Phillygenin in combination with dexmedetomidine for improving myocardial ischemia-reperfusion injury

Abstract

The application discloses application of Phillygenin combined with dexmedetomidine in improving myocardial ischemia-reperfusion injury and belongs to the technical field of drug development. The drug composition is composed of Phillygenin and dexmedetomidine; the combined use of Phillygenin and dexmedetomidine can reduce myocardial ischemia-reperfusion injury, and compared with the use of Phillygenin or dexmedetomidine alone, the combined use of Phillygenin and dexmedetomidine has a synergistic effect. The combined use of Phillygenin and dexmedetomidine can prevent and treat myocardial ischemia-reperfusion injury and provides a new target for the treatment of myocardial ischemia-reperfusion.

Description

Technical Field

[0001] This invention discloses the application of Phillygenin in combination with dexmedetomidine in improving myocardial ischemia-reperfusion injury, belonging to the field of drug development technology. Background Technology

[0002] Cardiovascular disease ranks first in global disease mortality, and coronary heart disease (CHD) accounts for the largest proportion of deaths from cardiovascular disease, approximately 42%. CHD is a type of heart disease caused by myocardial ischemia and hypoxia due to atherosclerosis or dynamic changes in the coronary arteries, leading to narrowing or even blockage of the blood vessels. It is also known as ischemic heart disease. Western medicine considers lipid metabolism disorders and arterial wall dysfunction to be the main causes of CHD. Traditional Chinese medicine has recorded symptoms such as "chest pain" and "chest pain" related to CHD in ancient texts like the *Huangdi Neijing* and *Jinkui Yaolue*. However, despite continuous research into CHD, a cure remains elusive. Patients with CHD rely on medication for long-term treatment or undergo interventional procedures such as coronary angiography, coronary stent implantation, and percutaneous transluminal coronary angioplasty. However, complications such as intraoperative and postoperative bleeding, infection, heart failure, and arrhythmias often accompany CHD. Currently, most clinical treatments aim to restore coronary artery blood perfusion. However, while the heart can tolerate short periods of ischemia, it is prone to further damage during the recovery process after severe or prolonged ischemia, leading to symptoms such as arrhythmias, hemorrhagic necrosis, and decreased cardiac function—a condition known as myocardial ischemia / reperfusion injury (MI / RI). Current treatment principles include early identification and correction of reversible causes, timely intervention to prevent further damage, appropriate nutritional support, and active prevention and treatment of complications.

[0003] Dexmedetomidine (DEX) is a highly potent and selective α2-adrenergic receptor agonist with anti-sympathetic, sedative, and analgesic effects. By activating different types of α2 receptors, DEX can achieve various therapeutic effects, including sedation, pain relief, anti-infection, and cardiovascular regulation. Recent extensive preclinical studies have demonstrated that dexmedetomidine plays an important role in the treatment of ischemia-reperfusion injury. This effect is mainly achieved through influencing gene expression, regulating channel function, modulating neurotransmitter release, inhibiting inflammatory responses, and reducing apoptosis and necrosis. However, due to the complexity of myocardial ischemia-reperfusion injury, involving multiple cellular and molecular mechanisms, the clinical efficacy of dexmedetomidine in the treatment of myocardial ischemia-reperfusion injury remains limited.

[0004] Current treatments for MI / RI are not ideal. Therefore, there is an urgent need for a drug treatment strategy that is more effective, safer, and has fewer side effects for MI / RI patients, in order to improve their quality of life and long-term prognosis. Summary of the Invention

[0005] Phlygenin, a monomer from the traditional Chinese medicine Forsythia suspensa, is an important active ingredient isolated from the herb Forsythia suspensa. Its molecular formula is C1. 21 H 24 O6. Dexmedetomidine combined with Phillygenin can mediate macrophage polarization from M1 to M2, thereby improving myocardial ischemia-reperfusion injury and myocardial tissue lesions, and reducing myocardial damage. It can be used to prepare drugs for the prevention and treatment of myocardial ischemia-reperfusion injury.

[0006] This invention provides a pharmaceutical composition or kit comprising a therapeutically effective amount of dexmedetomidine and a therapeutically effective amount of phillygenin, wherein the combined use of dexmedetomidine and phillygenin has a significant synergistic effect.

[0007] The Phlygenin is a compound having the structure shown in the following formula, its stereoisomer, or solvate.

[0008]

[0009] The dexmedetomidine is a compound, its stereoisomer, or solvate having the structure shown in the following formula:

[0010]

[0011] In one embodiment, the mass ratio of Phillygenin to dexmedetomidine is (2000-3500):(1-5); preferably, the mass ratio is 3000:1.

[0012] In one embodiment, the pharmaceutical composition comprises a first pharmaceutical composition and a second pharmaceutical composition; the first pharmaceutical composition includes Phillygenin and a pharmaceutically acceptable carrier or excipient; the second pharmaceutical composition includes dexmedetomidine and a pharmaceutically acceptable carrier or excipient.

[0013] In one embodiment, the pharmaceutical composition is used to treat or prevent myocardial ischemia-reperfusion injury.

[0014] In one embodiment, the myocardial ischemia-reperfusion injury is caused by cardiac surgery, including but not limited to coronary artery bypass grafting, heart transplantation, or coronary angioplasty.

[0015] In one embodiment, the first pharmaceutical composition is taken or injected 50 minutes before cardiac surgery; the second pharmaceutical composition is taken or injected 20 minutes before cardiac surgery.

[0016] In one embodiment, the pharmaceutical composition is administered orally or by injection daily for two weeks prior to cardiac surgery using a first pharmaceutical composition; and administered orally or by injection 20 minutes prior to cardiac surgery using a second pharmaceutical composition.

[0017] In one embodiment, the cardiac surgery includes, but is not limited to, coronary artery bypass grafting, heart transplantation, or coronary angioplasty.

[0018] This invention provides the use of dexmedetomidine in combination with phillygenin or the above-described pharmaceutical composition or kit in any of the following (a) to (e):

[0019] (a) To prepare a drug that improves myocardial ischemia-reperfusion injury or ischemic cardiomyopathy; or to improve myocardial ischemia-reperfusion injury or ischemic cardiomyopathy;

[0020] (b) To prepare a drug for inhibiting myocardial cell apoptosis induced by myocardial ischemia-reperfusion; or to inhibit myocardial cell apoptosis induced by myocardial ischemia-reperfusion;

[0021] (c) To prepare a drug for inhibiting the generation of reactive oxygen species (ROS) after myocardial ischemia-reperfusion; or to inhibit the generation of reactive oxygen species (ROS) after myocardial ischemia-reperfusion;

[0022] (d) Prepare drugs for inhibiting apoptosis of cardiomyocytes after hypoxia-reoxygenation; or inhibit apoptosis of cardiomyocytes after hypoxia-reoxygenation;

[0023] (e) To prepare a drug for inhibiting the production of reactive oxygen species (ROS) by cardiomyocytes after hypoxia-reoxygenation; or to inhibit the production of reactive oxygen species (ROS) by cardiomyocytes after hypoxia-reoxygenation;

[0024] The combined use of dexmedetomidine and Phyllygenin has a significant synergistic effect.

[0025] The Phlygenin is a compound having the structure shown in the following formula, its stereoisomer, or solvate.

[0026]

[0027] The dexmedetomidine is a compound, its stereoisomer, or solvate having the structure shown in the following formula:

[0028]

[0029] In one embodiment, the single dose of Phillygenin is 10–35 mg / kg, and the dosing frequency is once daily, once every two days, once every three days, or once every four days; the single dose of dexmedetomidine is 3–50 μg / kg, and the dosing frequency is once daily, once every two days, once every three days, or once every four days.

[0030] Optionally, the single dose of Phillygenin is 15 mg / kg, and the dosing frequency is once daily; the single dose of dexmedetomidine is 5 μg / kg, and the dosing frequency is once daily.

[0031] Optionally, the single dose of Phillygenin is 20 mg / kg, and the dosing frequency is once daily; the single dose of dexmedetomidine is 10 μg / kg, and the dosing frequency is once daily.

[0032] Optionally, the single dose of Phillygenin is 35 mg / kg, and the dosing frequency is once daily; the single dose of dexmedetomidine is 50 μg / kg, and the dosing frequency is once daily.

[0033] Optionally, the single dose of Phillygenin is 30 mg / kg, and the dosing frequency is once daily; the single dose of dexmedetomidine is 10 μg / kg, and the dosing frequency is once daily.

[0034] In one embodiment, Phillygenin and dexmedetomidine are contained as active ingredients in different formulations and are administered simultaneously or at different times.

[0035] In one embodiment, the combined route of administration is selected from oral administration, parenteral administration, and transdermal administration, wherein the parenteral administration includes, but is not limited to, intravenous injection, subcutaneous injection, and intramuscular injection;

[0036] Preferably, Phillygenin is administered orally; dexmedetomidine is administered intravenously.

[0037] In one embodiment, the drug may be a formulation of tablets, pills, powders, lozenges, small capsules, flat capsules, elixirs, suspensions, emulsions, solutions, syrups, aerosols, ointments, soft and hard gelatin capsules, suppositories, sterile injectable solutions, or sterile packaged powder injections; in this invention, the active ingredient is prepared into a drug so that it is released immediately, sustained, or delayed upon administration to a subject.

[0038] In one embodiment, the drug further includes a pharmaceutically acceptable pharmaceutical carrier.

[0039] In one embodiment, the pharmaceutical composition comprises a first pharmaceutical composition and a second pharmaceutical composition; the first pharmaceutical composition includes Phillygenin and a pharmaceutically acceptable carrier or excipient; the second pharmaceutical composition includes dexmedetomidine and a pharmaceutically acceptable carrier or excipient.

[0040] In one embodiment, the pharmaceutical composition is used to treat or prevent myocardial ischemia-reperfusion injury.

[0041] In one embodiment, the myocardial ischemia-reperfusion injury is caused by cardiac surgery, including but not limited to coronary artery bypass grafting, heart transplantation, or coronary angioplasty.

[0042] In one embodiment, the first pharmaceutical composition is taken or injected 50 minutes before cardiac surgery; the second pharmaceutical composition is taken or injected 20 minutes before cardiac surgery.

[0043] In one embodiment, the pharmaceutical composition is administered orally or by injection daily for two weeks prior to cardiac surgery using a first pharmaceutical composition; and administered orally or by injection 20 minutes prior to cardiac surgery using a second pharmaceutical composition.

[0044] In one embodiment, the cardiac surgery includes, but is not limited to, coronary artery bypass grafting, heart transplantation, or coronary angioplasty.

[0045] This invention also provides the use of Phillygenin in the preparation of drugs that enhance the efficacy of dexmedetomidine in improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy.

[0046] In one embodiment, the Phlygenin is a compound having the structure shown in the following formula, its stereoisomer, or a solvate:

[0047]

[0048] The dexmedetomidine is a compound, its stereoisomer, or solvate having the structure shown in the following formula:

[0049]

[0050] The combined use of dexmedetomidine and Phyllygenin has a significant synergistic effect.

[0051] In one embodiment, the drug contains the aforementioned pharmaceutical ingredients and pharmaceutically acceptable excipients.

[0052] In one embodiment, the excipients include any one or a combination of at least two of the following: carrier, diluent, excipient, filler, binder, wetting agent, disintegrant, emulsifier, cosolvent, solubilizer, osmotic pressure regulator, surfactant, coating material, colorant, pH adjuster, antioxidant, antibacterial agent, or buffer.

[0053] In one embodiment, the carrier is one or more of liposomes and nanoparticles.

[0054] In one embodiment, the excipient is one or more of mannitol, lactose, fatty acids, and polyethylene glycol.

[0055] In one embodiment, the dosage form of the drug includes any one of drops, oral liquid, tablets, capsules, granules, films, gels, powders, emulsions, pellets, or solutions.

[0056] In one embodiment, the route of administration of the drug includes oral administration, sublingual administration, rectal administration, skin / mucous membrane administration, inhalation administration, or injection administration.

[0057] The present invention also provides the use of dexmedetomidine in combination with phillygenin in the preparation of drugs, kits or drug combinations for improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy; the combination of dexmedetomidine and phillygenin has a significant synergistic effect.

[0058] The Phlygenin is a compound having the structure shown in the following formula, its stereoisomer, or solvate.

[0059]

[0060] The dexmedetomidine is a compound, its stereoisomer, or solvate having the structure shown in the following formula:

[0061]

[0062] In one embodiment, the dexmedetomidine and Phyllygenin can be administered simultaneously, formulated independently and administered together, or formulated independently and administered sequentially.

[0063] In one embodiment, the mass ratio of Phillygenin to dexmedetomidine in the application is (2000-3500):(1-5); preferably, the mass ratio is 3000:1.

[0064] In one embodiment, the single dose of Phillygenin is 10–35 mg / kg, and the dosing frequency is once daily, once every two days, once every three days, or once every four days; the single dose of dexmedetomidine is 3–50 μg / kg, and the dosing frequency is once daily, once every two days, once every three days, or once every four days.

[0065] In one embodiment, the drug contains the aforementioned pharmaceutical ingredients and pharmaceutically acceptable excipients.

[0066] In one embodiment, the excipients include any one or a combination of at least two of the following: carrier, diluent, excipient, filler, binder, wetting agent, disintegrant, emulsifier, cosolvent, solubilizer, osmotic pressure regulator, surfactant, coating material, colorant, pH adjuster, antioxidant, antibacterial agent, or buffer.

[0067] In one embodiment, the carrier is one or more of liposomes and nanoparticles.

[0068] In one embodiment, the excipient is one or more of mannitol, lactose, fatty acids, and polyethylene glycol.

[0069] In one embodiment, the dosage form of the drug includes any one of drops, oral liquid, tablets, capsules, granules, films, gels, powders, emulsions, pellets, or solutions.

[0070] In one embodiment, the route of administration of the drug includes oral administration, sublingual administration, rectal administration, skin / mucous membrane administration, inhalation administration, or injection administration.

[0071] In one embodiment, the drug combination or kit comprises a first drug composition and a second drug composition; the first drug composition includes Phillygenin and a pharmaceutically acceptable pharmaceutical carrier or excipient; the second drug composition includes dexmedetomidine and a pharmaceutically acceptable pharmaceutical carrier or excipient.

[0072] In one embodiment, the drug combination or kit is used to treat or prevent myocardial ischemia-reperfusion injury.

[0073] In one embodiment, the myocardial ischemia-reperfusion injury is caused by cardiac surgery, including but not limited to coronary artery bypass grafting, heart transplantation, or coronary angioplasty.

[0074] In one embodiment, the first pharmaceutical composition is taken or injected 50 minutes before cardiac surgery; the second pharmaceutical composition is taken or injected 20 minutes before cardiac surgery.

[0075] In one embodiment, the pharmaceutical composition is administered orally or by injection daily for two weeks prior to cardiac surgery using a first pharmaceutical composition; and administered orally or by injection 20 minutes prior to cardiac surgery using a second pharmaceutical composition.

[0076] In one embodiment, the cardiac surgery includes, but is not limited to, coronary artery bypass grafting, heart transplantation, or coronary angioplasty.

[0077] The present invention also provides a method for improving myocardial ischemia-reperfusion injury not for the purpose of diagnosing or treating a disease, comprising administering a therapeutically effective amount of dexmedetomidine and a therapeutically effective amount of phillygenin to a subject in need, wherein the therapeutically effective amount of dexmedetomidine and the therapeutically effective amount of phillygenin may be administered simultaneously, independently prepared and administered together, or independently prepared and administered sequentially.

[0078] In one embodiment, the single dose of Phillygenin is 10–35 mg / kg, and the dosing frequency is once daily, once every two days, once every three days, or once every four days; the single dose of dexmedetomidine is 3–50 μg / kg, and the dosing frequency is once daily, once every two days, once every three days, or once every four days.

[0079] In one embodiment, the Phlygenin is a compound having the structure shown in the following formula, its stereoisomer, or a solvate;

[0080]

[0081] The dexmedetomidine is a compound, its stereoisomer, or solvate having the structure shown in the following formula:

[0082]

[0083] This invention also provides the use of dexmedetomidine in the preparation of medicaments that enhance the efficacy of pillygenin in improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy.

[0084] In one embodiment, the Phlygenin is a compound having the structure shown in the following formula, its stereoisomer, or a solvate:

[0085]

[0086] The dexmedetomidine is a compound, its stereoisomer, or solvate having the structure shown in the following formula:

[0087]

[0088] The combined use of dexmedetomidine and Phyllygenin has a significant synergistic effect.

[0089] In one embodiment, the drug contains the aforementioned pharmaceutical ingredients and pharmaceutically acceptable excipients.

[0090] In one embodiment, the excipients include any one or a combination of at least two of the following: carrier, diluent, excipient, filler, binder, wetting agent, disintegrant, emulsifier, cosolvent, solubilizer, osmotic pressure regulator, surfactant, coating material, colorant, pH adjuster, antioxidant, antibacterial agent, or buffer.

[0091] In one embodiment, the carrier is one or more of liposomes and nanoparticles.

[0092] In one embodiment, the excipient is one or more of mannitol, lactose, fatty acids, and polyethylene glycol.

[0093] In one embodiment, the dosage form of the drug includes any one of drops, oral liquid, tablets, capsules, granules, films, gels, powders, emulsions, pellets, or solutions.

[0094] In one embodiment, the route of administration of the drug includes oral administration, sublingual administration, rectal administration, skin / mucous membrane administration, inhalation administration, or injection administration.

[0095] Beneficial effects:

[0096] This invention relates to the application of dexmedetomidine in combination with phillygenin in the preparation of drugs for improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy, and is the first public disclosure of this invention. The combined use of dexmedetomidine and phillygenin can reduce macrophage-mediated myocardial injury / irritation and oxidative damage, exhibiting a protective effect on cardiomyocytes and demonstrating unexpected technical effects. This represents a significant advancement in the treatment of myocardial ischemia-reperfusion injury or ischemic cardiomyopathy. The combined use of dexmedetomidine and phillygenin in this invention is superior to dexmedetomidine alone in improving myocardial ischemia-reperfusion injury, and is also superior to phillygenin alone. The combined use of dexmedetomidine and phillygenin in this invention exhibits a synergistic effect. Attached Figure Description

[0097] Figure 1 The combined use of Phillygenin and dexmedetomidine was used to improve cardiac function in mice with myocardial ischemia-reperfusion injury; A shows that the combined use of the drugs reduced macrophage-mediated myocardial injury in MI / RI; B shows that the combined use of the drugs alleviated oxidative damage in MI / RI; C shows that the combined use of the drugs improved the levels of inflammatory factors in MI / RI.

[0098] Figure 2 The combined use of Phillygenin and dexmedetomidine was used to improve cardiac function in mice with myocardial ischemia-reperfusion injury; A shows that the combined use of the drugs reduced macrophage-mediated myocardial injury in MI / RI; B shows that the combined use of the drugs alleviated oxidative damage in MI / RI; C shows that the combined use of the drugs improved the levels of inflammatory factors in MI / RI. Detailed Implementation

[0099] To further illustrate the technical means and effects adopted by the present invention to achieve its intended purpose, the specific embodiments, structures, features, and effects of the present invention will be described in detail below with reference to the accompanying drawings and preferred embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0100] Unless otherwise stated, the following terms and phrases as used herein are intended to have the following meanings. A particular term or phrase should not be considered uncertain or unclear unless specifically defined, but should be understood in its ordinary sense. When a trade name appears herein, it is intended to refer to the corresponding product or its active ingredient.

[0101] The term "pharmaceutical acceptable" refers to compounds, materials, compositions, and / or dosage forms that, within the bounds of reliable medical judgment, are suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, in proportion to a reasonable benefit / risk ratio.

[0102] Some compounds of this invention may exist in non-solventized or solvated forms, including hydrated forms. Generally, solvated and non-solventized forms are equivalent and both are included within the scope of this invention. Solventized forms are generally equivalent to non-solventized forms and should be included within the scope of this invention. Some compounds of this invention may exist in polymorphic or amorphous forms. Generally, all physical forms are equivalent for the applications contemplated by this invention and should be included within the scope of this invention.

[0103] The compounds of this invention can exist in specific geometric or stereoisomeric forms. This invention envisions all such compounds, including cis and trans isomers, (-)- and (+)- enantiomers, (R)- and (S)- enantiomers, diastereomers, (D)- isomers, (L)- isomers, rotational isomers (or may also be called rotational isomers), racemic mixtures, and other mixtures, such as mixtures enriched with enantiomers or diastereomers, all of which are within the scope of this invention.

[0104] The term "effective amount" or "therapeutic effective amount" as used in this invention includes an amount sufficient to improve or prevent symptoms or conditions of a medical condition. An effective amount also means an amount sufficient to allow or facilitate diagnosis. The effective amount for a particular patient or veterinary subject may vary depending on factors such as the condition to be treated, the patient's overall health, the route and dosage of administration, and the severity of side effects. An effective amount may be the maximum dose or administration regimen that avoids significant side effects or toxicity.

[0105] The terms “subject,” “individual,” or “patient” are used interchangeably in this document and refer to vertebrates, preferably mammals, and more preferably humans. Mammals include, but are not limited to, mice, apes, humans, farm animals, sports animals, and pets.

[0106] The amount of compound administered can depend on the subject being treated, the subject's age, health status, sex, and weight, the type of concurrent treatment (if any), the severity of the condition, the nature of the desired effect, the manner and frequency of treatment, and the prescribing physician's judgment. Dosing frequency can also depend on the pharmacodynamic effect on arterial oxygen partial pressure. However, the optimal dose can be adjusted for individual subjects, as understood by those skilled in the art and determined without tolerance experiments. This typically involves adjusting the standard dose (e.g., reducing the dose if the patient is underweight).

[0107] The term "pharmaceutical composition" refers to a mixture of one or more compounds of the present invention or their salts with a pharmaceutically acceptable carrier. The purpose of a pharmaceutical composition is to facilitate the administration of the compound of the present invention to an organism. The pharmaceutical compositions of the invention may include one or more pharmaceutically acceptable salts, antioxidants, aqueous and non-aqueous carriers, and / or adjuvants such as preservatives, wetting agents, emulsifiers, and dispersants.

[0108] The "pharmaceutical composition" of the present invention can also be administered to patients or subjects requiring such treatment via any suitable route of administration, such as oral, parenteral, rectal, pulmonary, or local administration. When intended for oral administration, the pharmaceutical composition can be formulated into oral dosage forms, such as oral solid dosage forms, like tablets, capsules, pills, granules, etc.; or oral liquid dosage forms, such as oral solutions, oral suspensions, syrups, etc. When formulated into oral dosage forms, the pharmaceutical formulation may also contain suitable fillers, binders, disintegrants, lubricants, etc.

[0109] The term "pharmaceutically acceptable carrier" refers to excipients that do not cause significant irritation to the organism and do not impair the bioactivity and properties of the active compound. Suitable excipients are well known to those skilled in the art, such as carbohydrates, waxes, water-soluble and / or water-swellable polymers, hydrophilic or hydrophobic materials, gelatin, oils, solvents, water, liposomes, polymer micelles, or inorganic nanocarriers.

[0110] The pharmaceutical compositions of the present invention can be formulated into any pharmaceutically acceptable dosage form for oral, nasal, topical (including oral cavity and sublingual), rectal, vaginal and / or parenteral administration, for example, they can be formulated into tablets, lozenges, capsules, pills, solutions, suspensions, syrups, injections, suppositories, inhalers or sprays.

[0111] The term "synergism" refers to the phenomenon that two drugs used in combination are more effective than they are individually, as opposed to antagonism.

[0112] The term “treatment” includes both prevention and treatment; for example, treating ischemic cardiomyopathy includes both prevention and / or treatment of ischemic cardiomyopathy.

[0113] The "combined" administration method described in this invention is selected from simultaneous administration, independent preparation and co-administration, or independent preparation and sequential administration.

[0114] In this invention, "combination" or "co-administration" refers to a method of administration, encompassing various situations where two drugs are administered sequentially or simultaneously. Here, "simultaneously" means administering dexmedetomidine and phillygenin within the same dosing cycle, for example, administering both drugs within two days or one day. "Sequential or sequential" administration includes situations where dexmedetomidine and phillygenin are administered separately within different dosing cycles. All these methods of administration fall under the category of combined administration as described in this invention.

[0115] The dexmedetomidine described in this invention is a commercially available product, and its molecular formula is C. 13 H 16 N2, CAS number 113775-47-6, has the following structural formula:

[0116]

[0117] The Phillygenin described in this invention is a commercially available product with the molecular formula C. 21 H 24 O6, CAS number 487-39-8, has the following structure:

[0118]

[0119] The mice used in the following examples were C57BL / 6J strain mice, 6-8 weeks old, purchased from Nanjing Spaford Biotechnology Co., Ltd.

[0120] Example 1: Application of the combined use of Phillygenin and dexmedetomidine in improving myocardial ischemia-reperfusion injury

[0121] Mice were randomly divided into 5 groups, with 6 mice in each group: sham operation group (Sham group, i.e., control group), myocardial ischemia-reperfusion group (MI / RI group, i.e., model group), Phillygenin + myocardial ischemia-reperfusion group (MI / RI + PHI group), DEX + myocardial ischemia-reperfusion group (MI / RI + DEX group), and Phillygenin + DEX + myocardial ischemia-reperfusion group (MI / RI + PHI + DEX group).

[0122] All five groups of mice were fed a standard diet with free access to food. After one week of acclimatization, the results were as follows:

[0123] Phillygenin+DEX+myocardial ischemia-reperfusion group (MI / RI+PHI+DEX group): Phillygenin (15mg / kg) (diluted with DMSO) was injected intraperitoneally 50 minutes before coronary artery ligation for ischemia, and DEX (5μg / kg, diluted with normal saline) was injected intravenously 20 minutes before ligation to construct myocardial ischemia-reperfusion.

[0124] Phillygenin + Myocardial Ischemia-Reperfusion Group (MI / RI + PHI Group): Phillygenin (30 mg / kg) (diluted with DMSO) was injected intraperitoneally 50 minutes before coronary artery ligation for ischemia, and an equal volume of normal saline was injected intravenously 20 minutes before ligation to construct myocardial ischemia-reperfusion.

[0125] DEX+myocardial ischemia-reperfusion group (MI / RI+DEX group): 50 minutes before coronary artery ligation for ischemia, an equal volume of normal saline was injected intraperitoneally, and 20 minutes before ligation, DEX (10 μg / kg, diluted with normal saline) was injected intravenously to construct myocardial ischemia-reperfusion.

[0126] Myocardial ischemia-reperfusion group (MI / RI group, i.e. model group): 50 minutes before ischemia was ligated in the coronary artery, an equal volume of normal saline was injected intraperitoneally, and 20 minutes before ligation, an equal volume of normal saline was injected intravenously to construct myocardial ischemia-reperfusion.

[0127] Sham surgery group (Sham group, i.e. control group): 50 minutes before the sham surgery, an equal volume of normal saline was injected into the peritoneum, and 20 minutes before the sham surgery, an equal volume of normal saline was injected intravenously, and then the sham surgery was performed.

[0128] The specific method for constructing the myocardial ischemia-reperfusion model is as follows:

[0129] Mice were anesthetized with 2% isoflurane gas and intubated, then given mechanical ventilation. A small skin incision (approximately 1.2 cm) was made in the left chest, exposing the fourth intercostal space after incising the pectoralis major and minor muscles. A small hole was made in the fourth intercostal space using a needle holder to open the pleura and pericardium. With the intercostal space slightly opened by the needle holder, the heart smoothly and gently "popped" out of the hole. The left coronary artery (LCA) was located using 6-0 silk suture and ligated with a slipknot approximately 3 mm above its superior end. The ligation was considered successful when the anterior wall of the left ventricle turned pale. Immediately after ligation, the heart was returned to the thoracic cavity, leaving the longer end of the slipknot outside the chest. Pneumothorax was prevented by manual aspiration, and the muscles and skin were closed using a purse-string suture. A 30-minute ischemia timer was then started. The mice were then allowed to breathe room air, and monitoring was conducted during recovery, which typically took 3-5 minutes. After half an hour, the ligation suture was slowly removed, and reperfusion began. Reperfusion continued for 24 hours. In the sham surgery group, the chest cavity was opened and then immediately closed with sutures, without establishing a cardiac MI / RI model.

[0130] The methods and results for measuring myocardial ischemia-reperfusion injury are as follows:

[0131] 1. Mouse hearts were harvested, embedded in paraffin, sectioned, and subjected to immunofluorescence staining, DHE staining, microscopic imaging, and ImageJ software was used to measure myocardial injury and oxidative stress in each group.

[0132] The results are shown in Table 1:

[0133] Table 1

[0134]

[0135] like Figure 1 As shown in Figure A, the combined use of phillygenin and dexmedetomidine can reduce macrophage-mediated myocardial injury in MI / RI. Immunofluorescence staining of paraffin-embedded cardiac sections after intraperitoneal injection of phillygenin in the MI / RI+PHI and MI / RI+PHI+DEX groups, and intravenous injection of DEX in the MI / RI+DEX and MI / RI+PHI+DEX groups, showed that the combined use of phillygenin and DEX had a better anti-MI / RI myocardial injury effect.

[0136] like Figure 1As shown in Figure B, the combined use of Phillygenin and dexmedetomidine can reduce oxidative damage in myocardial infarction (MI / RI). Following intraperitoneal injection of Phillygenin in the MI / RI+PHI and MI / RI+PHI+DEX groups, and intravenous injection of DEX in the DEX+MI / RI and MI / RI+PHI+DEX groups, DHE staining of paraffin sections revealed that the combined use of Phillygenin and DEX had a better anti-MI / RI myocardial injury effect.

[0137] In summary, the combined use of Phillygenin and DEX has good effects in preventing myocardial injury and oxidative damage caused by MI / RI, and exhibits a synergistic effect compared with the use of Phillygenin or DEX alone.

[0138] 2. RNA was extracted from mouse heart tissue and reverse transcribed into cDNA. The mRNA levels of myocardial injury biomarker genes (IL-6, TNF-α, IL-1β, IL-10) in five groups were then detected by real-time PCR. The primer sequences are as follows.

[0139] IL-1β:

[0140] Reverse-5'AACACAGCCTGGATGGCTAC3' (SEQ ID NO.1);

[0141] Forward-5'TTGAGTCTGCACAGTTCCCC3' (SEQ ID NO.2);

[0142] IL-6:

[0143] Reverse-5'GTCCTGGGGAAGGCATTAGG3' (SEQ ID NO.3);

[0144] Forward-5'CACTTCACAAGTCGGAGGCT3' (SEQ ID NO.4);

[0145] IL-10:

[0146] Reverse-5'AGCACACTAGGTTTGCCGAG3' (SEQ ID NO.5);

[0147] Forward-5'CATTCCATCCGGGGTGACAA3' (SEQ ID NO.6);

[0148] TNF-α:

[0149] Reverse-5'GTAGATGCCGGGTGGTTCAA3' (SEQ ID NO.7);

[0150] Forward-5'GGCTTTCGGAACTCACTGGA3' (SEQ ID NO. 8).

[0151] β-actin:

[0152] Reverse-5'GTCGCACCTCCACATAGCTT3' (SEQ ID NO.9);

[0153] Forward-5'CCCGCGAGTACAACCTTCTT3' (SEQ ID NO. 10).

[0154] RT-PCR assay method: Total RNA was extracted from mouse heart tissue samples using TRIzol (CWBIO, China) according to the manufacturer's instructions. III. First-strand cDNA Synthesis SuperMix (Shanghai Yesen Biotechnology Co., Ltd.) was used to prepare cDNA. Then, real-time PCR (RT-PCR) was performed on an Applied Biosystems QuantStudio 3 (ThermoFisher, USA) using a SYBR Green PCR master mix (Shanghai Yansheng Biotechnology Co., Ltd.). Two... -ΔΔCt The mRNA expression level normalized to β-actin was calculated using the method.

[0155] The results are shown in Table 2:

[0156] Table 2

[0157]

[0158]

[0159] like Figure 1 As shown in C, the combination of Phillygenin and dexmedetomidine downregulated the expression levels of IL-6, TNF-α, and IL-1β genes mRNA in the heart, while upregulating the expression level of IL-10 gene mRNA in the heart.

[0160] After intraperitoneal injection of Phillygenin and intravenous injection of DEX in the MI / RI+PHI and MI / RI+PHI+DEX groups, the expression of myocardial injury biomarker genes in the hearts of mice in different treatment groups was different.

[0161] The mRNA expression levels of the biomarkers IL-6, TNF-α, and IL-1β in the MI / RI group mice were significantly higher than those in the control group mice. The mRNA levels of the biomarker genes IL-6, TNF-α, and IL-1β in the MI / RI+DEXI, MI / RI+PHI, and MI / RI+PHI+DEX groups were significantly lower than those in the MI / RI group, with the most significant decrease observed in the MI / RI+PHI+DEX group.

[0162] Meanwhile, the IL-10 gene mRNA expression level in the MI / RI group mice was significantly lower than that in the control group mice. The IL-10 gene mRNA levels in the MI / RI+DEX group, MI / RI+PHI group, and MI / RI+PHI+DEX group were significantly higher than those in the MI / RI group, with the MI / RI+PHI+DEX group showing the most significant increase.

[0163] The above indicates that the combined use of Phillygenin and DEX improves the level of myocardial infarction in MI / RI mice, and exerts a synergistic effect compared with the use of Phillygenin or DEX alone.

[0164] Example 2: Application of the combined use of Phillygenin and dexmedetomidine in improving myocardial ischemia-reperfusion injury

[0165] Mice were randomly divided into 5 groups, with 6 mice in each group: sham operation group (Sham group, i.e., control group), myocardial ischemia-reperfusion group (MI / RI group, i.e., model group), Phillygenin + myocardial ischemia-reperfusion group (MI / RI + PHI group), DEX + myocardial ischemia-reperfusion group (MI / RI + DEX group), and Phillygenin + DEX + myocardial ischemia-reperfusion group (MI / RI + PHI + DEX group).

[0166] All five groups of mice were fed a standard diet with free access to food. After one week of acclimatization, the MI / RI+PHI group received intraperitoneal injections of Phillygenin (30 mg / kg / day) (diluted in DMSO) for two weeks; the MI / RI+PHI+DEX group received intraperitoneal injections of Phillygenin (15 mg / kg / day) (diluted in DMSO) for two weeks. Mice in the sham-operated group, MI / RI group, and MI / RI+DEX group received an equal volume of physiological saline intraperitoneally daily for two weeks.

[0167] Two weeks later, myocardial ischemia-reperfusion models were established in the MI / RI group, MI / RI+DEX group, MI / RI+PHI group, and MI / RI+PHI+DEX group: the coronary arteries of mice were ligated for ischemia for 30 minutes and then reperfused for 24 hours.

[0168] In the MI / RI+DEX group, DEX (10 μg / kg, diluted with normal saline) was injected intravenously 20 minutes before ligation; in the MI / RI+PHI+DEX group, DEX (5 μg / kg, diluted with normal saline) was injected intravenously 20 minutes before ligation; in the MI / RI group and the MI / RI+PHI group, the same amount of normal saline was administered intravenously in the same manner 20 minutes before ligation; in the sham surgery group, a sham surgery was performed, and the same amount of normal saline was administered intravenously in the same manner 20 minutes before ligation.

[0169] After the model was established, the mice were given a benevolent endpoint and samples were collected.

[0170] The specific method for constructing the myocardial ischemia-reperfusion model is as follows:

[0171] Mice were anesthetized with 2% isoflurane gas and intubated, then given mechanical ventilation. A small skin incision (approximately 1.2 cm) was made in the left chest, exposing the fourth intercostal space after incising the pectoralis major and minor muscles. A small hole was made in the fourth intercostal space using a needle holder to open the pleura and pericardium. With the intercostal space slightly opened by the needle holder, the heart smoothly and gently "popped" out of the hole. The left coronary artery (LCA) was located using 6-0 silk suture and ligated with a slipknot approximately 3 mm above its superior end. The ligation was considered successful when the anterior wall of the left ventricle turned pale. Immediately after ligation, the heart was returned to the thoracic cavity, leaving the longer end of the slipknot outside the chest. Pneumothorax was prevented by manual aspiration, and the muscles and skin were closed using a purse-string suture. A 30-minute ischemia timer was then started. The mice were then allowed to breathe room air, and monitoring was conducted during recovery, which typically took 3-5 minutes. After half an hour, the ligation suture was slowly removed, and reperfusion began. Reperfusion continued for 24 hours. In the sham surgery group, the chest cavity was opened and then immediately closed with sutures, without establishing a cardiac MI / RI model.

[0172] The methods and results for measuring myocardial ischemia-reperfusion injury are as follows:

[0173] 1. Mouse hearts were harvested, embedded in paraffin, sectioned, and subjected to immunofluorescence staining, DHE staining, microscopic imaging, and ImageJ software was used to measure myocardial injury and oxidative stress in each group.

[0174] The results are shown in Table 3:

[0175] Table 3

[0176]

[0177] like Figure 2 As shown in Figure A, the combined use of Phillygenin and dexmedetomidine can reduce macrophage-mediated myocardial injury in MI / RI.

[0178] Immunofluorescence staining of paraffin sections of the heart showed that, after intraperitoneal injection of Phillygenin in the MI / RI+PHI and MI / RI+PHI+DEX groups for 2 weeks, and intravenous injection of DEX in the MI / RI+DEX and MI / RI+PHI+DEX groups, the F4 / 80 expression level was significantly increased in the MI / RI group compared with the control group, indicating that myocardial immune cells were in an active state after MI / RI. The F4 / 80 expression level was significantly decreased in the MI / RI+DEX, MI / RI+PHI, and MI / RI+PHI+DEX groups compared with the MI / RI group, and the decrease was the most significant in the MI / RI+PHI+DEX group.

[0179] like Figure 2 As shown in B, the combined use of Phillygenin and dexmedetomidine can reduce oxidative damage in MI / RI.

[0180] After administering intraperitoneal injections of Phillygenin to the MI / RI+PHI and MI / RI+PHI+DEX groups for 2 weeks, and intravenous injections of DEX to the MI / RI+DEX and MI / RI+PHI+DEX groups, DHE staining of paraffin sections showed that the ROS level in the MI / RI group was significantly higher than that in the control group. However, the ROS levels in the MI / RI+DEX, MI / RI+PHI, and MI / RI+PHI+DEX groups were significantly lower than those in the MI / RI group, with the MI / RI+PHI+DEX group showing the most significant decrease.

[0181] This indicates that the combined use of Phillygenin and DEX has a good effect on resisting MI / RI oxidative damage, and exhibits a synergistic effect compared with the use of Phillygenin or DEX alone.

[0182] 2. After obtaining mouse heart tissue, RNA was extracted and reverse transcribed into cDNA. Then, the mRNA levels of five groups of myocardial injury biomarker genes (IL-6, TNF-α, IL-1β, IL-10) were detected by real-time PCR. The mRNA expression levels of the mice in this example were measured using the primer sequences and RT-PCR method described in Example 1.

[0183] The results are shown in Table 4:

[0184] Table 4

[0185]

[0186] like Figure 2As shown in C, the combination of Phillygenin and dexmedetomidine downregulated the expression levels of IL-6, TNF-α, and IL-1β genes mRNA in the heart, while upregulating the expression level of IL-10 gene mRNA in the heart.

[0187] After administering intraperitoneal injections of Phillygenin to the MI / RI+PHI and MI / RI+PHI+DEX groups for 2 weeks, and intravenous injections of DEX to the MI / RI+DEX and MI / RI+PHI+DEX groups, the expression of myocardial injury biomarker genes in the hearts of mice in different treatment groups was different.

[0188] The mRNA expression levels of the biomarkers IL-6, TNF-α, and IL-1β in the MI / RI group mice were significantly higher than those in the control group mice. The mRNA levels of the biomarker genes IL-6, TNF-α, and IL-1β in the DEX+MI / RI group, MI / RI+PHI group, and MI / RI+PHI+DEX group were significantly lower than those in the MI / RI group, with the MI / RI+PHI+DEX group showing the most significant decrease.

[0189] Meanwhile, the IL-10 gene mRNA expression level in the MI / RI group mice was significantly lower than that in the control group mice. The IL-10 gene mRNA levels in the MI / RI+DEX group, MI / RI+PHI group, and MI / RI+PHI+DEX group were significantly higher than those in the MI / RI group, with the MI / RI+PHI+DEX group showing the most significant increase.

[0190] The above indicates that the combined use of Phillygenin and DEX improves the level of myocardial infarction in MI / RI mice, and exerts a synergistic effect compared with the use of Phillygenin or DEX alone.

[0191] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A pharmaceutical composition comprising a therapeutically effective amount of dexmedetomidine and a therapeutically effective amount of phillygenin, wherein the combined use of dexmedetomidine and phillygenin has a significant synergistic effect; wherein the mass ratio of phillygenin to dexmedetomidine in the pharmaceutical composition is (2000~3500):(1~5); Phlygenin is a compound having the structure shown in the following formula: ； The dexmedetomidine is a compound having the structure shown in the following formula: 。 2. The use of the pharmaceutical composition of claim 1 in the preparation of a medicament for improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy.

3. The application according to claim 2, characterized in that, The drug is used to inhibit myocardial cell apoptosis induced by myocardial ischemia-reperfusion, and the combination of dexmedetomidine and Phillygenin has a significant synergistic effect.

4. The application according to claim 2, characterized in that, The drug is used to inhibit the production of reactive oxygen species (ROS) after myocardial ischemia-reperfusion.

5. The application according to claim 2, characterized in that, The drug is used to inhibit apoptosis of cardiomyocytes after hypoxia and reoxygenation.

6. The application according to claim 2, characterized in that, The drug is used to inhibit the production of reactive oxygen species (ROS) by myocardial cells after hypoxia and reoxygenation.

7. The application according to claim 2, characterized in that, Phillygenin and dexmedetomidine are contained as active ingredients in different formulations and are administered simultaneously or at different times.

8. The application according to claim 7, characterized in that, The single dose of Phillygenin is 10–35 mg / kg, and the dosing frequency is once daily, once every two days, once every three days, or once every four days; the single dose of dexmedetomidine is 3–50 μg / kg, and the dosing frequency is once daily, once every two days, once every three days, or once every four days.

9. The application according to claim 2, characterized in that, The drug also includes pharmaceutically acceptable pharmaceutical carriers.

10. The application according to claim 2, characterized in that, The combined routes of administration are selected from oral administration, parenteral administration, and transdermal administration.

11. The application according to claim 10, characterized in that, The parenteral administration includes intravenous injection, subcutaneous injection, and intramuscular injection.

12. The application according to claim 11, characterized in that, The dosage form of the drug includes any one of the following: drops, oral liquid, tablets, capsules, granules, films, gels, powders, emulsions, pellets, or solutions.

13. The application according to claim 12, characterized in that, The routes of administration of the drug include oral administration, sublingual administration, rectal administration, skin and mucous membrane administration, inhalation administration, or injection administration.

Images