Application of multi-element compound aqueous solution, method for preventing color fading of sorghum grains and structural gene for improving color of sorghum seeds

Abstract

The invention discloses application of a multi-element compound aqueous solution, a method for preventing color fading of sorghum grains and a structural gene for improving the color of the sorghum seeds. According to the application of the multi-element compound aqueous solution, the multi-element compound aqueous solution is prepared from, by mass, 8%-10% of citric acid, 2%-3% of potassium sorbate, 0.5%-1% of propyl dihydrojasmonate and the balance water. The multi-element compound aqueous solution is used for preventing color fading of sorghum grains. The method for preventing color fading of sorghum grains comprises the following steps: 1) spraying sorghum clusters on the 21st-27th day after blooming by using a multi-element compound aqueous solution, spraying once every 7d, and spraying for 2-4 times. (2) harvesting the sorghum 45-50 days after blooming; and 3) drying until the water content is reduced to below 13%. The method can effectively reduce the risk of color fading of the sorghum grains, can improve the seed quality, effectively improves the commodity value, and prolongs the storage time.

Description

Technical Field

[0001] The invention relates to an application of a multi-component composite aqueous solution, a method for preventing sorghum grains from fading and a structural gene for improving sorghum seed color, and belongs to the technical field of preventing sorghum grains from fading. Background Art

[0002] The wine industry is a "hundred-billion-level" industry in Guizhou Province, and the cultivation of sorghum for wine has become a characteristic and advantageous industry in Guizhou Province. At present, there is a problem of seed fading during the storage process of sorghum after harvesting, which seriously affects its commodity value.

[0003] Current research progress shows that multiple factors affect the color of sorghum grains, such as the color of the exocarp, the thickness of the mesocarp, the presence or absence of the seed coat, and the color of the seed coat (Fernandez et al., 2008). The color of the exocarp is controlled by the R and Y genes, which interact to regulate the different colors of the seed coat, including yellow (rrY_), red (R_Y_) and white (RRyy, ryyy) (Zhou Fuping, 2015). In 2008, ESMace reported that the Y gene that regulates sorghum grain color is located in the 121.9-128.8 cM interval of chromosome 1 of sorghum and is closely linked to the SSR marker txp279. Based on the homologous comparison results of the maize pericarp color p1 gene, it is speculated that the Y gene of sorghum may be Sb0lg037670, which encodes a MYB transcription factor family gene (Mace & Jordan, 2010; Sidorenko & Chandler, 2008). The R gene is located between the RFLP marker umc63 and the SSR marker txp120 on chromosome 3 of sorghum (Mace & Jordan, 2010). In addition, a study reported a sorghum pericarp color enhancement gene I, in which the kernels of the RYI genotype are darker in color, while the kernels of the RYi genotype are pink. This gene is located in the 91.1-103.3 cM interval of chromosome 7 of sorghum and is closely linked to the SSR marker msbcir300 (Mace & Jordan, 2010). For the genes for mesocarp thickness (Z and z), they are located in the 89.9-104.4 cM interval of chromosome 2 of sorghum and are closely linked to the SSR markers txp298 and SbAGAB03 (Mace & Jordan, 2010). Studies have shown that the presence or absence of sorghum seed coat is determined by two genes. When both genes are dominant, sorghum produces an outer pericarp. At this time, if the dominant diffusible factor gene (S) is present at the same time, the exocarp will appear brown; if the s gene is recessive, the brown color of the exocarp will be suppressed (Lu Xiaochun, 2017). There are two genes that control the color of sorghum seed coat, namely B1 and B2. Among them, the B2 gene is located in the 32.3-36cM interval of chromosome 2 of sorghum and is closely linked to the SSR marker txp304 (Mace & Jordan, 2010). Fernandez et al. used yellow endosperm sorghum KS115 and white endosperm sorghum Macia as parents to construct recombinant inbred lines to study the quantitative trait QTL positioning of sorghum endosperm color. The results showed that the QTLs related to endosperm color are located on chromosomes 1, 2, 3, 5, 6, 7, 8 and 10 of sorghum, respectively (Fernandez et al., 2008).

[0004] The invention provides a method for preventing sorghum grains from fading and a structural gene for improving the color of sorghum seeds, thereby reducing the risk of seed fading and prolonging storage. Summary of the invention

[0005] The invention provides uses of a multi-component composite aqueous solution, a method for preventing sorghum grains from fading, and a structural gene for improving sorghum seed color, which can effectively reduce the risk of sorghum grains fading and improve commodity value.

[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows:

[0007] A use of a multi-component composite aqueous solution, which consists of 8-10% citric acid, 2-3% potassium sorbate, 0.5-1% propyl dihydrojasmonate and the remainder of water, wherein the aforementioned percentages are mass percentages; the multi-component composite aqueous solution is used to prevent sorghum grains from fading.

[0008] The multi-component composite aqueous solution can also be used to increase superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT) in sorghum.

[0009] A method for preventing sorghum grains from fading comprises the following steps:

[0010] 1) spraying sorghum ears on the 21st to 27th day after flowering with a multi-component composite aqueous solution, spraying once every 7 days, and spraying 2 to 4 times; the multi-component composite aqueous solution is composed of 8 to 10% citric acid, 2 to 3% potassium sorbate, 0.5 to 1% propyl dihydrojasmonate and the remainder water, and the above percentages are mass percentages;

[0011] 2) Harvest sorghum 45 to 50 days after flowering;

[0012] 3) Dry until the moisture content drops below 13%.

[0013] In step 3), spraying is performed so that all surfaces of the ear are evenly adhered to the spray liquid.

[0014] The sorghum maturity stage is divided into 6 periods, as follows:

[0015]

[0016] As sorghum seeds mature, the starch content gradually increases, while the soluble sugar content gradually decreases. 45 days after sorghum flowering, the starch content reaches a peak, while the soluble sugar content drops to the lowest point. In addition, as sorghum continues to mature, secondary metabolites such as total phenols, flavonoids, and anthocyanins gradually accumulate, reaching the highest level 45 days after flowering. The conductivity value of sorghum seeds drops to the lowest 45 days after flowering, indicating that the sorghum is fully mature.

[0017] If harvesting is done too early, the grains may not be fully filled, resulting in insufficient grain weight, thus reducing yield; if harvesting is done too late, not only will respiratory consumption and rain erosion increase, but the possibility of grain falling, spike sprouting, and lodging will also increase, resulting in reduced yield and quality. For sorghum used for brewing, sensory quality is also an important evaluation indicator; sorghum of different maturity also has great differences in color, and the market prefers sorghum with bright red color. As the maturity of sorghum grains increases, its color parameters Δc (color deviation angle), Δa (redness), and Δb (yellowness) show a gradual increasing trend. In the late waxy maturity (full maturity), the seeds' Δc, Δa, and Δb reach their maximum values, and are significantly higher than other periods.

[0018] During the maturation of sorghum, the thousand-grain weight shows a trend of first increasing and then decreasing. The thousand-grain weight of sorghum grains reaches its maximum value about 24 days after flowering (late milk maturity). At this stage, the dry matter accumulation of sorghum grains may be close to the peak. As the maturity increases, the seeds begin to enter the natural dehydration stage, resulting in a continuous decrease in the thousand-grain weight, which stabilizes after 31 days after flowering. In order to maximize the quality and yield of sorghum grains, it is recommended that sorghum be harvested after 31 days after flowering, or even later.

[0019] As the sorghum seed maturation process progresses, the standard germination rate of the seeds will show a certain trend of change. In the early stage after flowering, because the seeds are not yet fully mature, the activity of various enzymes is low, and the seed vitality is correspondingly weak, which affects the germination process. However, after the middle stage of milky maturity (after 17 days after flowering), the germination rate of sorghum seeds in each harvested batch began to show a leap-forward growth, and eventually tended to be basically stable. For sorghum seeds, a higher germination rate may be shown in the middle stage (about 17 days later) and late stage (after 35 days) of seed development.

[0020] The conductivity of the seed extract slowly decreases in the early stage of development, and sharply decreases in the middle stage, until it reaches the lowest level on the 45th day after flowering (late wax maturity), and then remains at a low level and basically stabilizes. The soluble sugar content in sorghum seeds gradually decreases with increasing maturity, reaching the lowest level on the 38th-45th day after full flowering, and the lowest point occurs on the 45th day after full flowering, that is, the late wax maturity (maturity stage). The starch content reaches its highest value on the 38th-45th day after full flowering, and reaches its maximum value on the 45th day, indicating that the sorghum grains are fully mature at this time.

[0021] As sorghum kernels developed, the accumulation of total phenolic, flavonoid, and anthocyanin compounds gradually increased until the late waxy stage (45 days after anthesis), when total phenolic, flavonoid, and anthocyanin levels in sorghum kernels reached their highest levels.

[0022] As one of the specific preferred implementation schemes, in step 1), the sorghum ears on the 23rd-24th day after flowering are sprayed with a multi-component composite aqueous solution for 3 times; in step 2), the sorghum is harvested on the 45th day after flowering.

[0023] In the above step 3), the drying method is: hanging the fruit ears to dry in the sun, hot air drying in an oven at 40°C for 4 hours after threshing, spreading the fruit ears on a bamboo mat to dry in the sun, spreading the fruit ears on the ground to dry in the sun, spreading them on a bamboo mat to dry in the sun after threshing, and drying them on the ground after threshing.

[0024] In order to better meet the needs of different occasions, in the above step 3), the best drying method for sorghum used for brewing is to dry it in an oven at 40°C for 4 hours after threshing; when used as sorghum seeds, the best solution is to hang the ears in the sun to dry. The inventors have found through research that hanging the ears in the sun to dry is the best way to maintain seed vitality and promote seed germination, and is more suitable for the sorghum seed production industry. For food sorghum used for brewing applications without considering seed vitality, under mechanical drying, the sorghum has the highest yellowness value Δb and brightness Δl, a relatively high redness Δa, and a low mold rate, which is more in line with the market standards for the appearance and quality of food sorghum.

[0025] The structural genes for improving the color of sorghum seeds include: flavonoid isomerase gene, cinnamic acid-4-hydroxylase gene and genes related to anthocyanin synthesis. The genes related to anthocyanin synthesis are chalcone synthase gene CHS and anthocyanin reductase gene-ANR.

[0026] The above-mentioned flavonoid isomerase genes are flavonoid isomerase gene (CHI) Sobic.001G035600; cinnamic acid-4-hydroxylase gene (C4H) Sobic.003G337400; chalcone synthase gene (CHS): Sobic.005G137100, Sobic.005G137200; anthocyanin reductase gene (ANR): Sobic.006G226800, Sobic.006G226900 up-regulated. That is, the structural genes that improve sorghum seed color include Sobic.001G035600 (flavonoid isomerase gene), Sobic.003G337400 (cinnamic acid-4-hydroxylase gene), Sobic.005G137100, Sobic.005G137200, Sobic.006G226800 and Sobic.006G226900 (genes related to anthocyanin synthesis), among which the chalcone synthase gene CHS (Sobic.005G137100 and Sobic.005G137200) and the anthocyanin reductase gene-ANR (Sobic.006G226800 and Sobic.006G226900). The aforementioned genes affect the flavonoid metabolic pathway.

[0027] Table 1: Gene ID and transcript sequence of structural genes that improve sorghum seed color

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035] By spraying the multi-component solution, the flavonoid isomerase gene (CHI) Sobic.001G035600; cinnamic acid-4-hydroxylase gene (C4H) Sobic.003G337400; chalcone synthase gene (CHS): Sobic.005G137100, Sobic.005G137200; anthocyanin reductase gene (ANR): Sobic.006G226800, Sobic.006G226900 were upregulated to prevent sorghum grain fading. The nucleotide sequences of each gene are shown in Table 1.

[0036] The above-mentioned structural genes for improving the color of sorghum seeds can regulate the accumulation of flavonoids and anthocyanins, including apigenin, luteolin, quercetin, isoflavones, dihydroquercetin and catechins, thereby improving the color of sorghum grains and enhancing the stability of sorghum grains during storage.

[0037] The technologies not mentioned in the present invention are all referred to the prior art.

[0038] The method for preventing sorghum grains from fading can effectively reduce the risk of sorghum grains fading, improve seed quality, effectively increase commodity value, and prolong storage. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 The pictures are of sorghum ears at different maturity stages (the upper pictures are early milky, middle milky and late milky stages from left to right, and the lower pictures are early waxy, middle waxy and late waxy stages from left to right);

[0040] Figure 2 is the thousand-grain weight of sorghum grains at different maturity stages;

[0041] Figure 3 is the germination rate of sorghum grains at different maturity stages;

[0042] Figure 4 is the soluble sugar content of sorghum grains at different maturity stages;

[0043] Figure 5 is the starch content of sorghum grains at different maturity stages;

[0044] Figure 6 is the relative conductivity of sorghum grains at different maturity stages;

[0045] Figure 7 is the germination index of sorghum seeds under different drying methods (in the figure, the horizontal axis is: spreading on bamboo mats with ears, drying on the ground after threshing, spreading on bamboo mats after threshing, spreading on the ground with ears, hanging with ears to dry, and hot air drying in an oven at 40°C for 4 hours after threshing (mechanical drying));

[0046] Figure 8 The sprout length and root length of sorghum seeds treated with different drying methods on the seventh day after germination ( Figure 8 There are 26 figures of bud length and root length in each figure, in which the horizontal axis is: spreading the fruit ears on the ground to dry, spreading the fruit ears on bamboo mats to dry after threshing, spreading the fruit ears on bamboo mats to dry, hanging the fruit ears to dry, drying on the ground after threshing, and hot air drying in an oven at 40°C for 4 hours after threshing (mechanical drying);

[0047] Fig. 9 Sorghum grains after being treated by different drying methods;

[0048] Fig.10 Effects of different drying methods on sorghum seed color ( Fig.10 There are 6 figures, namely Δl, Δa, Δb, Δc, Δh and Δe. In each figure, the horizontal axis is: hanging and drying with fruit ears, hot air drying in an oven at 40°C for 4h after threshing (mechanical drying), spreading fruit ears on bamboo mats for drying, spreading fruit ears on the ground for drying, spreading fruit ears on bamboo mats for drying after threshing, and drying on the ground after threshing); DETAILED DESCRIPTION

[0049] In order to better understand the present invention, the content of the present invention is further explained below in conjunction with the embodiments, but the content of the present invention is not limited to the following embodiments.

[0050] Measurement items and methods

[0051] 1. Determination of Thousand-Grain Weight

[0052] From the sorghum seed samples at different time periods after flowering, a portion of the samples were air-dried. 1,000 seeds of uniform size were taken from each seed batch sample, and each was repeated 8 times. The seeds sampled each time were weighed to obtain the thousand-grain weight of the seeds.

[0053] 2. CIELAB color determination

[0054] The color of sorghum seeds was measured using a ColorI7S colorimeter (Osaka, Japan). Each treatment had three replicates, and 300 grams of seeds were spread flat in a glass petri dish. The color value was measured using a five-point sampling method, and the average of the five measurements was used as a replicate.

[0055] CIELAB color model overview: To ensure the reproducibility of color measurement, a 200×200 pixel area was separated from the scanned image and converted to L*a*b* units. The L*a*b* color space mathematically describes all perceptible colors in three-dimensional space, where L* represents brightness, a* and b* represent green-red and yellow-blue respectively.

[0056] The value range of L* is from 0 (darkest black) to 100 (brightest white). The parameter a* indicates that negative values ​​are green and positive values ​​are red. Negative values ​​of the parameter b* indicate yellow and positive values ​​indicate blue. The calculation of color saturation C and hue angle h is as follows: C = [2(A*) + 2(B*)] / 2, H* = Arctan (B* / A*)

[0057] 3. Determination of total phenols, total flavonoids and anthocyanins

[0058] The extraction reagent was 10% trichloroacetic acid-methanol solution. Weigh 0.5 g of fresh seeds from each treatment, freeze them in liquid nitrogen, grind them into powder, and then put them into EP tubes. Add 4 mL of acidified methanol to the tube and mix the sample thoroughly, then place the EP tube containing the solution flat on the oscillator. Adjust the vibration amplitude to ≤5 mm and the rotation speed to 1420 r·min. -1 . After shaking at room temperature for 20 minutes, the sample was centrifuged at 6000 rpm for 6 minutes, 1 mL of the supernatant was taken and diluted to 101 mL. UV-Vis spectrophotometer Evolution 220 (Thermo Fisher, USA) was used for preheating for 30 minutes, and the absorbance values ​​were measured at 280 nm, 325 nm, 600 nm and 530 nm after the preheating. The absorbance values ​​of each sample were measured three times, wherein the absorbance value at 280 nm indicated the total phenol content, and the absorbance value at 325 nm indicated the flavonoid content. 3-deoxyanthocyanidin standard solutions of 0, 1.0, 5.0, 10.0, 20.0, 40.0 and 60.0 mg / mL of luteolin were set, and a standard curve was drawn by measuring the absorbance value at 527 nm. The standard curve was determined at 527 nm. The equation is A = 0.0164841C-0.01364846, where A is the absorbance value; C is the concentration in mg / L, and the correlation coefficient r 2 =0.999. The anthocyanin content of different treatments was obtained according to the formula: anthocyanin content (mg / kg) = (C×V) / m, where C: mass concentration of anthocyanin in the sample, in mg / L; V: volume of fixed volume, in milliliters; m: mass of the sample to be tested, in grams.

[0059] 4. Determination of total starch

[0060] The total starch was determined using the Solebow BC0700-50 tube / 48 sample plant total starch detection kit (Beijing, China). The determination method was referred to the kit instructions.

[0061] 5. Determination of soluble sugar

[0062] The soluble sugar was determined using the Solebio BC0035-100T / 96S Plant Soluble Sugar Detection Kit (Beijing, China). The determination method was described in the kit instructions.

[0063] 6. Determination of relative conductivity

[0064] Relative conductivity was measured using a conductivity meter. When the selective permeability of the plant cell membrane is not fully formed or damaged, electrolytes in the cell will seep into the surrounding medium. Deionized water is used as the surrounding medium, and the electrolytes that seep out will increase the conductivity of the water, usually manifested as an increase in conductivity. The less complete the cell membrane structure, the more electrolytes that seep out, resulting in enhanced conductivity of the medium, and therefore the higher the measured conductivity. Take 30 sorghum seeds of uniform size and maturity and put them in 30mL of deionized water, and soak them in the dark at 25°C for 3 hours. Then use a DDS-11A conductivity meter to measure the conductivity value of the seed soaking solution (A1). Then heat the soaking solution in a boiling water bath for 1 hour, and then measure its conductivity value after boiling (A2).

[0065] The relative conductivity was calculated using the following formula: Relative conductivity (%) = A1 / A2×100.

[0066] 7. Determination of germination rate

[0067] Some seeds collected at different time periods after flowering were treated under refrigerated conditions at 4°C for 7 days. 100 clean seeds were selected from each batch and tested using the paper germination method, with 3 replicates each time. Culture was carried out in a constant temperature incubator at 26°C with 12 hours of light / 12 hours of darkness. Timing was started from the beginning of germination until the 7th day, and the percentage of normal germination was calculated.

[0068] Here are the steps for the paper germination method: First, clean and dry the petri dish with 50% alcohol. Place two layers of qualitative filter paper in the petri dish. Sterilize the seeds with 5% sodium hypochlorite and then rinse them three times with distilled water. Gently pick up the seeds with sterilized tweezers and place them evenly on the filter paper. Cover the petri dish and place it in a pre-adjusted constant temperature incubator for cultivation and observation.

[0069] Example 1

[0070] This study selected the local sorghum variety Hongyingzi in Guizhou Province as the research object, and was conducted at the test site of the Seed Farm of Guizhou Moutai Liquor (Group) Hongying Subsidiary Technology Development Co., Ltd. in Tanchang Town, Renhuai City, Zunyi City, Guizhou Province. The area of ​​the test site is about 650 square meters. The three development stages of sorghum seeds (late milky maturity, early waxy maturity, and mid-waxy maturity) were selected, and the ears were sprayed with treatment agents in the field.

[0071] 1) Select sorghum with consistent growth and good growth as the test material. Use a multi-component compound liquid (10% citric acid, 3% potassium sorbate, 1% propyl dihydrojasmonate, and water as the balance) to spray the ears, with 20 plants in each treatment group and 20 plants in the control group. The treatment started on August 16, 2023 (the 23rd day after flowering), and the treatment was evenly applied on both sides of the ears with a back-type electric sprayer, spraying once every 7 days for 3 times.

[0072] 2) Harvest sorghum at 45 days after flowering.

[0073] 3) After threshing, hot air drying was carried out in an oven at 40°C for 4 hours until the moisture content dropped to below 13%.

[0074] Comparative Example:

[0075] Comparative Example 1: The fruit ears were not sprayed and served as a control group (U); the rest were referred to Example 1.

[0076] Comparative Example 2: The fruit ears were sprayed with water, which was used as the water treatment group (W); the rest were referred to Example 1.

[0077] Comparative Example 3: Only 10% citric acid aqueous solution was used for treatment. The rest were all referred to Example 1.

[0078] Comparative Example 4: Only 3% potassium sorbate aqueous solution was used for treatment. The rest were all referred to Example 1.

[0079] Comparative Example 5: Only 1% propyl dihydrojasmonate aqueous solution was used for treatment. The rest were all referred to Example 1.

[0080] After drying, the samples were stored at a constant temperature of 15°C for 180 days. Samples were collected at 0, 60 and 180 days after storage and the color parameters were measured.

[0081] Table 2 Color parameters

[0082]

[0083]

[0084] The color parameters of seeds treated with multi-component aqueous solution were significantly higher than those of seeds treated with water and untreated seeds. Treatment with multi-component aqueous solution increased the brightness, redness and yellowness of sorghum grains, making their color brighter and redder.

[0085] The Δl parameter of the control group and the water treatment group gradually decreased as the storage process progressed. After 180 days of storage, the Δc, Δe, Δl, Δa, Δb and Δl values ​​of the grains in the multi-component aqueous solution were significantly higher than those of the water-treated, untreated and other control groups, and the brightness was almost unchanged, making them appear brighter and more ruddy in the subsequent drying and storage process.

[0086] Comparative Example 6:

[0087] The concentrations of citric acid, potassium sorbate and propyl dihydrojasmonate in the multi-component composite aqueous solution were adjusted respectively, and spraying was performed according to the method of Example 1.

[0088] When the mass concentration of citric acid was adjusted to 15%, the rest was referred to Example 1, and the color parameters did not change significantly compared with Example 1, but the brightness decayed after storage, and the brightness at 180 days was significantly decayed by 12.6% compared with 0 days. When the mass concentration of citric acid was adjusted to 5%, the rest was referred to Example 1, and the color parameters were reduced by more than 6.2% compared with Example 1.

[0089] When the mass concentration of potassium sorbate is adjusted to 8%, the rest is referred to Example 1, and the color parameters are reduced by more than 5.8% compared with Example 1. When the mass concentration of potassium sorbate is adjusted to 1%, the rest is referred to Example 1, and the color parameters are reduced by more than 6.3% compared with Example 1.

[0090] When the mass concentration of propyl dihydrojasmonate was adjusted to 5%, the rest was referred to Example 1, and the color parameters did not change significantly compared with Example 1, but the brightness decayed after storage, and the brightness decay rate was 10.1% after 180 days compared with 0 days. When the mass concentration of propyl dihydrojasmonate was adjusted to 0.1%, the rest was referred to Example 1, and the color parameters were reduced by more than 7.6% compared with Example 1.

[0091] CAT, POD and SOD are important antioxidant enzymes in plants and play a vital role in protecting plants from oxidative damage. After 180 days of storage, CAT and POD in the multi-component solution (Example 1), the control group (U) and the water treatment group (W) were tested respectively;

[0092] The test method is as follows: weigh 0.1g of seeds from different treatments, grind them into powder with liquid nitrogen, put them into a centrifuge tube pre-frozen with liquid nitrogen, add 1mL of extract to the centrifuge tube with the sample, mix the sample and extract on ice, centrifuge at 4°C (8000g) for 10 minutes, and take the supernatant with a pipette and put it on ice. Each treatment was repeated 3 times, and the MultiskanFC microplate reader (Thermo Fisher, USA) was preheated for more than 30 minutes, and the wavelengths were adjusted to 560nm, 470nm and 240nm, respectively, and zeroed with distilled water.

[0093] SOD (superoxide dismutase): After adding the test solution to the ELISA plate, let it stand at room temperature for 30 minutes, and then measure the absorbance value A of each tube at 560nm. Inhibition percentage = (A control tube-A test tube) ÷ A control tube x 100%, SOD activity (U / g fresh weight) = 11.11x inhibition percentage ÷ (1-inhibition percentage) ÷ W (W: sample mass, 0.1g).

[0094] POD (peroxidase): After adding the test solution to the ELISA plate, place it in the ELISA instrument and record the absorbance value A1 at 470nm at 1 minute and the absorbance value A2 after 2 minutes. Calculate Δa = A2-A1, POD (U / g fresh weight) = 4000xΔa÷W (W: sample mass, 0.1g).

[0095] CAT (catalase): After adding the test solution to the ELISA plate, place it in the ELISA reader and record the initial absorbance value A1 at 240nm and the absorbance value A2 after 1 minute. Calculate Δa = A1-A2, CAT (nmol / min / g fresh weight) = 918xΔa÷W (W: sample mass, 0.1g).

[0096] The results showed that after 180 days of storage, the SOD activity in the sorghum seeds treated with the multi-component compound liquid (Example 1) was 2.01 times and 1.68 times higher than that in the water treatment group (Comparative Example 2) and the control group (Comparative Example 1), respectively; the POD activity in the multi-component compound liquid treatment group was 2.13 times and 1.69 times higher than that in the water treatment group and the control group, respectively; and the CAT activity in the multi-component compound liquid treatment group was 2.53 times and 1.83 times higher than that in the water treatment group and the control group, respectively.

[0097] 50 g of samples were extracted and quickly frozen in liquid nitrogen and then stored in a -80 ± 1C freezer for subsequent analysis, transcriptome sequencing, metabolome analysis, and qRT-PCR.

[0098] Transcriptomic analysis

[0099] Total RNA was extracted from each sample using RNAprep Pure Plant Kit (Tiangen, Beijing, China). The quality of RNA was determined using Nanophotometer Spectrophotometer (IMPLEN, California, USA) and Agilent Bioanalyzer2100 system (Agilent Technologies, CA, USA). Libraries were constructed using TruSeqStranded mRNALT sample preparation kit (Illumina, CA, USA) and sequenced on the Illumina HiSeq X Ten platform at OE Biotech Co., Ltd. (Shanghai, China) to generate 150 bp paired-end reads. Raw reads were processed using Trimomatic (Bolger et al., 2014), and clean reads were mapped to the Sorghum bicolor v3.1.1 genome (Phytozome genome ID: 454) using HISAT2 (Kim et al., 2016). The fragments per kilobase million (FPKM) value of each gene was calculated using Cufflinks (Trapnell et al., 2010), and their read counts were obtained using HTSeq-Count (Trapnell et al., 2010). Differential expression analysis was performed using the DESeq (2012) R package (Love et al., 2018), with p value ≤ 0.05, fold change (FC) ≤ ​​0.5 or ≥ 2, and FPKM ≥ 2 as the thresholds for significant differentially expressed genes (DEGs). Principal component analysis (PCA) of the expression profiles was performed using the R PCA function.

[0100] To validate the results of transcriptome analysis, qRT-PCR experiments were performed. According to the transcriptome sequencing data, four highly up-regulated DEGs (differentially expressed genes) and four highly down-regulated DEGs were selected based on their differential expression patterns. Gene Sobic.002G148700.2 showed stable expression in all treatments and was selected as a reference gene. Total RNA was extracted from sorghum using the Plant RNA Extraction Kit (DNase I) (Conway Biotech, Jiangsu, China). Any impurities were removed using HiFiScript gDNA Removal RT MasterMix (Conway Biotech, Jiangsu, China). cDNA was synthesized using HiFiScript cDNA Synthesis Kit (Conway Biotech, Jiangsu, China). Real-time fluorescence quantitative PCR (qRT-PCR) analysis was performed using UltraSYBR One Step qRT-PCR Kit (Conway Biotech, Jiangsu, China). The relative expression level was calculated by Equation 2 -ΔΔct (Willems et al., 2008). The expression level of the reference gene was normalized to 1, and the fold changes of other points compared with the reference gene were calculated. The primers used are listed in the table below.

[0101] Table 3 qRT-PCR primer sequences

[0102] Primer Name Primer Sequence(Forward) Primer Sequence (Reverse) >Sobic.002G148700 TGACGAGAGGAAGAGGAGGAAGG AGCATGGTCGTTAGCGAGATGG >Sobic.002G148700 GGCGACGGATATGGCTACGG CTTTGCCTTCCTTTCCCTCTTTGC >Sobic.006G148800 ACCTCGTCCCGCTGTCCTAC TCCACCTTCCTCCCGTCCAC >Sobic.001G012200 CCAACACCAACACCAATACCAACC TGCTTGCTTCGCTTCGCTTTG >Sobic.001G438000 GGTGAAGGTGATGGTGGAGGAC CCAGCCGCATGTCGTAGGAG >Sobic.001G059800 TGCTCCTGCTCCTGCTCTCC GAAGCTCTCCTCGCCGAAGTG >Sobic.001G014800 GCCTCGCCCTCCTCAACAAC CCAATACAGTCCTTTGCCACATCG >Sobic.004G139100 GCGACACCGACCAACTTGTTTC ACGAAGAAGGCGGCTGATGC >Sobic.004G238801 TGGAGGATCATCAGGAGGAGGTC TGACAAGAGGCAGTTGAGGAGTG >Sobic.009G143500 TGGAGGATCATCAGGAGGAGGTC TGACAAGAGGCAGTTGAGGAGTG >Sobic.003G236551 GGGCAGCAGTGTACCTGTTCC AGATTGAGATGGCGCTGGTGAC

[0103] Data analysis

[0104] DMs and DEGs were annotated using the Kyoto Encyclopedia of Genomes (KEGG) database and an automated annotation server. Fisher's exact test was used to determine the significance of KEGG pathway enrichment of differential metabolites.

[0105] Analyses were performed using Excel 2016 (Microsoft Inc., Redmond, WA, USA), IBM SPSS Statistics version 22 (IBMCorp., Armonk, NY, USA), and Graphpad prism 9. One-way analysis of variance (ANOVA) followed by Duncan’s multiple comparison test was used to determine significance between treatments at a probability level of P < 0.05 and P < 0.01. Graphs were prepared using Graphpad prism 9.0.

[0106] Combined analysis of transcriptome and metabolome showed that the multi-component solution treatment mainly affected the flavonoid metabolic pathway. The structural genes affecting the flavonoid metabolic pathway included Sobic.001G035600 (flavonoid isomerase gene), Sobic.003G337400 (cinnamate-4-hydroxylase gene), Sobic.005G137100, Sobic.005G137200, Sobic.006G226800 and Sobic.006G226900 (genes related to anthocyanin synthesis); among them, Sobic.005G137100 and Sobic.005G137200 were chalcone synthase genes CHS; Sobic.006G226800 and Sobic.006G226900 were anthocyanin reductase genes-ANR. These genes regulate the accumulation of anthocyanins, such as apigenin, luteolin, quercetin, isoflavones, dihydroquercetin, and catechins, thereby improving the color and enhancing the stability of sorghum grains during storage. The results of this study are expected to provide new insights into sorghum grain storage and provide theoretical technology for the safe production of sorghum for wine with high market acceptance.

[0107] Example 2

[0108] Comparison of sorghum grain morphology and color changes at different maturity stages:

[0109] This study selected Hongyingzi, a local sorghum variety in Guizhou Province, as the research object and was conducted at the test site of the Seed Farm of Guizhou Moutai Liquor (Group) Hongying Subsidiary Technology Development Co., Ltd. in Tanchang Town, Renhuai City, Zunyi City, Guizhou Province. The area of ​​the test site is about 650 square meters. Samples were collected on the 10th day after the sorghum bloomed, and 8-10 ears were taken each time. The sampling frequency was once every 3 days until it was fully mature. At each sampling, the ears were placed in a nylon mesh bag, beaten with a stick until completely threshed, and then air-selected to remove impurities. After removing impurities, the grains in each mesh bag were randomly mixed as experimental materials.

[0110] After each sampling, 10 sorghum seeds of uniform size and color were selected for processing. First, the seeds were cut longitudinally with a scalpel to observe the internal structure and changes, and the color was checked to determine the maturity. Then, the seeds were tested for indicators such as thousand-grain weight, CIELAB color, total flavonoids, total starch, soluble sugar content, relative conductivity, and germination rate.

[0111] 1. According to the changes in the color and contents of sorghum grains at different harvesting periods, the sorghum grain maturation process is divided into 6 periods, see Table 3.

[0112] Table 4 Changes in morphology and color of sorghum grains at different maturity stages

[0113]

[0114] Depend on Figure 1 It can be seen that with the increase of sorghum grain maturity, its color parameters Δc (color saturation), Δa (redness) and Δb (yellowness) show a gradual increasing trend.

[0115] In the late waxy stage (full maturity stage), the Δc, Δa and Δb of the seeds reached their maximum values ​​and were significantly higher than those in other stages. In general, as sorghum grains matured, their Δh (color deviation angle) and Δl (brightness) showed a trend of increasing first and then decreasing. Δl reached its maximum value in the middle waxy stage (full maturity stage) and reached its minimum value in the late waxy stage (full maturity stage). The Δh parameter reached its maximum value in the middle waxy stage and was its minimum value in the early milky stage. The total color difference Δe of sorghum seeds was significantly higher in the early waxy stage than in other stages. Taking the standard black colorimetric card as the reference color, the Δa, Δb, Δl, Δc, Δh and Δe of sorghum grains in the fully mature stage were 18.67 / NBS, 20.30 / NBS, 9.2 / NBS, 28.82 / NBS, 7.90 / NBS and 24.11 / NBS, respectively. As sorghum grains matured, their colors became more and more red and yellow, the color saturation became higher and higher, and the brightness increased first and then decreased.

[0116] 2. Comparison of changes in sorghum grain morphology and thousand-grain weight at different maturity stages:

[0117] Table 5 Thousand-grain weight of sorghum grains at different maturity stages

[0118] Harvest time (after flowering) Mature stage Thousand-grain weight SD 10 Early milk maturity 8.216 2.5275 17 Mid-milk ripeness 15.86 2.5774 24 Late milk maturity 23.543 4.435 31 Early waxy stage 21.642 1.345 38 Waxy mid-stage 22.488 1.2146 45 Late waxy stage (full maturity) 22.39 1.678

[0119] Depend on Figure 2 It can be seen that during the maturation of sorghum seeds, the thousand-grain weight shows a trend of first increasing and then decreasing. The changes in the early stage of development are more significant, that is, within 0-24 days after flowering, the thousand-grain weight increases rapidly and reaches its maximum value at about 24 days (late milky maturity). Subsequently, during the 31st-45th day, the thousand-grain weight began to decline and basically stabilized. This phenomenon shows that in the early stage after flowering, sorghum seeds are not yet fully mature, have a high water content, and are still in a grain filling state. Cell metabolism is active, and although the dry matter mass is small, the dry matter accumulates rapidly. As the seeds mature, dry matter gradually accumulates and the thousand-grain weight gradually increases. Approaching the maturity stage, the cell metabolism of the seeds slows down, begins to dehydrate naturally, and the water content of the seeds gradually decreases. Until the seeds are fully mature, the thousand-grain weight remains basically stable and the size no longer changes.

[0120] 3. Comparison of germination rates of sorghum grains at different maturity stages

[0121] Table 6 Germination rate of sorghum grains at different maturity stages

[0122] Harvest time (after flowering) Mature stage Germination rate SD 10 Early milk maturity 68.333 0.577 17 Mid-milk ripeness 91.667 4.163 24 Late milk maturity 96.333 2.517 31 Early waxy stage 97.333 1.528 38 Waxy mid-stage 95.667 1.155 45 Late waxy stage (full maturity) 94.667 1.528

[0123] Depend on Figure 3 It can be seen that during the development of sorghum seeds, sorghum seeds began to have the ability to germinate from the 10th day after flowering. As the development time increased, the standard germination rate of the seeds showed a gradual increase as a whole, until the 31st day (early wax maturity), when the standard germination rate reached the highest value of 97.33%. After that, the standard germination rate of sorghum seeds remained at the maximum level and tended to be stable.

[0124] 4. Comparison of soluble sugar content in sorghum grains at different maturity stages

[0125] Depend on Figure 4 It can be seen that during the maturation of sorghum seeds, as the seeds develop, the soluble sugar content in the seeds shows a trend of first increasing and then decreasing. In the middle of milky maturity, the soluble sugar content reaches a peak and then begins to decline. In general, the change is small in the early stage of seed development (milky stage), and decreases rapidly in the middle stage (waxy stage), until it drops to the lowest value in the late waxy stage (fully mature stage).

[0126] Before sorghum seeds mature, their cells contain a variety of different types and amounts of sugars, resulting in a high soluble sugar content. However, as they mature, these sugars are gradually converted into other substances such as starch, causing the soluble sugar content to decrease. Until the seeds are fully mature, the soluble sugar content remains basically stable.

[0127] 5. Comparison of starch content in sorghum grains at different maturity stages:

[0128] Depend on Figure 5 It can be seen that the starch content of sorghum grains was measured from the 10th day after the flowering and pollination of red tassel sorghum, and the measurement was carried out every 7 days until the 45th day. After the flowering and pollination of sorghum, the ovary gradually swelled, the grains began to form and entered the filling stage. In the early stage of seed development, the starch content changed little, but increased rapidly in the middle stage until it reached its maximum value in the late stage. The overall trend was opposite to the change in soluble sugar content. Within 24 days after pollination, the starch content increased fastest until it reached its peak on the 45th day after pollination, indicating that the starch accumulation rate peaked in the middle stage of filling.

[0129] 7. Comparison of relative conductivity of sorghum grains at different maturity stages

[0130] The conductivity of the seed soaking solution is an important indicator for detecting seed vitality. It plays a significant role in reflecting the repair and damage ability of the cell membrane in the early stage of seed germination. Therefore, there is a negative correlation between conductivity and seed vitality. Studies have shown that by testing the conductivity of sorghum seeds of different maturity, it was found that the conductivity gradually decreased with the passage of harvest time. Specifically, from the 10th day after flowering to the fully mature stage, the conductivity decreased from 121.45μS / (cm*g) to 29.4325μS / (cm*g), a decrease of 75.77%. These results reveal that delays in seed harvesting will lead to increased seed cell integrity and reduced damage rate until 45 days after the sorghum seeds bloom, when the relative conductivity drops to the lowest point.

[0131] Example 3

[0132] Comparison of the effects of different sorghum seed drying methods:

[0133] This experiment used Hongyingzi, a local sorghum variety in Guizhou Province, as the research object. The experiment was conducted at the seed farm of Guizhou Maotai Liquor (Group) Hongying Subsidiary Technology Development Co., Ltd. in Tanchang Town, Renhuai City, Zunyi City, Guizhou Province. The area of ​​the test site is about 650m 2 . The ears were sprayed with a multi-component liquid (10% citric acid, 3% potassium sorbate, 1% propyl dihydrojasmonate, and the remainder was water). The treatment began on the 23rd day after flowering, and was evenly applied on both sides of the ears with a back-type electric sprayer. The spray was applied once every 7 days for 3 times. Sorghum was harvested and sampled 45 days after flowering. When sampling, the ears were placed in nylon mesh bags without threshing or beaten with a stick until completely threshed, followed by air separation and impurity removal. After impurities were removed, the grains in each mesh bag were randomly mixed and used as experimental materials. The average temperature of the experimental site was 21℃-31℃.

[0134] The sorghum seeds to be dried were divided into 6 parts on average, and the process of drying grains by farmers was simulated. 6 different drying methods were set, namely, hanging and drying with ears, hot air drying in an oven at 40°C for 4h after threshing (mechanical drying), spreading on bamboo mats with ears, spreading on the ground with ears, spreading on bamboo mats after threshing, and drying on the ground after threshing. Drying was done in a natural environment for 3 days until the moisture content dropped below 13%. The moisture content obtained by different drying methods was all below 13%. After drying, a germination experiment was carried out to determine the effects of different drying methods on germination of sorghum seeds. After drying, a culture dish was used for germination. Two filter papers were laid on each culture dish, 50 seeds were in each culture dish, and 100 seeds in two culture dishes were repeated once. Three replicates were set for each treatment, and cultured in a 12h light / dark incubator at 25°C for 7 days. The number of sprouts was counted every day until the 7th day, and the root length and sprout length of the seedlings were measured.

[0135] Table 7 Germination rate of sorghum seeds under different drying methods

[0136]

[0137] It can be seen from the above table that the germination rate of sorghum dried with ears is higher than that of sorghum that is separated before drying; the germination rate of sorghum dried without direct contact with the ground is higher than that of sorghum in direct contact with the ground; and the germination rate of sorghum dried naturally is higher than that of sorghum dried mechanically.

[0138] Depend on Figure 7 It can be seen that the sorghum seeds dried with ears have a higher germination index than the sorghum seeds that are threshed and then dried (p < 0.05); the sorghum seeds that are not in direct contact with the ground (including hanging for drying and laying on bamboo mats) have a higher germination index than the sorghum seeds in direct contact with the ground; the sorghum seeds dried naturally in the sun have a higher germination index than the sorghum seeds dried mechanically (p < 0.05).

[0139] Depend on Figure 8 It can be seen that the root length of sorghum seedlings dried with ears is significantly longer than that of sorghum that is threshed first and then dried, and the root length of sorghum that is dried naturally is also significantly longer than that of sorghum that is dried mechanically.

[0140] Identification and qRT-PCR Analysis of Sorghum α-amylase Genes (SbAMYs)

[0141] The whole genome sequence and annotation files of sorghum (Sorghum bicolor) were obtained from the National Center for Biotechnology Information (NCBI) (https: / / www.ncbi.nlm.nih.gov / ). The protein sequences of the Arabidopsis AMYs gene family can be obtained from the Arabidopsis genome database TAIR (https: / / www.arabidopsis.org / ), the plant genome database phytozome13 (https: / / phytozome-next.jgi.doe.gov / ) and NCBI. The CDS sequence of sorghum was extracted using the FastaExtract (Recommended) tool of the TBtools software, and translated into protein sequences using the Batch Translate CDS to Protein module. Then, the sorghum and Arabidopsis AMY family protein sequences were bidirectionally Blast aligned to preliminarily screen the sorghum AMY family members. These preliminarily screened protein sequences were then subjected to a secondary Blast alignment using the ProteinBlast module of NCBI, and the conserved domains of the proteins were analyzed using the CD-Search tool to remove redundancy, and finally the sorghum AMY family members were determined.

[0142] The sorghum grains of each treatment were subjected to seed germination and seedling development experiments under a 12-hour light / dark intermittent photoperiod. On the third day after sowing, the seeds and seedlings were sampled as a whole, and total RNA was extracted using a plant RNA extraction kit (DNaseI) (Kangwei Biotechnology, Jiangsu, China). Then, impurities were removed by HiFiScript gDNA Removal RT MasterMix Rapid Genomic Reverse Transcription Premix (Kangwei Biotechnology, Jiangsu, China). cDNA was synthesized using HiFiScript cDN SynthesisKit (Kangwei Biotechnology, Jiangsu, China). Real-time fluorescence quantitative PCR (qRT-PCR) was performed using UltraSYBR One Step RT-gPCR Kit ultraSYBR One Step Fluorescence Quantitative PCR Kit (Kangwei Biotechnology, Jiangsu, China). The relative expression level was calculated according to the formula 2-ΔΔct (Willems et al., 2008). The specific primers for SBAMYs genes and the internal reference gene sorghum actin gene Actin (Tac9) are listed in Table 3.1.

[0143] Table 8 Fluorescence quantitative PCR primer sequences

[0144]

[0145] During seed germination, the embryo regulates the endosperm to produce amylase, decomposing the stored starch in the endosperm into sugars to provide ATP for seed germination. This experiment measured the α-amylase activity of sorghum seeds treated with different drying methods 1 day, 3 days, 5 days, and 7 days after germination. In the early stage of germination, the a-amylase activity in sorghum seeds was weak, and the a-amylase activity showed an upward trend over time. During the period from 1 day to 3 days after seed germination, sorghum with ears spread on bamboo mats for drying had a higher α-amylase growth rate, and its α-amylase activity reached the maximum on the third day, which was significantly higher than other treatments (p < 0.05). The mechanically dried sorghum seeds had the lowest α-amylase activity on the first day of seed germination, but had the highest growth rate from 1 day to 3 days, until the seventh day, when its α-amylase activity reached the maximum. Overall, the α-amylase activity of sorghum seeds dried with ears on the third day of germination was higher than that of seeds dried by threshing, which may be caused by its higher initial water content.

[0146] Using TBtools software, we obtained 12 SbAMYs gene (α-amylase gene) family members by bidirectional Blast alignment based on the sorghum genome sequence file and annotation file, removing duplicate sequences and verifying the domains through NCBI-CDD. The relative expression levels of SbAMYs in sorghum seeds of each treatment on the third day of germination were determined by qRT-PCR. The results showed that the overall expression levels of SbAMY1.2a, SbAMY1.2b, SbAMY1.4a, SbAMY1.4b, and SbAMY3b were low in each treatment. However, the expression levels of SbAMY1.1a, SbAMY1.1b, SbAMY1.3a, SbAMY1.3b, SbAMY2.1a, and SbAMY2.1b in sorghum seeds with ears dried were higher than those in seeds dried by threshing, and were similar to the trends shown by germination rate, germination index, and α-amylase activity.

[0147] Seed drying method has a great influence on seed quality. Fig.10 As shown in the figure, for sorghum used for brewing, the best drying method is mechanical drying. Under the condition of mechanical drying, sorghum has the highest yellowness value Δb and brightness Δl, as well as a higher redness Δa, and a lower mold rate, which meets the market's evaluation standards for appearance and quality. In order to make sorghum seeds have the best germination quality, the best solution is to carry the ears and hang them in the sun for drying.

Claims

1. A use of a multi-component composite aqueous solution, characterized in that: The multi-component compound aqueous solution consists of 8-10% citric acid, 2-3% potassium sorbate, 0.5-1% propyl dihydrojasmonate and the balance of water, the aforementioned percentages being percentages by mass; the multi-component compound aqueous solution is used to prevent sorghum grains from fading.

2. The use of the multi-component composite aqueous solution as claimed in claim 1, characterized in that: Used to increase superoxide dismutase, peroxidase and catalase in sorghum.

3. A method for preventing sorghum grain from fading, characterized in that: The steps include: 1) spraying sorghum ears on the 21st to 27th day after flowering with a multi-component composite aqueous solution, spraying once every 7 days, and spraying 2 to 4 times; the multi-component composite aqueous solution is composed of 8 to 10% citric acid, 2 to 3% potassium sorbate, 0.5 to 1% propyl dihydrojasmonate and the remainder water, and the above percentages are mass percentages; 2) Harvest sorghum 45 to 50 days after flowering; 3) Dry until the moisture content drops below 13%.

4. The method for preventing sorghum grain from fading according to any one of claims 1 to 3, characterized in that: In step 1), the multi-component compound aqueous solution is sprayed on sorghum ears on the 23rd to 24th day after flowering, and the spraying is performed 3 times; in step 2), the sorghum is harvested on the 45th day after flowering.

5. The method for preventing sorghum grain from fading according to any one of claims 1 to 3, characterized in that: In step 3), the drying method is: hanging the fruit ears to dry in the sun, hot air drying in an oven at 40°C for 3-5 hours after threshing, spreading the fruit ears on a bamboo mat to dry in the sun, spreading the fruit ears on the ground to dry in the sun, spreading them on a bamboo mat to dry in the sun after threshing, and drying them on the ground after threshing.

6. The method for preventing sorghum grain from fading according to any one of claims 1 to 3, characterized in that: In step 3), the sorghum used for brewing is dried by hot air drying in an oven at 40° C. for 3 to 5 hours after threshing; when used as sorghum seeds, the sorghum is hung with the ears to dry in the sun.

7. A structural gene for improving sorghum seed color, characterized in that: include: Flavonoid isomerase gene, cinnamic acid-4-hydroxylase gene and genes related to anthocyanin synthesis. The genes related to anthocyanin synthesis are chalcone synthase gene CHS and anthocyanin reductase gene-ANR.

8. The structural gene for improving sorghum seed color according to claim 7, characterized in that: By spraying a multi-component compound liquid, the flavonoid isomerase gene Sobic.001G035600, the cinnamic acid-4-hydroxylase gene Sobic.003G337400, the chalcone synthase genes: Sobic.005G137100, Sobic.005G137200, and the anthocyanin reductase genes: Sobic.006G226800, Sobic.006G226900 are upregulated to prevent sorghum grains from fading. The nucleotide sequences of each gene are shown in Table 1; the multi-component compound aqueous solution consists of 8-10% citric acid, 2-3% potassium sorbate, 0.5-1% propyl dihydrojasmonate and the remainder water, and the above percentages are mass percentages.

9. The structural gene for improving sorghum seed color according to claim 7 or 8, characterized in that: It is used to regulate the accumulation of apigenin, luteolin, quercetin, isoflavones, dihydroquercetin and catechins, improve the color of sorghum grains and enhance the stability of sorghum grains during storage.

Images