can avoid the blindness in traditional breeding, greatly reduce the population size, save costs, and increase the accuracy and efficiency of selection. Summary of the invention

[0006] The purpose of the present invention is to provide a KASP molecular marker tightly linked to the BNS series wheat male sterility major gene locus and its application, so as to use the molecular marker to locate and detect the BNS series wheat male sterility major gene locus, to carry out purposeful selection of offspring in the creation of new BNS series male sterile wheat germplasm, and to provide a guiding basis for the creation of new wheat varieties with BNS series male sterility characteristics.

[0007] The present invention adopts the following technical scheme to achieve the above-mentioned object: a KASP molecular marker closely linked to the BNS series wheat male sterility major gene locus, characterized in that: the BNS series wheat male sterility major gene locus is located on the wheat chromosome 2A, and the KASP molecular markers closely linked to it are AX-174216228 and AX-109413735;

[0008] The KASP molecular marker primers of AX-174216228 are respectively an upstream primer AL1 (FAM) with a nucleotide sequence as shown in SEQ ID NO: 1, an upstream primer AL2 (VIC) with a nucleotide sequence as shown in SEQ ID NO: 2, and a downstream primer C (COM) with a nucleotide sequence as shown in SEQ ID NO: 3;

[0009] The KASP molecular marker primers of AX-109413735 are respectively the upstream primer AL1 (FAM) with a nucleotide sequence as shown in SEQ ID NO: 4, the upstream primer AL2 (VIC) with a nucleotide sequence as shown in SEQ ID NO: 5, and the downstream primer C (COM) with a nucleotide sequence as shown in SEQ ID NO: 6.

[0010] The invention discloses an application of the KASP molecular marker tightly linked to the BNS series wheat male sterility major gene locus in the positioning and detection of the BNS series wheat male sterility major gene.

[0011] The invention discloses an application of the KASP molecular marker tightly linked to the BNS series wheat male sterility major gene locus in creating a new wheat strain with the BNS series male sterility characteristic.

[0012] The invention discloses an application of the KASP molecular marker tightly linked to the BNS series wheat male sterility major gene locus in the selective breeding of thermosensitive nuclear sterile wheat.

[0013] The application of the KASP molecular marker tightly linked to the BNS series wheat male sterility major gene locus described in the present invention specifically comprises the following steps:

[0014] (1) extracting DNA from the wheat sample to be tested;

[0015] (2) After receiving the dry powder of primer synthesis, dilute it with ddH2O to 100mmol / L -1 , and fully vortex to dissolve, respectively obtain primer AL1 (FAM) solution, AL2 (VIC) solution and C (COM) solution, take 2D tube and caps, add 230 μL of 10MmTris-HCl, take 60 μL of AL1 (FAM) solution and AL2 (VIC) solution, 150 μL of C (COM) solution, mix and centrifuge to obtain primer mixture, and put into the library; wherein the KASP molecular marker primers of AX-174216228 are respectively the upstream primer AL1 (FAM) with a nucleotide sequence as shown in SEQ ID NO: 1, the upstream primer AL2 (VIC) with a nucleotide sequence as shown in SEQ ID NO: 2, and the downstream primer C (COM) with a nucleotide sequence as shown in SEQ ID NO: 3, and the primer mixture is named primer (AX-174216228) mix; the KASP molecular marker primers of AX-109413735 are respectively the upstream primer AL1 (FAM) with a nucleotide sequence as shown in SEQ ID NO: 4, the nucleotide sequence as shown in SEQ ID NO: 5, the nucleotide sequence as shown in SEQ ID NO: 6, the nucleotide sequence as shown in SEQ ID NO: 7, the nucleotide sequence as shown in SEQ ID NO: 8, the nucleotide sequence as shown in SEQ ID NO: 9, the nucleotide sequence as shown in SEQ ID NO: 10, the nucleotide sequence as shown in SEQ ID NO: 11, the nucleotide sequence as shown in SEQ ID NO: 12, the nucleotide sequence as shown in SEQ ID NO: 13, the nucleotide sequence as shown in SEQ ID NO: 14, the nucleotide sequence as shown in SEQ ID NO: 15, the nucleotide sequence as shown in SEQ ID NO: 16, the nucleotide sequence as shown in SEQ ID NO: 17, the nucleotide sequence as shown in SEQ ID NO: 18, the nucleotide The upstream primer AL2 (VIC) shown in NO:5 and the downstream primer C (COM) whose nucleotide sequence is shown in SEQ ID NO:6, and the primer mixture is named primer (AX-109413735) mix;

[0016] (3) Using Nexar, the diluted DNA in the 384 plate and the MIX and KASP markers required for the PCR reaction are automatically dispensed onto the 384 Array Tape and sealed;

[0017] (4) Perform PCR reaction using a Soellex water bath system;

[0018] PCR reaction system:

[0019] The 1.6 μL system of PCR amplification reaction includes: 2×Master mix 0.4 μL, primer mix 0.022 μL, DNA to be detected 0.8 μL, ddH2O 0.4 μL; when the KASP molecular marker of AX-174216228 is detected, the primer mix added is primer (AX-174216228) mix; when the KASP molecular marker of AX-109413735 is detected, the primer mix added is primer (AX-109413735) mix;

[0020] PCR reaction procedure:

[0021]

[0022] (5) After the Soellex water bath PCR is completed, remove the Array Tape, wipe each Tape dry, and centrifuge it using a dedicated Array Tape centrifuge at 700 rpm for 10-15 min.

[0023] (6) After centrifugation, the Array Tape was automatically scanned by the Araya high-throughput pipeline fluorescence signal scanner, and all the data were automatically transmitted to the central server. The results were analyzed and interpreted by the Kraken software, and a test report was issued. The alleles AX-174216228-C and AX-174216228-T were excellent alleles with positive and negative effects on the male sterile phenotype of the BNS series of wheat, respectively. The alleles AX-109413735-C and AX-109413735-A were excellent alleles with positive and negative effects on the male sterile phenotype of the BNS series of wheat, respectively.

[0024] The BNS series wheat male sterility-related typing detection kit of the present invention comprises the KASP molecular marker tightly linked to the BNS series wheat male sterility major gene locus. The BNS series wheat male sterility-related typing detection kit of the present invention is used in creating new wheat lines with BNS series male sterility characteristics.

[0025] The present invention uses an F2 recombinant inbred line population with BNS366 as the female parent and Zhoumai 18 as the male parent as the material, performs phenotypic identification on the international method of self-pollination fruit setting rate under normal autumn sowing conditions, and combines a high-density linkage map constructed with a 660K SNP chip to locate the major gene locus controlling the male sterility trait of the thermo-sensitive nuclear male sterile wheat BNS366 on chromosome 2A, and is closely linked to the AX-174216228 and AX-109413735 molecular markers, and obtains primer sequences corresponding to the molecular markers. The two KASP markers developed by the present invention were used to provide 97 materials of BNS366 (19 plants, male sterile), Zhoumai 18 (11 plants, male fertile), F1 generation after hybridization of BNS366 and Zhoumai 18 (16 plants, male sterile), male fertile homozygous materials in F4 generation after hybridization of BNS366 and Zhoumai 18 (25 plants, male fertile), two parents BNS (13 plants, male sterile) and Zhengmai 366 (5 plants, male fertile) when BNS366 was created, Wenmai No. 6 (5 plants, male fertile) and Zhengmai 9023 (3 plants, male fertile), and the verification was carried out under normal autumn sowing conditions, and the experimental results were consistent with expectations.

[0026] The innovation of the present invention is:

[0027] 1. The present invention locates the major gene of the BNS series wheat thermosensitive male sterility gene on chromosome 2A, and is closely linked to the AX-174216228 and AX-109413735 molecular markers, and for the first time develops two KASP molecular markers that are closely linked to the major gene loci of the BNS series wheat male sterility trait. Experiments have shown that the major gene loci controlling the BNS series wheat male sterility are the major loci that can be stably expressed under normal autumn sowing conditions;

[0028] 2. The KASP molecular marker developed by the present invention is based on the 660K high-density SNP chip. Compared with traditional molecular markers, it is fast, simple, highly specific and accurate, and can complete the screening of large quantities of materials and phenotype prediction in a relatively short time;

[0029] 3. The KASP molecular marker developed by the present invention based on the major effect gene of BNS series wheat male sterility has the function of assisting selection for its male sterility characteristics, and can be used for molecular marker assisted selection breeding, greatly accelerating the breeding process of wheat varieties.

[0030] The present invention applies the KASP molecular marker closely linked to the BNS series wheat male sterility major gene locus to wheat breeding, which not only enables rapid and accurate screening, is not affected by the environment, and has a clear selection target, but also saves costs and greatly improves the selection efficiency and selection quality of high-yield wheat varieties or lines. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The results of genotyping of AX-174216228 locus in 58 wheat materials, including male sterile plants (43 plants), male fertile plants (12 plants, 11 of which were selected as high-quality samples after quality inspection), BNS366 (parent 1, male sterile, 2 plants) and Zhoumai 18 (parent 2, male fertile, 2 plants), in the F2 population (BNS366 (male sterile) was used as the female parent and Zhoumai 18 (male fertile) was used as the male parent to obtain hybrid F1, and F1 was self-pollinated to produce F2). The blue dots indicate the genotype is CC, the red dots indicate the genotype is TT, the green dots indicate the genotype is CT, and the black dots indicate the control without DNA template.

[0032] Figure 2The results of genotyping of AX-109413735 locus in 58 wheat materials, including male sterile plants (43 plants), male fertile plants (12 plants, 11 of which were selected as high-quality samples after quality inspection), BNS366 (parent 1, male sterile, 2 plants) and Zhoumai 18 (parent 2, male fertile, 2 plants), in the F2 population (BNS366 (male sterile) was used as the female parent and Zhoumai 18 (male fertile) was used as the male parent to obtain hybrid F1, and F1 was self-pollinated to produce F2). The blue dots indicate the genotype is CC, the red dots indicate the genotype is AA, the green dots indicate the genotype is CA, and the black dots indicate the control without DNA template. DETAILED DESCRIPTION

[0033] The following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials, reagents, etc. used in the examples are commercially available unless otherwise specified.

[0034] Example 1

[0035] Obtaining Tightly Linked Molecular Markers for the Candidate Loci of Male Sterility Gene in Thermo-sensitive Genic Male-sterile Wheat BNS366

[0036] (1) Hybrid F1 was obtained by hybridization with BNS366 (male sterile) as the female parent and Zhoumai 18 (male fertile) as the male parent. F1 was self-pollinated to produce F2 (231 plants). The flag leaf of each individual plant of the F2 generation was collected and preserved for later use.

[0037] (2) Phenotypic identification of male sterility and male fertility in wheat

[0038] After wheat heading and before flowering, two ears in total from the main stem or large tillering ears were selected and bagged for self-pollination. After harvesting at maturity, the seeds were tested and their international self-pollination fruit setting rate was detected. The average value was calculated, and the materials with an average self-pollination fruit setting rate of 0 were designated as fully sterile materials (male sterile materials, the same below), and the materials with an average self-pollination fruit setting rate greater than or equal to the self-pollination fruit setting rate of Zhoumai 18 in the same year were designated as male highly fertile materials (male fertile materials, the same below).

[0039] (3) Genotype scanning and localization of the male sterility gene of BNS366

[0040] a) Genomic DNA extraction: DNA of male sterile plants (43 plants), male fertile plants (12 plants), BNS366 (parent 1, male sterile, 2 plants) and Zhoumai 18 (parent 2, male fertile, 2 plants) of the above F2 population was extracted by CTAB method, and its concentration was detected and diluted to 50-100 ng / μL. DNA of male sterile plants (43 plants) of F2 generation was mixed to construct male sterile pool 1 (12 plants, 9 of which were actually selected as high-quality samples after quality inspection) and male sterile pool 2 (31 plants, 16 of which were actually selected as high-quality samples after quality inspection), and DNA of male fertile plants (12 plants, 8 of which were actually selected as high-quality samples after quality inspection) of F2 generation was mixed to construct male fertile pool.

[0041] b) Wheat 660K SNP scan

[0042] The wheat 660K SNP chip (Zhongyujin Marker (Beijing) Biotechnology Co., Ltd.) was used to scan and determine the genotype information. The genotyping results were quality controlled to obtain 397,087 high-quality SNP markers. After removing the sites without physical positions, 362,593 SNP markers were obtained. There were 75,196 homozygous difference sites between parents. There were 691 sites with consistent genotyping between the male sterile parent and male sterile pool 1, and the markers were inconsistent with the male fertile pool; there were 3014 sites with consistent genotyping between the male sterile parent and male sterile pool 2, and the markers were inconsistent with the male fertile pool. The sites obtained from male sterile pool 2 were combined for the two male sterile pools (data 1). There were 9364 sites with consistent genotyping between the male fertile parent and male fertile pool, and the markers were inconsistent with male sterile pool 1 and male sterile pool 2 (data 2). The intersection of data 1 and data 2 (data 3) was obtained. Referring to the Triticum-aestivum v1.0 version, two SNP markers were found on chromosome 2A that were closely linked to the BNS366 sterility gene, namely AX-174216228 (at position 778024123 on the chromosome) and AX-109413735 (at position 780762484 on the chromosome). The sequences on both sides of the SNPs of these two molecular markers are as follows:

[0043] The sequences on both sides of the SNP of the molecular marker AX-174216228 are as follows:

[0044]

[0045] Another situation of the sequences on both sides of the SNP of the molecular marker AX-174216228 is:

[0046]

[0047] The sequences on both sides of the SNP of the molecular marker AX-109413735 are as follows:

[0048]

[0049] Another situation of the sequences on both sides of the SNP of molecular marker AX-109413735 is:

[0050]

[0051] (4) Development of KASP markers

[0052] In order to facilitate the identification and auxiliary selection of two SNP markers AX-174216228 and AX-109413735 in the hybrid offspring of BNS366 and Zhoumai 18, and to reduce the breeding cost and workload and enhance the operability in breeding work, it is necessary to develop the target molecular marker probe sequence into a KASP marker that can be used for identification and screening based on conventional molecular biological methods. We designed two upstream primers [AL1 (FAM), AL2 (VIC)] and a common downstream primer C (COM) for the two target molecular markers:

[0053] The nucleotide sequence of the upstream primer AL1 (FAM) of AX-174216228:

[0054] 5'-3'GAAGGTGACCAAGTTCATGCTATGATGATAACACACGTCTGTTCG, as shown in SEQ ID NO: 1;

[0055] The nucleotide sequence of the upstream primer AL2 (VIC) of AX-174216228:

[0056] 5'-3'GAAGGTCGGAGTCAACGGATTACATGATGATAACACACGTCTGTTCA, as shown in SEQ ID NO: 2;

[0057] The nucleotide sequence of the downstream primer C (COM) of AX-174216228:

[0058] 5'-3'TCGGTTGAGCAACCTAATGGACGAT, as shown in SEQ ID NO:3;

[0059] The nucleotide sequence of the upstream primer AL1 (FAM) of AX-109413735 is:

[0060] 5'-3'GAAGGTGACCAAGTTCATGCTGTTGTTGCCAACCTCATAGACG, as shown in SEQ ID NO:4;

[0061] The nucleotide sequence of the upstream primer AL2 (VIC) of AX-109413735:

[0062] 5'-3'GAAGGTCGGAGTCAACGGATTAAGTTGTTGCCAACCTCATAGACT, as shown in SEQ ID NO:5;

[0063] The nucleotide sequence of the downstream primer C (COM) of AX-109413735:

[0064] 5'-3'CGTGCACACGACCAGTGACAAAAAT, as shown in SEQ ID NO:6.

[0065] (5) Primer detection

[0066] a) Using 58 wheat genomic DNAs from the F2 generation of hybridization of BNS366 (male sterile) and Zhoumai 18 (male fertile), male sterile plants (43 plants), male fertile plants (12 plants, 11 of which were high-quality samples were selected after quality inspection), BNS366 (2 plants) and Zhoumai 18 (2 plants) as templates, PCR amplification was performed on the template using the primers shown in SEQ ID NO: 1 (FAM), SEQ ID NO: 2 (VIC), SEQ ID NO: 3 (COM) and SEQ ID NO: 4 (FAM), SEQ ID NO: 5 (VIC), SEQ ID NO: 6 (COM).

[0067] b) Receive the dry powder after primer synthesis, dilute with ddH2O to 100mmol / L at 12000rpm for 10min, and fully vortex to dissolve, to obtain primer FAM, VIC and COM solutions respectively. Take 2D tubes and caps, add 10Mm Tris-HCL 230μL, take 60μL of FAM and VIC solution, 150μL of COM solution, mix and centrifuge to obtain primer mixture, and store;

[0068] The KASP molecular marker primers of AX-174216228 are respectively an upstream primer (FAM) with a nucleotide sequence as shown in SEQ ID NO: 1, an upstream primer (VIC) with a nucleotide sequence as shown in SEQ ID NO: 2, and a downstream primer (COM) with a nucleotide sequence as shown in SEQ ID NO: 3, and the primer mixture is named primer (AX-174216228) mix; the KASP molecular marker primers of AX-109413735 are respectively an upstream primer (FAM) with a nucleotide sequence as shown in SEQ ID NO: 4, an upstream primer (VIC) with a nucleotide sequence as shown in SEQ ID NO: 5, and a downstream primer (COM) with a nucleotide sequence as shown in SEQ ID NO: 6, and the primer mixture is named primer (AX-109413735) mix.

[0069] c) Nexar automatically dispenses the diluted DNA in the 384 plate and the MIX and KASP markers required for PCR reaction onto the 384 Array Tape and seals the tape.

[0070] d) Performing PCR reaction using a Soellex water bath system;

[0071] PCR reaction system:

[0072] The 1.6 μL PCR amplification reaction system includes: 2× Master mix 0.4 μL, primer mix 0.022 μL, DNA to be tested 0.8 μL, ddH2O 0.4 μL;

[0073] When the KASP molecular marker of AX-174216228 is detected, the primer mix added is primer (AX-174216228) mix; when the KASP molecular marker of AX-109413735 is detected, the primer mix added is primer (AX-109413735) mix;

[0074] PCR reaction procedure:

[0075]

[0076] e) After the Soellex water bath PCR is completed, take out the Array Tape, wipe each Tape dry, and use a dedicated Array Tape centrifuge to centrifuge at 700 rpm for 10-15 minutes.

[0077] f) After centrifugation, the Array Tape is automatically scanned by the Araya high-throughput pipeline fluorescence signal scanner. All data are automatically transmitted to the central server, and the results are analyzed and interpreted by Kraken software, and a test report is issued.

[0078] (6) Genotyping and verification results

[0079] The alleles AX-174216228-C and AX-174216228-T are excellent alleles with positive and negative effects on the male sterility phenotype of BNS366 wheat, respectively; the alleles AX-109413735-C and AX-109413735-A are excellent alleles with positive and negative effects on the male sterility phenotype of BNS366 wheat, respectively.

[0080] Example 2

[0081] Application of the developed KASP molecular marker in identification and screening of male sterility traits in BNS series wheat

[0082] (1) A total of 97 accessions were collected, including BNS366 (19 plants, male sterile), Zhoumai 18 (11 plants, male fertile), F1 generation after hybridization of BNS366 and Zhoumai 18 (16 plants, male sterile), male fertile homozygous materials in the F4 generation after hybridization of BNS366 and Zhoumai 18 (25 plants, male fertile), the two parents of BNS366 (13 plants, male sterile) and Zhengmai 366 (5 plants, male fertile), Wenmai 6 (5 plants, male fertile), and Zhengmai 9023 (3 plants, male fertile), and phenotypic identification was carried out under normal autumn sowing conditions.

[0083] (2) KASP marker detection was performed on the harvested wheat materials. The specific method was as follows: total genomic DNA of leaves was extracted at the three-leaf stage; genomic DNA of 97 materials was used as substrate, and PCR amplification was performed using the developed KASP marker primers carrying different fluorescent marker signals. The primers were:

[0084] Upstream primer AL1 (FAM) of AX-174216228:

[0085] 5'-3'GAAGGTGACCAAGTTCATGCTATGATGATAACACACGTCTGTTCG (SEQ ID NO: 1),

[0086] Upstream primer AL2 (VIC) of AX-174216228:

[0087] 5'-3'GAAGGTCGGAGTCAACGGATTACATGATGATAACACACGTCTGTTCA (SEQ ID NO: 2),

[0088] Downstream primer C (COM) of AX-174216228:

[0089] 5'-3'TCGGTTGAGCAACCTAATGGACGAT(SEQ ID NO:3),

[0090] Upstream primer AL1 (FAM) of AX-109413735:

[0091] 5'-3'GAAGGTGACCAAGTTCATGCTGTTGTTGCCAACCTCATAGACG (SEQ ID NO: 4),

[0092] Upstream primer AL2 (VIC) of AX-109413735:

[0093] 5'-3'GAAGGTCGGAGTCAACGGATTAAGTTGTTGCCAACCTCATAGACT(SEQ ID NO:5),

[0094] Downstream primer C (COM) of AX-109413735:

[0095] 5'-3'CGTGCACACGACCAGTGACAAAAAT (SEQ ID NO: 6).

[0096] The PCR amplification system, PCR reaction procedure and PCR product detection are shown in Example 1.

[0097] (3) Genotyping and verification results

[0098] The two KASP molecular markers of the present invention are closely linked to the male sterile phenotype in 97 materials. It shows that the male sterile superior alleles identified from the F2 generation population of BNS366 and Zhoumai 18 are also applicable to the F1 generation and F4 generation materials after the hybridization of BNS366 and Zhoumai 18, BNS and other conventional materials, and the experimental results are consistent with expectations. It shows that the markers of the present invention that are closely linked to the male sterile gene of the BNS series wheat do have the effect of assisting the selection of the male sterile phenotype. The alleles AX-174216228-C and AX-174216228-T are excellent alleles with positive and negative effects on the male sterility phenotype of BNS series (BNS and BNS366) wheat, respectively; the alleles AX-109413735-C and AX-109413735-A are excellent alleles with positive and negative effects on the male sterility phenotype of BNS366 series (BNS and BNS366) wheat, respectively.

[0099] Table 1 Genotyping and verification results

[0100]

[0101] The two KASP molecular markers of the present invention have clear sequences and primers, clear chromosome positions, high efficiency and accuracy, and can be directly used in molecular marker-assisted selection breeding through case implementation.

[0102] The above has been described in detail with general descriptions and specific embodiments of the present invention, but on the basis of the present invention, some modifications or improvements can be made, which are easy to operate for those skilled in the art. Therefore, these modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

Claims

1. KASP molecular markers closely linked to the major effect gene loci of BNS series wheat male sterility, characterized by: The major effect gene locus of BNS series wheat male sterility is located on wheat chromosome 2A, and the KASP molecular markers closely linked to it are AX-174216228 and AX-109413735; The KASP molecular marker primers of AX-174216228 are respectively an upstream primer AL1 (FAM) with a nucleotide sequence as shown in SEQ ID NO: 1, an upstream primer AL2 (VIC) with a nucleotide sequence as shown in SEQ ID NO: 2, and a downstream primer C (COM) with a nucleotide sequence as shown in SEQ ID NO: 3; The KASP molecular marker primers of AX-109413735 are respectively the upstream primer AL1 (FAM) with a nucleotide sequence as shown in SEQ ID NO: 4, the upstream primer AL2 (VIC) with a nucleotide sequence as shown in SEQ ID NO: 5, and the downstream primer C (COM) with a nucleotide sequence as shown in SEQ ID NO:

6.

2. Use of the KASP molecular marker tightly linked to the BNS series wheat male sterility major gene locus as claimed in claim 1 in the localization and detection of the BNS series wheat male sterility major gene.

3. Use of the KASP molecular marker tightly linked to the major effect gene locus of BNS series wheat male sterility as claimed in claim 1 in creating new wheat lines with BNS series male sterility characteristics.

4. Use of the KASP molecular marker tightly linked to the major effect gene locus of BNS series wheat male sterility as claimed in claim 1 in the selective breeding of thermosensitive nuclear male sterile wheat.

5. The use according to any one of claims 2 to 4, characterized in that The specific process is: (1) extracting DNA from the wheat sample to be tested; (2) After receiving the dry powder of primer synthesis, dilute it with ddH2O to 100mmol / L -1 , and fully vortex to dissolve, respectively obtain primer AL1 (FAM) solution, AL2 (VIC) solution and C (COM) solution, take 2D tube and caps and add 10Mm Tris-HCl230μL, take AL1 (FAM) solution and AL2 (VIC) solution 60μL, C (COM) solution 150μL, mix and centrifuge to obtain primer mixture, and put into library; wherein the KASP molecular marker primers of AX-174216228 are respectively the upstream primer AL1 (FAM) with the nucleotide sequence shown in SEQ ID NO:1, the upstream primer AL2 (VIC) with the nucleotide sequence shown in SEQ ID NO:2, and the downstream primer C (COM) with the nucleotide sequence shown in SEQ ID NO:3, and the primer mixture is named primer (AX-174216228) mix; the KASP molecular marker primers of AX-109413735 are respectively the upstream primer AL1 (FAM) with the nucleotide sequence shown in SEQ ID NO:4, the nucleotide sequence shown in SEQ ID The upstream primer AL2 (VIC) shown in NO:5 and the downstream primer C (COM) whose nucleotide sequence is shown in SEQ ID NO:6, and the primer mixture is named primer (AX-109413735) mix; (3) Using Nexar, the diluted DNA in the 384 plate and the MIX and KASP markers required for the PCR reaction are automatically dispensed onto the 384 Array Tape and sealed; (4) Perform PCR reaction using a Soellex water bath system; PCR reaction system: The 1.6 μL system of PCR amplification reaction includes: 2×Master mix 0.4 μL, primer mix 0.022 μL, DNA to be detected 0.8 μL, ddH2O 0.4 μL; when the KASP molecular marker of AX-174216228 is detected, the primer mix added is primer (AX-174216228) mix; when the KASP molecular marker of AX-109413735 is detected, the primer mix added is primer (AX-109413735) mix; PCR reaction procedure: (5) After the Soellex water bath PCR is completed, remove the Array Tape, wipe each tape dry, and centrifuge it using a dedicated Array Tape centrifuge at 700 rpm for 10-15 min. (6) After centrifugation, the Array Tape was automatically scanned by the Araya high-throughput pipeline fluorescence signal scanner, and all the data were automatically transmitted to the central server. The results were analyzed and interpreted by the Kraken software, and a test report was issued. The alleles AX-174216228-C and AX-174216228-T were excellent alleles with positive and negative effects on the male sterile phenotype of the BNS series of wheat, respectively; the alleles AX-109413735-C and AX-109413735-A were excellent alleles with positive and negative effects on the male sterile phenotype of the BNS series of wheat, respectively.

6. A BNS series wheat male sterility related typing detection kit, characterized in that It comprises the KASP molecular marker as claimed in claim 1 which is closely linked to the major effect gene locus of BNS series wheat male sterility.

7. Use of the BNS series wheat male sterility-related typing detection kit according to claim 6 in creating new wheat varieties with BNS series male sterility characteristics.

Images