Adeno-associated virus mutants and their applications
By constructing adeno-associated virus capsid protein mutants with specific amino acid sequences, the problems of insufficient muscle targeting and liver tropism of existing adeno-associated viruses have been solved, and a highly targeted and safe recombinant adeno-associated virus vector has been achieved, thereby improving the effectiveness of gene therapy.
Patent Information
- Application Number
- CN202411819539.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-16
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2044-07-16
AI Technical Summary
Existing adeno-associated virus gene therapy vectors have deficiencies in muscle targeting and liver tropism, resulting in high dosage requirements, severe side effects, and high costs, which limit their application in gene therapy.
By constructing adeno-associated virus capsid protein mutants with specific amino acid sequences, muscle targeting is improved and liver tropism is reduced. AAV variants with high targeting are screened using a specific motif method to construct recombinant adeno-associated virus vectors.
The muscle targeting was increased by about 496.41 times and the liver tropism was reduced by nearly 100 times, which improved the specificity and safety of the recombinant adeno-associated virus vector and expanded its scope of application.
Smart Images

Figure CN119751595B_ABST
Abstract
Description
[0001] This invention patent application is a divisional application based on Chinese patent application No. 2024109520630, filed on July 16, 2024, entitled “Adeno-associated virus mutants and their applications”. Technical Field
[0002] The present invention relates to the field of biomedicine technology, and in particular to an adeno-associated virus mutant and applications thereof. Background Art
[0003] Adeno-associated virus (AAV) is a small, non-enveloped virus encapsidated by a linear, single-stranded DNA genome. It belongs to the genus Dependovirus in the family Parvoviridae and requires a helper virus (usually an adenovirus) for replication. The AAV genome is a single-stranded DNA fragment contained within a non-enveloped viral capsid and can be divided into three functional regions: two open reading frames (the Rep gene and the Cap gene) and an inverted terminal repeat (ITR). Recombinant adeno-associated viral vectors (rAAV) are derived from non-pathogenic wild-type AAV. Due to their advantages, such as a broad host range, non-pathogenicity, low immunogenicity, long-term stable expression of foreign genes, excellent diffusion properties, and stable physical properties, they are widely used as gene transfer vectors in gene therapy and vaccine research. In medical research, rAAV has been used in gene therapy studies for a variety of diseases (including in vitro and in vivo experiments), such as studying gene function, establishing disease models, and generating knockout mice.
[0004] In recent years, gene therapy has become a new method for treating muscle diseases, among which AAV has been widely used as an effective gene vector. Take Duchenne muscular dystrophy (DMD) as an example. It is a rare and fatal neuromuscular genetic disease that occurs in one in every 3,500-5,000 males worldwide. DMD is caused by changes or mutations in the gene encoding dystrophin. Symptoms of DMD usually appear in infants and young children, and affected patients may experience developmental delays, such as difficulty walking, climbing stairs, or standing from a sitting position. Elevidys (trade name), its generic name is delandistrogene moxeparvovec, and its early name was SRP-9001. It is a gene therapy delivered by an AAVrh74 vector and uses the MHCK7 promoter to express a truncated DMD gene (mini-dystrophin) in DMD patients. It will be launched in June 2023 for DMD patients aged 4-5 years who can walk independently (it is contraindicated for people with deletion mutations in exons 8 and / or 9). On June 20, 2024, the FDA fully approved ELEVIDYS for use in DMD patients aged 4 years and above who can walk independently, and at the same time accelerated the approval (conditional marketing) of the drug for use in DMD patients aged 4 years and above who cannot walk independently. In addition, there are some other AAV treatment cases or clinical studies in progress. However, like any drug treatment, AAV treatment also has some potential risks. For example, excessively high doses may cause a response from the immune system, leading to side effects. In addition, high doses also mean greater production difficulty and higher costs. Therefore, the main purpose of AAV serotype modification is to develop drugs with higher targeting to reduce drug doses, or to make drugs more specific to avoid adverse reactions.
[0005] In summary, while AAV is currently one of the most widely used and safest gene therapy vectors, further improvements are needed in areas such as lower-dose muscle targeting. Developing serotypes with improved therapeutic efficacy, lower therapeutic doses, and fewer side effects and lower costs is crucial. Therefore, the development of new AAV gene therapy products with lower dose requirements and costs is urgently needed to meet the needs of a wider range of patients and promote the scale-up and socialization of AAV-based gene therapy approaches. Summary of the Invention
[0006] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an adeno-associated virus mutant with muscle or heart targeting and its application.
[0007] To achieve the above object, the technical solution adopted by the present invention is as follows:
[0008] In a first aspect, the present invention provides an adeno-associated virus capsid protein mutant, the amino acid sequence of which includes a sequence as shown in any one of SEQ ID No. 7-12.
[0009] The adeno-associated virus capsid protein mutant of the present invention has muscle or heart targeting. The mutant has good targeting to different muscle tissues (quadriceps, biceps and abdominal muscles, etc.). Compared with the control group AAV9, the muscle targeting is increased by up to about 496.41 times, and the liver tropism is also nearly 100 times lower than that of the control group. It has good specificity and also shows good effects in NHP (Nonhuman primate).
[0010] As a preferred embodiment of the adeno-associated virus capsid protein mutant of the present invention, a targeting peptide is inserted into the amino acid sequence; the amino acid sequence of the targeting peptide is any one of SEQ ID Nos. 1 to 6.
[0011] In a second aspect, the present invention provides a nucleic acid encoding the adeno-associated virus capsid protein mutant.
[0012] As a preferred embodiment of the nucleic acid of the present invention, its nucleotide sequence comprises a nucleotide sequence as shown in any one of SEQ ID Nos. 13 to 18.
[0013] In a third aspect, the present invention provides an expression vector comprising the nucleic acid.
[0014] In a fourth aspect, the present invention provides a host cell comprising the expression vector.
[0015] In a fifth aspect, the present invention provides a host cell that expresses the adeno-associated virus capsid protein mutant.
[0016] In a sixth aspect, the present invention provides a recombinant adeno-associated virus, comprising the adeno-associated virus capsid protein mutant.
[0017] The recombinant adeno-associated virus vector constructed using the AAV capsid protein mutant of the present invention has higher specificity, better safety, and a wide range of applications.
[0018] As a preferred embodiment of the recombinant adeno-associated virus of the present invention, it also includes a heterologous target gene.
[0019] As a preferred embodiment of the recombinant adeno-associated virus of the present invention, the heterologous target gene encodes any gene product of interfering RNA, aptamer, endonuclease, and guide RNA.
[0020] In a seventh aspect, the present invention provides a method for preparing a recombinant adeno-associated virus, comprising introducing at least the following components into a host cell: 1) the nucleic acid or the expression vector, 2) an adeno-associated virus helper plasmid, and 3) a plasmid containing two terminal inverted repeat sequences.
[0021] In an eighth aspect, the present invention provides rAAV prepared by the method described above.
[0022] In a ninth aspect, the present invention provides a pharmaceutical composition comprising the recombinant adeno-associated virus or the rAAV, and a pharmaceutically acceptable carrier.
[0023] In the tenth aspect, the present invention uses the adeno-associated virus capsid protein mutant, the expression vector, the host cell, the recombinant adeno-associated virus, and the rAAV in the preparation of a drug or preparation for delivering gene products to cells or tissues of a subject.
[0024] As a preferred embodiment of the application of the present invention, the cells are muscle cells or heart cells; the tissues are muscle tissues or heart tissues.
[0025] In the eleventh aspect, the present invention uses the adeno-associated virus capsid protein mutant, the expression vector, the host cell, the recombinant adeno-associated virus, and the rAAV in the preparation of a drug delivery tool for preventing and / or treating muscle or heart diseases.
[0026] As a preferred embodiment of the application described in the present invention, the muscle diseases include but are not limited to any one of Duchenne muscular dystrophy, Becker muscular dystrophy, X-linked myotubular myopathy, limb-girdle muscular dystrophy, myotonic dystrophy, and facioscapulohumeral muscular dystrophy; the heart diseases include but are not limited to any one of arrhythmogenic cardiomyopathy, ischemic cardiomyopathy, hypertrophic cardiomyopathy, dilated cardiomyopathy, angina pectoris, coronary heart disease, myocardial infarction, and heart failure.
[0027] Compared with the prior art, the present invention has the following beneficial effects:
[0028] The present invention uses a method based on a specific motif to construct an AAV virus library for muscle targeting screening. Effective AAV variants can be discovered through fewer screening processes, overcoming the shortcomings of the generally used random library, which has a large number of types, poor screening accuracy, and the need for multiple rounds of repeated screening and verification. The adeno-associated virus capsid protein mutants screened out by the present invention have muscle or heart targeting, and the mutants have good targeting to different muscle tissues (quadriceps, biceps and abdominal muscles, etc.). Compared with the control group AAV9, the muscle targeting is increased by about 496.41 times, and the liver tropism is also nearly 100 times lower than the control group, with good specificity, and also shows good effects in NHP. The recombinant adeno-associated virus vector constructed using the AAV capsid protein mutants of the present invention has higher specificity, better safety, and a wide range of applications. This will be of great significance in the future for improving the benefits of gene therapy and serving the majority of patients. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 The results of in vivo imaging of Balb / c mice infected with different serotypes are shown. Figure 1 In the middle, A: 14 days, B: 21 days;
[0030] Figure 2 For the targeting analysis of different serotypes on Balb / c mouse muscle (biceps brachii) (21 days), Figure 2 In the figure, A is the relative expression level of mRNA, and B is the protein expression level;
[0031] Figure 3 Analysis of the targeting of different serotypes to the muscle (triceps brachii) of Balb / c mice (21 days). Figure 3 In the figure, A is the relative expression level of mRNA, and B is the protein expression level;
[0032] Figure 4 Analysis of the targeting of different serotypes to the muscle (quadriceps femoris) of Balb / c mice (21 days). Figure 4 In the figure, A is the relative expression level of mRNA, and B is the protein expression level;
[0033] Figure 5 Analysis of the targeting of different serotypes to the muscles (abdominal muscles) of Balb / c mice (21 days). Figure 5 In the figure, A is the relative expression level of mRNA, and B is the protein expression level;
[0034] Figure 6 Analysis of the targeting of different serotypes to the muscle (gastrocnemius) of Balb / c mice (21 days). Figure 6 In the figure, A is the relative expression level of mRNA, and B is the protein expression level;
[0035] Figure 7Analysis of cardiac targeting of different serotypes in Balb / c mice (21 days). Figure 7 In the figure, A is the relative expression level of mRNA, and B is the protein expression level;
[0036] Figure 8 Analysis of the targeting of different serotypes to the liver of Balb / c mice (21 days). Figure 8 In the figure, A is the relative expression level of mRNA, and B is the protein expression level;
[0037] Figure 9 To analyze the muscle targeting and liver tropism of different serotypes in cynomolgus monkeys by NGS detection, Figure 9 In Figure 1, A is the puncture at 14 days, and B is the puncture at 28 days. DETAILED DESCRIPTION
[0038] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.
[0039] Unless the context clearly indicates otherwise, the term "or" refers to a single element of the listed alternative elements and the term "and / or" refers to any one, any two, any three, any more or all of the listed alternative elements.
[0040] The term "comprising" or "including" means including the recited elements, integers, or steps, but does not exclude any other elements, integers, or steps. As used herein, when the term "comprising" or "including" is used, unless otherwise indicated, it also encompasses consisting of the recited elements, integers, or steps. For example, when reference is made to a polypeptide "comprising" a particular sequence, it is intended to encompass a polypeptide consisting of that particular sequence.
[0041] "Adeno-associated virus (AAV)" is a non-enveloped icosahedral capsid virus of the Parvoviridae family that includes a single-stranded DNA viral genome. The Parvoviridae family includes the genus Dependovirus, which includes AAV, which relies on the presence of a helper virus such as adenovirus for its replication. Due to its relatively simple structure, ability to infect a variety of cells (including quiescent and dividing cells) without integrating into the host genome, and its relatively mild immunogenicity, AAV has been shown to be useful as a biological tool for expressing a gene of interest in vitro or in vivo. Also contemplated herein are AAV-based expression vectors, including recombinant AAV (rAAV) carrying a gene of interest for therapeutic purposes.
[0042] The wild-type AAV viral genome is a linear, single-stranded DNA (ssDNA) molecule of approximately 5,000 nucleotides (nt) in length. The AAV viral genome typically includes two inverted terminal repeats (ITRs), which cap the viral genome at the 5' and 3' ends, respectively, and provide an origin of replication for the viral genome. These ITRs have a characteristic T-shaped hairpin structure and have multiple functions, including but not limited to serving as an origin of DNA replication by acting as a primer for the endogenous DNA polymerase complex of the host viral replicating cell.
[0043] The wild-type AAV viral genome also includes the Rep gene and the Cap gene, which encode four non-structural Rep proteins (Rep78, Rep68, Rep52, Rep40) and three capsid proteins or structural proteins (VP1, VP2, VP3), respectively. Rep proteins are associated with viral replication and packaging, while capsid proteins assemble to form the protein shell of AAV or AAV capsid. Alternative splicing and alternate start codons and promoters result in the production of four different Rep proteins from a single open reading frame in the Rep gene and the production of three capsid proteins from a single open reading frame in the Cap gene.
[0044] When referring to AAV, the term "viral capsid protein" or "capsid protein" refers to the protein of AAV that is capable of self-assembly to produce AAV particles, also known as coat protein or VP protein. The VP protein includes three subunits VP1, VP2 and VP3, so the changes in the VP protein mutant relative to the wild-type VP protein can be reflected in the changes in the amino acid sequences of the VP1, VP2 and VP3 subunits. Accordingly, in this article, "capsid protein mutants" include VP protein mutants, and also include VP1 VP2 and / or VP3 subunit mutants. Due to the consistency of the amino acid sequences between the VP1, VP2 and VP3 subunits expressed from the same Cap gene, when the coding sequence in the Cap gene is changed, for example, when the coding sequence of the VP1 subunit is changed, the amino acid sequences of the expressed VP2 and VP3 subunits are also changed.
[0045] The term "serotype" as used in reference to AAV refers to the distinction of the capsid protein of AAV from other AAV serotypes in serology. Serological uniqueness is determined based on the reactivity of an antibody to one AAV and the lack of cross-reactivity with other or another AAV. This difference in cross-reactivity is usually due to differences in the capsid protein sequence (or its subunit sequence) / antigenic determinants (e.g., due to differences in the VP1, VP2 and / or VP3 sequences of serotype AAV9). A variety of AAV serotypes have been discovered, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12, as well as their mutants.
[0046] When referring to the AAV capsid protein or its subunits, the term "variable region" refers to the region whose amino acid sequence varies significantly between different serotypes. This is typically achieved by comparing the amino acid sequences of AAV capsid proteins from numerous serotypes to identify relatively conserved regions. The sequences between these regions are then designated as the variable region. The variable region is likely involved in AAV binding to cell surface receptors.
[0047] "Recombinant AAV vector" refers to an AAV genome derived by removing some wild-type genes (such as Rep genes and Cap genes) from the AAV genome using molecular biological methods and replacing them with heterologous nucleic acid sequences (such as coding sequences of proteins or RNAs for therapeutic purposes). Typically, for recombinant AAV vectors, one or two inverted terminal repeat (ITR) sequences of the AAV genome are retained therein. In most cases, recombinant AAV vectors are replication-defective and lack sequences encoding functional Rep and Cap proteins in their viral genomes. These replication-defective AAV particles may lack most of the parental coding sequences and essentially carry only one or two AAV ITR sequences and target nucleic acids for delivery to cells, tissues, organs or organisms. AAV comprising recombinant AAV vectors is referred to herein as recombinant AAV (rAAV).
[0048] "Amino acid changes" herein include amino acid substitutions, deletions or insertions. The number of amino acid changes in the mutant sequence relative to the parent sequence can be calculated as the sum of the number of amino acid substitutions, the number of deleted amino acids and the number of inserted amino acids.
[0049] As used herein, the terms "nucleic acid molecule," "nucleic acid," and "polynucleotide" are used interchangeably to refer to a polymer of nucleotides. Such nucleotide polymers may contain natural and / or non-natural nucleotides and include, but are not limited to, DNA, RNA, and PNA. A "nucleic acid sequence" refers to a linear sequence of nucleotides contained in a nucleic acid molecule or polynucleotide. An "isolated nucleic acid molecule" refers to a nucleic acid molecule that has been removed from its natural environment (e.g., the intracellular environment) and is substantially free of one or more substances normally associated with it in nature, such as proteins, nucleic acids, lipids, carbohydrates, cell membranes, etc., or is an artificially prepared (e.g., synthetic) nucleic acid molecule.
[0050] The term "expression vector" refers to a nucleic acid molecule comprising various expression elements for expressing a target protein or target RNA in a host cell. For expression vectors for expressing a target protein in eukaryotic cells, these expression elements typically include a promoter, an enhancer, a polyadenylation signal sequence, etc. For ease of amplification in Escherichia coli, the expression vector typically also includes an Escherichia coli replicon sequence. In addition, the expression vector may also include an antibiotic resistance gene or a selective marker gene (e.g., ampicillin resistance gene (AmpR), thymidine kinase gene (TK), kanamycin resistance gene (KanR), neomycin resistance gene (NeoR) etc.) for screening and a multiple cloning site (MCS) for insertion of the target gene.
[0051] The term "host cell" refers to cells in which an expression vector can be maintained and / or replicated, including prokaryotic and eukaryotic cells, such as bacteria (such as E. coli), fungi (yeast), insect cells (such as SF9), and mammalian cells (such as HEK-293T).
[0052] When referring to a pharmaceutical composition, the term "pharmaceutically acceptable carrier" refers to a solid or liquid diluent, filler, antioxidant, stabilizer, or other substance that can be safely administered to humans and / or animals without excessive adverse side effects and is suitable for maintaining the activity of the drug or active agent contained therein. Depending on the route of administration, a variety of carriers well known in the art may be used, including, but not limited to, sugars, starches, cellulose and its derivatives, maltose, gelatin, talc, calcium sulfate, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffer, emulsifiers, isotonic saline, and / or pyrogen-free water.
[0053] The "targeting" of AAV or rAAV refers to its relative accumulation in specific tissues or organs upon introduction into the body. For example, targeting can be manifested as a higher concentration in tissue A than in tissue B. This targeting can be assessed by measuring the amount or concentration of the genome in different tissues or organs.
[0054] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.
[0055] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified. The nucleotide sequence of the capsid of the low hepatotropic serotype is shown in SEQ ID No. 32 in Chinese invention patent document CN116041443B.
[0056] Example 1: Screening of novel mutants
[0057] (1) Construction of a low hepatotropic serotype mutant library backbone plasmid
[0058] The backbone vector for the hypohepatotropic serotype mutant library contains the CAG promoter, Intron, a mutated hypohepatotropic serotype capsid protein sequence [the VP1 sequence after T580 is removed, and the T580 nucleic acid sequence ACC is mutated to ACT, thereby forming a restriction site BsrGI (TGTACA) with the pre-polyA sequence for subsequent backbone linearization] and polyA. These sequences are synthesized by gene synthesis and inserted between the ITRs of the AAV vector plasmid to form the backbone vector for the hypohepatotropic serotype mutant library.
[0059] (2) Construction of mutant Rep-CAP vector
[0060] By introducing a stop codon at the N-terminus of the VP1, VP2, and VP3 proteins of the CAP sequence in the hypohepatotropic serovar, the Rep-CAP vector normally expresses Rep and AAP proteins, but not CAP VP1, VP2, and VP3 proteins, thereby avoiding contamination with the CAP sequence in the parent strain. The above sequence is synthesized by gene synthesis and inserted into the hypohepatotropic serovar Rep-CAP vector to replace the CAP sequence.
[0061] (3) Construction of a random peptide vector library containing the RGD motif
[0062] Design method: The TNLQ583 and Q588AAT sequences of the low hepatotropic serotype CAP were used as insertion and modification sequences, and the combinations were as follows: AGRGDXXXXXR, AGXRGDXXXXR, AGXXRGDXXXR, AGXXXRGDXXR, AGXXXXRGDXR, AGXXXXXRGDR, AGRGDXXXXXA, AGXRGDXXXXA, AGXXRGDXXXA, AGXXXRGDXXA, AGXXXXRGDXA, AGXXXXXRGDA. The upstream primer sequence consisted of: homology arm sequence + the above combination sequence + primer matching sequence, forming a total of 12 sequence primers. The downstream primers used the same sequence. These primers served as upstream primers and downstream primers to form primer pairs. When the low hepatotropic serotype CAP vector was used as a template, the target fragment library was amplified. The fragment library had homology arms at both ends and could be homologously recombined with the backbone plasmid of the low hepatotropic serotype mutant library after enzyme digestion to form a vector library.
[0063] The base sequence of the upstream primer (5'->3') is as follows:
[0064] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCAGAGGAGACNNKNNKNNKNNKNNKAGACAAGCAGCTACCGCAGAT;
[0065] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKAGAGGAGACNNKNNKNNKNNKAGACAAGCAGCTACCGCAGAT;
[0066] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKAGAGGAGACNNKNNKNNKAGACAAGCAGCTACCGCAGAT;
[0067] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKAGAGGAGACNNKNNKAGACAAGCAGCTACCGCAGAT;
[0068] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKAGAGGAGACNNKAGACAAGCAGCTACCGCAGAT;
[0069] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKNNKAGAGGAGACAGACAAGCAGCTACCGCAGAT;
[0070] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCAGAGGAGACNNKNNKNNKNNKNNKGCTCAAGCAGCTACCGCAGAT;
[0071] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKAGAGGAGACNNKNNKNNKNNKGCTCAAGCAGCTACCGCAGAT;
[0072] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKAGAGGAGACNNKNNKNNKGCTCAAGCAGCTACCGCAGAT;
[0073] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKAGAGGAGACNNKNNKGCTCAAGCAGCTACCGCAGAT;
[0074] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKAGAGGAGACNNKGCTCAAGCAGCTACCGCAGAT;
[0075] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKNNKAGAGGAGACGCTCAAGCAGCTACCGCAGAT。
[0076] The base sequence of the downstream primer (5’->3’) is as follows:
[0077] CGGTTTATTGATTAACAATCGATTACAGATTACGAGTCAGGTATCTGGTG。
[0078] The specific operation steps are as follows: using a vector containing the low hepatotropic serotype CAP as a template, PCR amplification using the above primers is performed to obtain a fragment containing a random sequence. The fragment is subjected to gel electrophoresis and gel recovery to obtain a purified nucleic acid fragment; the nucleic acid fragment is connected to the low hepatotropic serotype mutant library backbone vector constructed in step (1) (after BsrG I enzyme digestion and gel recovery purification) by Gibson homologous recombination connection, the connected vector is purified by a PCR product purification kit, and then digested with Plasmid-Safe DNase enzyme to remove unconnected fragments; finally, after purification by a PCR product purification kit, the constructed low hepatotropic serotype mutant random polypeptide vector library containing the RGD motif is obtained, that is, the low hepatotropic serotype mutant plasmid library.
[0079] (4) Production of low hepatotropic mutant virus library
[0080] The mutant Rep-Cap plasmid constructed in step (2), the low hepatotropic serotype mutant plasmid library constructed in step (3), and the pHelper plasmid were co-transfected into HEK-293T cells, and the adeno-associated virus was purified by iodixanol gradient ultracentrifugation. The virus titer was measured at 10 12 GC / mL~10 13 GC / mL is the appropriate titer, and the low hepatotropic serotype mutant virus library is obtained and stored at -80℃ for use.
[0081] (5) Screening of mutants
[0082] (5.1) Animal injection and dissection
[0083] Crab-eating macaques were intravenously injected with the low hepatotropic serotype mutant virus library. The animals were dissected and organs were collected 28 days after the injection. The samples were immediately frozen in liquid nitrogen and used for subsequent RNA extraction experiments.
[0084] (5.2) Total RNA extraction and RT-PCR
[0085] Sample Grinding: Pre-cool the grinder 10 minutes in advance and set the grinding parameters. Remove the animal tissue sample from the -80°C freezer and cut approximately 50-100 mg of tissue into pea-sized pieces in a sterile Petri dish. Transfer the sample to a 1.5 mL RNase-free EP tube. Add an appropriate amount of TransZol Up at a ratio of 1 mL TransZol Up per 50-100 mg of tissue. Add two clean, sterile 3 mm grinding steel beads and wrap with Parafilm. Place the sample in a 24-well grinding adapter, level it, tighten the screws, and press the lid button. Start the grinding program. After the instrument finishes, remove the sample and inspect the grind size. If no large pieces of tissue remain, proceed to extraction. Centrifuge the ground sample at 12,000 × g for 2 minutes at 4°C. Aspirate the supernatant and transfer it to a new, labeled 1.5 mL RNase-free EP tube.
[0086] Extract total RNA from samples: Refer to the TransZol Up Plus RNA Kit (Beijing Quanshijin, Cat. No. ER501) instructions for details. For every 1 mL of TranZol Up, add 0.2 mL of RNA Extraction Agent, shake vigorously for 5 minutes, and centrifuge at 12,000 × g at 4°C for 10 minutes. At this time, the sample is divided into three layers. Transfer the colorless aqueous phase to a new 1.5 mL RNase-free EP tube, add an equal volume of anhydrous ethanol (precipitate may appear at this time), and gently invert to mix; add the resulting solution and precipitate to the centrifuge column, centrifuge at 12,000 × g at room temperature for 30 seconds, and discard the filtrate; add 500 μL CB9, centrifuge at 12,000 × g at room temperature for 30 seconds, and discard the filtrate; repeat the above steps once; add 500 μL WB9, centrifuge at 12,000 × g at room temperature for 30 seconds, and discard the filtrate; repeat the above steps once; centrifuge at 12,000 × g at room temperature for 2 minutes to completely remove residual ethanol; place the centrifuge column in a 1.5 ml RNase-free EP tube, add 30-50 μL (depending on the size of the tissue) RNase-free water in the center of the centrifuge column, and let it stand at room temperature for 1 minute; centrifuge at 12,000 × g at room temperature for 1 minute to elute RNA;
[0087] Determination of sample nucleic acid concentration: Use a micro-nucleic acid quantification instrument detector to detect RNA concentration, record the concentration, OD260 / 280, and OD260 / 230, and store the RNA at -80°C.
[0088] RT-PCR: First-strand cDNA was synthesized using PrimeScript™ IV 1st strand cDNA Synthesis Mix (Takara, 6215A) after RNA extraction. Two rounds of PCR amplification were then performed using NEB Q5 (the first round used outer primers; the second round used the gel-recovered first-round product as a template and NGS primers). PCR products of the corresponding band size were then sent to the company for NGS sequencing.
[0089] NGS sequencing, data analysis, and selection of candidate vectors: After sequencing, sequencing data analysis is performed, and sequences with high frequency rankings and repeated occurrence in multiple samples are selected as candidates for subsequent AAV mutant construction and verification.
[0090] Example 2: Construction of AAV capsid protein mutants and virus production
[0091] (1) Construction of mutant serotype vector and plasmid extraction
[0092] The AAV9 Rep-CAP plasmid (purchased from Guangzhou Paizhen Biotechnology Co., Ltd.) was double-digested with Smi I and BshT I, and a fragment band of about 5000 bp was cut out for gel electrophoresis and gel recovery to obtain the enzyme-digested backbone fragment.
[0093] Based on the Cap sequence of mutant 1, the following primers were designed. Specifically, the following steps were performed: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ573-R primers for amplification and gel recovery to obtain the target product YJ573-1; using the Rep-CAP plasmid of serotype 109 as a template, using the YJ573-F+cap-r primers for amplification and gel recovery to obtain the target product YJ573-2; and by mixing the backbone fragment, YJ573-1, and YJ573-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 1 was recombinantly constructed;
[0094] Based on the Cap sequence of mutant 2, the following primers were designed. Specifically, the following steps were performed: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ578-R primers for amplification and gel recovery to obtain the target product YJ578-1; using the Rep-CAP plasmid of serotype 109 as a template, using the YJ578-F+cap-r primers for amplification and gel recovery to obtain the target product YJ578-2; and by mixing the backbone fragment, YJ578-1, and YJ578-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 2 was recombinantly constructed;
[0095] Based on the Cap sequence of mutant 3, the following primers were designed. The specific steps were as follows: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ588-R primers for amplification and gel recovery to obtain the target product YJ588-1; using the Rep-CAP plasmid of serotype 109 as a template, using the YJ588-F+cap-r primers for amplification and gel recovery to obtain the target product YJ588-2; by mixing the backbone fragment, YJ588-1, and YJ588-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 3 can be recombined and constructed;
[0096] Based on the Cap sequence of mutant 4, the following primers were designed. Specifically, the following steps were performed: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ581-R primers for amplification and gel recovery to obtain the target product YJ581-1; using the Rep-CAP plasmid of serotype 109 as a template, using the YJ581-F+cap-r primers for amplification and gel recovery to obtain the target product YJ581-2; and by mixing the backbone fragment, YJ581-1, and YJ581-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 4 was recombinantly constructed;
[0097] Based on the Cap sequence of mutant 5, the following primers were designed. Specifically, the following steps were performed: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ574-R primers for amplification and gel recovery to obtain the target product YJ574-1; using the Rep-CAP plasmid of serotype 109 as a template, using the YJ574-F+cap-r primers for amplification and gel recovery to obtain the target product YJ574-2; and by mixing the backbone fragment, YJ574-1, and YJ574-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 5 was recombinantly constructed;
[0098] Based on the Cap sequence of mutant 6, the following primers were designed. Specifically, the following steps were performed: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ585-R primers for amplification and gel recovery to obtain the target product YJ585-1; using the Rep-CAP plasmid of serotype 109 as a template, using the YJ585-F+cap-r primers for amplification and gel recovery to obtain the target product YJ585-2; and by mixing the backbone fragment, YJ585-1, and YJ585-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 6 was recombinantly constructed;
[0099] The primers involved in the construction of the Rep-CAP vector of the above-mentioned AAV capsid protein mutant are shown in Table 1:
[0100] Table 1 Primer sequence information
[0101]
[0102]
[0103] Label a clean 200μL PCR tube and place it on ice. Combine the digested backbone and each target fragment at a 1:3 molar ratio of backbone to fragment. Incubate in a PCR machine at 50°C for 30 minutes for recombination ligation. Thaw 50μL of competent cells on ice, mix 10μL of the ligation product with DH5α competent cells, and incubate on ice for 20-30 minutes. Heat shock at 42°C for 45 seconds. Quickly place on ice for 2 minutes, add 400μL of recovery SOC medium (without antibiotics), and incubate at 37°C at 200 rpm for 1 hour. Spread evenly on an Amp-resistant plate (50μg / mL) and incubate at 37°C for 14 hours. Select a single colony and expand it in 4mL of liquid LB medium (Amp+ resistant) and incubate at 37°C for 14 hours.
[0104] The bacterial solution was centrifuged at 12000rpm for 1 minute, and the supernatant culture medium was discarded; 250μL of buffer P1 / RNaseA mixture was added and the bacteria were resuspended by high-speed vortexing; 250μL of buffer P2 was added and the solution was inverted 8-10 times; 350μL of buffer P3 was added and the solution was immediately inverted and mixed 8-10 times to completely neutralize the solution; centrifuged at 13000rpm for 10 minutes, the supernatant was taken and passed through the column; centrifuged at 12000 for 1 minute, the waste liquid was discarded, 500μL of PW1 was added, and the waste liquid was discarded; 600μL of PW2 was added, and the supernatant was discarded; 600μL of PW2 was added, and the solution was centrifuged at 12000 for 1 minute, and the supernatant was discarded; the solution was idling at 12000rpm for 2 minutes; 30-50μL of 55℃ preheated eluent was added, the solution was allowed to stand for 2 minutes, and the solution was centrifuged at 12000rpm for 1 minute. A micro-volume nucleic acid quantifier was used for concentration detection.
[0105] The obtained plasmids were tested for concentration, and 10 μL of the positive plasmids identified by enzyme digestion were sent for sequencing and stored at -20°C. Sequencing results showed that the obtained plasmids could encode the variant capsid protein VP1. Finally, according to the amount of virus required for subsequent testing, the relevant Helper plasmids, the Rep-Cap plasmids for each group (control serotypes AAV2, AAV9, MyoAAV 4A, 109, and mutants 1-6) plasmids, and the GOI plasmid (ssAAV.CAG.Fluc-2a-eGFP.WPRE.SV40pA) were extracted.
[0106] (2) Packaging and purification of mutant serotype viruses
[0107] The Rep-Cap plasmids of each group (control serotype and AAV mutants 1-6), the GOI plasmid expressing firefly luciferase (Fluc) and green fluorescent protein (EGFP), and the pHelper plasmid were co-transfected into HEK-293T cells in appropriate amounts. The AAV virus was purified by iodixanol gradient ultracentrifugation. The virus titer was measured to be around 1E+13 GC / mL, which was considered appropriate. The cells were stored at -80°C for use.
[0108] Example 3: Comparative testing of various indicators of mutant serotypes
[0109] (1) Mouse injection and dissection
[0110] The animal experiments used 6-8 week old Balb / c male mice. The relevant viruses were prepared according to the designed experimental and control groups (mutants 5 and 6 were only used in 2 mice due to low virus yield). Each mouse in each group was injected with 2E11GC virus. In vivo imaging was performed 14 and 21 days after injection. The animals were dissected and organs were collected 21 days after injection. The samples were immediately snap-frozen in liquid nitrogen and used for subsequent experiments such as RNA extraction and western blotting.
[0111] (2) In vivo imaging
[0112] Live imaging was performed on mice 14 and 21 days after injection. The mice were weighed before imaging, and the animal live imaging system (Guangzhou Bolu Teng Biotechnology Co., Ltd., AniView100) was turned on in advance and the small animal anesthesia system was debugged. The image save path, shooting parameters and other information were set. Each mouse was intraperitoneally injected with luciferin (15 mg / mL, Promega, E1605) at a dose of 150 mg / kg, or 10 μL / g. Imaging began 10 minutes after injection of each group. Each batch of mice was photographed in the order of supine, left lateral, prone, and right lateral. After the shooting was completed, the mice were put back into the cage to wait for anesthesia to wake up, and the mice were observed for any abnormalities.
[0113] (3) Detection of target gene mRNA expression level
[0114] (3.1) Total RNA extraction and reverse transcription
[0115] Sample Grinding: Pre-cool the grinder 10 minutes in advance and set the grinding parameters. Remove the animal tissue sample from the -80°C freezer and cut approximately 50-100 mg of tissue into pea-sized pieces in a sterile Petri dish. Transfer the sample to a 1.5 mL RNase-free EP tube. Add an appropriate amount of TransZol Up at a ratio of 1 mL TransZol Up per 50-100 mg of tissue. Add two clean, sterile 3 mm grinding steel beads and wrap with Parafilm. Place the sample in a 24-well grinding adapter, level it, tighten the screws, and press the lid button. Start the grinding program. After the instrument finishes, remove the sample and inspect the grind size. If no large pieces of tissue remain, proceed to extraction. Centrifuge the ground sample at 12,000 × g for 2 minutes at 4°C. Aspirate the supernatant and transfer it to a new, labeled 1.5 mL RNase-free EP tube.
[0116] Extract total RNA from samples: Refer to the TransZol Up Plus RNA Kit (Beijing Quanshijin, Cat. No. ER501) for details. For every 1 mL of TranZol Up, add 0.2 mL of RNA Extraction Agent, shake vigorously for 5 minutes, and centrifuge at 12,000 × g at 4°C for 10 minutes. At this time, the sample is divided into three layers. Transfer the colorless aqueous phase to a new 1.5 mL RNase-free EP tube, add an equal volume of anhydrous ethanol (precipitate may appear at this time), and gently invert to mix; add the resulting solution and precipitate to the centrifuge column, centrifuge at 12,000 × g at room temperature for 30 seconds, and discard the filtrate; add 500 μL CB9, centrifuge at 12,000 × g at room temperature for 30 seconds, and discard the filtrate; repeat the above steps once; add 500 μL WB9, centrifuge at 12,000 × g at room temperature for 30 seconds, and discard the filtrate; repeat the above steps once; centrifuge at 12,000 × g at room temperature for 2 minutes to completely remove residual ethanol; place the centrifuge column in a 1.5 mL RNase-free EP tube, add 30-50 μL (depending on the size of the tissue) RNase-free water in the center of the centrifuge column, and let it stand at room temperature for 1 minute; centrifuge at 12,000 × g at room temperature for 1 minute to elute RNA;
[0117] Determination of sample nucleic acid concentration: Use a micro-nucleic acid quantification instrument detector to detect RNA concentration, record the concentration, OD260 / 280, and OD260 / 230, and store the RNA at -80°C.
[0118] Reverse transcription: Each RNA sample was used All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) (Beijing Quanshijin, Cat. No. AE341-03). For specific steps, refer to the instruction manual.
[0119] (3.2) Quantitative PCR (qPCR) experiments:
[0120] Each cDNA group was used as a template and the qPCR system was configured according to the instructions of 2x SYBR Green qPCR Master Mix (Bimake, Cat. No.: B21203):
[0121] Table 2 qPCR system
[0122] Reagents Usage 2x SYBR Green qPCR Master Mix 10 μL cDNA template 2μL Upstream primer (10 μM) 1 μL Downstream primer (10 μM) 1 μL ROX Reference Dye 0.4μL Deionized water Up to 20μL
[0123] Table 3 qPCR primer information
[0124] Primer name Primer sequence (5'->3') Fluc2-qPCR-F1 AACCAGCGCCATTCTGATCA Fluc2-qPCR-R1 TCGGGGTTGTTAACGTAGCC GAPDH-F2 CAGGAGAGTGTTTCCTCGTCC GAPDH-R2 TTCCCATTCTCGGCCTTGAC
[0125] Table 4 qPCR program settings
[0126]
[0127]
[0128] 3.3) Data Analysis
[0129] According to the Ct value of each group, according to formula 2 -ΔΔct Calculate the relative expression level.
[0130] (4) Western blotting to detect the expression level of the target protein
[0131] Sample pretreatment: Cut the tissue into small pieces, weigh and record the weight, place in a 1.5 ml or 2 ml centrifuge tube, label the tube, and freeze at -80°C until use. Pre-cool the cryo-grinder; dissolve in RIPA (Biyuntian, P0013B) lysis buffer (add PMSF within a few minutes before use to a final PMSF concentration of 1 mM);
[0132] Add 150-250 μL of the complete lysis buffer to every 20 mg of tissue. Then, add two sterilized zirconium oxide grinding beads and grind the sample directly in the lysis buffer (for brain and spinal cord tissue samples: temperature -20°C, frequency 70 Hz, oscillation time 50 seconds, pause 10 seconds, 3-4 cycles; for muscle and liver samples: temperature -20°C, frequency 70 Hz, oscillation time 50 seconds, pause 10 seconds, 5-7 cycles). After grinding, centrifuge the sample at 12,000 × g in a refrigerated centrifuge at 4°C for 5-10 minutes. Transfer the supernatant to a new sterilized EP tube and store at -20°C or -80°C.
[0133] Protein concentration determination: After determining the protein concentration according to the modified BCA protein concentration determination kit (Sanggong, Cat. No. C503051), take an appropriate amount of protein homogenate sample according to the required amount, mix with the corresponding amount of 5X SDS-PAGE protein loading buffer, boil in water bath for 10 minutes, cool, centrifuge at low speed for a while, and wait for sample loading.
[0134] WB (Western Blot) detection:
[0135] A.SDS-PAGE electrophoresis: Determine the appropriate loading volume based on protein concentration and expression level, which should be less than 20μL / well. The loading volume of tissue homogenate protein is about 20-50μg. The specific operation process of electrophoresis is as follows: Pull out the comb on the precast gel, install the gel into the electrophoresis tank, add electrophoresis buffer to both the inner and outer tanks, add freshly prepared buffer to the inner tank, and check for leaks. If there are no leaks, add electrophoresis buffer to the outer tank; Load an appropriate amount of treated protein sample, use pre-stained standard protein as a reference, and perform 100V constant voltage electrophoresis on the Tianneng electrophoresis device for 100 minutes, until bromophenol blue reaches the bottom of the gel. Turn off the power, carefully remove the precast gel plate, remove the gel, and place it in transfer buffer and wait for subsequent operations;
[0136] B. Transfer: Cut 6 pieces of filter paper and 1 piece of PVDF membrane according to the gel area. Soak the PVDF membrane in methanol for 5-10 seconds, then transfer it to transfer buffer and soak for 5 minutes. The filter paper should also be pre-wetted in transfer buffer. Install the transfer device: negative electrode (blackboard) - sponge - 3 layers of wet filter paper - gel - PVDF membrane - 3 layers of wet filter paper - sponge - positive electrode (transparent plate). Expel bubbles from each layer to avoid affecting the transfer effect, clamp the bracket, and place it in the electroporation tank; use a 100V constant voltage ice bath to transfer the membrane for 100 minutes; determine whether the transfer is successful based on whether the pre-stained protein molecular weight standard bands are completely transferred to the PVDF membrane; soak the transferred PVDF membrane in PBST solution and wash it at room temperature for 5 minutes. Cut the PVDF membrane as needed. Be careful not to let the PVDF membrane dry during the cutting process.
[0137] C. Blocking and Antibody Incubation: Incubate the PVDF membrane with blocking solution (5% skim milk powder) at room temperature for 2 hours or at 4°C overnight. Transfer the blocked PVDF membrane to the primary antibody hybridization solution (Luciferase Rabbit Polyclonal antibody (Proteintech, 27986-1-AP) at 1:2000; GADPH Rabbit Polyclonal antibody (Proteintech, 10494-1-AP) at 1:2000; Rabbit GFP tag Polyclonal antibody (Proteintech, 50430-2-AP) at 1:2000) and add each to 4 ml of QuickBlock ELISA. TM The washed PVDF membrane was transferred to the secondary antibody hybridization solution (HRP-conjugated Affinipure Goat Anti-Rabbit IgG (H+L) (Proteintech, SA00001-2) at a ratio of 1:5000 and added to 4 ml of QuickBlock TM Western secondary antibody diluent (Biyuntian, P0258), i.e., secondary antibody hybridization solution), incubated at room temperature for 1 h, and washed with PBST for 3 × 5 min;
[0138] D. Color development: Mix equal volumes of Solution A and Solution B of the ECL chemiluminescence kit. Vortex to mix thoroughly. Drop the luminescent solution onto the PVDF membrane so that the membrane is completely covered with the solution. Adjust the exposure time to make the protein bands clear. Take photos with the instrument.
[0139] (5) Cynomolgus monkey injection, puncture, and NGS analysis
[0140] Animal experiments were conducted using approximately 4-year-old male cynomolgus macaques, which had passed AAV2 and AAV9 neutralizing antibody testing before use. Different serotype mutants and control serotypes were packaged with different GOIs (ssAAV.CAG.Fluc.WPRE.polyA vectors carrying different barcodes) and injected intravenously with equal viral loads (total mixed viral dose controlled to 3E13 GC / kg). Muscle punctures at different sites and liver punctures were performed at 2 and 4 weeks, respectively. Tissue RNA was extracted, RT-PCR was performed, and next-generation sequencing was performed. NGS data were analyzed to determine the multiple of each serotype mutant relative to the control AAV9.
[0141] Through different methods of mouse experiments, it was found that the obtained mutant 1-6 had better muscle targeting than AAV9 and retained the low liver tropism of the skeleton (from Figure 1 This result can be observed more intuitively from the 14-day and 28-day in vivo imaging results of the study), among which mutant 1 and mutant 3 even showed stronger muscle targeting than 109 and MyoAAV 4A serotypes. The mRNA levels of mutant 1 in the gastrocnemius, quadriceps, triceps, biceps, abdominal muscles and heart were 75.97 times, 37.27 times, 186.02 times, 13.79 times, 496.41 times and 10.06 times that of AAV9, respectively. The mRNA levels of mutant 3 in the gastrocnemius, quadriceps, triceps, biceps, abdominal muscles and heart were 71.95 times, 43.25 times, 112.55 times, 4.99 times, 247.96 times and 9.46 times that of AAV9, respectively. Figure 2 .A- Figure 7 .A). The protein level results of mutant 1 and mutant 3 are basically consistent with the mRNA level trend ( Figure 2 .B- Figure 7 .B). Liver results ( Figure 8 ) further confirmed that all serotype mutants based on the low liver-tropic backbone showed low liver targeting, with mRNA levels 50-100 times lower than AAV9, and still 9.5-19 times lower for MyoAAV 4A (obtained based on AAV9 backbone screening), showing very good targeting specificity.
[0142] In order to further illustrate the potential clinical use value of the serotype of the present invention, the mutant and control serotype viruses were intravenously injected into cynomolgus monkeys in equal amounts, and finally the expression strength relationship of different serotypes in muscle and liver tissues was determined by NGS analysis. Mutant 1 and mutant 3 had good effects in various muscles of cynomolgus monkeys, which was consistent with the results of mice. Among them, the mRNA levels of mutant 1 in gastrocnemius, biceps, triceps, and quadriceps (4 weeks) were 5.75 times, 13.31 times, 35.05 times, and 15.76 times that of AAV9, respectively. Figure 9 ), except that the expression effect in the gastrocnemius muscle was slightly lower than that of MyoAAV 4A, the performance in other muscles was better than MyoAAV 4A, and the expression trend at 2 weeks was basically the same as that at 4 weeks. Slightly different from the effect in mice, mutant 2, which performed slightly worse in mouse muscle, had a good effect in crab-eating macaque muscle, and the effect of some muscles (such as the gastrocnemius and quadriceps femoris) was close to that of mutant 1. In addition, all the muscle mutants obtained by screening, whether in mice or crab-eating macaques, showed liver tropism far lower than that of AAV9 and MyoAAV 4A, further demonstrating the consistency and superiority of this skeleton in cross-species use.
[0143] In summary, the present invention utilizes a strategy for constructing a small AAV mutant library to generate multiple serotype mutants with superior muscle targeting compared to AAV9. mRNA and protein expression levels confirm their efficacy in muscle tissues, including the gastrocnemius, quadriceps femoris, triceps brachii, biceps brachii, and abdominal muscles, with reduced liver tropism and improved specificity. These mutants can be further evaluated for their clinical application and safety, providing more useful and alternative vector tools for gene therapy of muscle diseases, benefiting a wide range of patients.
[0144] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. An adeno-associated virus capsid protein mutant, characterized in that: Its amino acid sequence is shown in SEQ ID No.
11.
2. A nucleic acid encoding an adeno-associated virus capsid protein mutant, characterized in that: Its nucleotide sequence is shown in SEQ ID No.
17.
3. An expression vector, characterized in that It comprises the nucleic acid according to claim 2.
4. A host cell, characterized in that It comprises the expression vector according to claim 3.
5. A host cell, characterized in that It expresses the adeno-associated virus capsid protein mutant according to claim 1.
6. A recombinant adeno-associated virus, characterized in that The invention comprises the adeno-associated virus capsid protein mutant according to claim 1.
7. The recombinant adeno-associated virus according to claim 6, characterized in that Heterologous genes of interest are also included.
8. The recombinant adeno-associated virus according to claim 7, characterized in that The heterologous target gene encodes any one of the gene products of interfering RNA, aptamer, endonuclease, and guide RNA.
9. A method for preparing a recombinant adeno-associated virus, characterized in that: The method comprises introducing at least the following components into a host cell: 1) the nucleic acid according to claim 2 or the expression vector according to claim 3, 2) an adeno-associated virus helper plasmid, and 3) a plasmid containing two terminal inverted repeat sequences.
10. The recombinant adeno-associated virus prepared by the method according to claim 9.
11. A drug delivery vehicle comprising the recombinant adeno-associated virus according to any one of claims 6 to 8 or the recombinant adeno-associated virus according to claim 10, and a pharmaceutically acceptable carrier.
12. Use of the adeno-associated virus capsid protein mutant according to claim 1, the expression vector according to claim 3, the host cell according to claim 4 or 5, the recombinant adeno-associated virus according to any one of claims 6 to 8, or the recombinant adeno-associated virus according to claim 10 in preparing a preparation for delivering a gene product to cells or tissues of a subject, characterized in that: The cells are muscle cells or heart cells; the tissues are muscle tissues or heart tissues.
13. Use of the adeno-associated virus capsid protein mutant according to claim 1, the expression vector according to claim 3, the host cell according to claim 4 or 5, the recombinant adeno-associated virus according to any one of claims 6 to 8, or the recombinant adeno-associated virus according to claim 10 in preparing a drug delivery tool for delivering a gene product to cells or tissues of a subject, characterized in that: The cells are muscle cells or heart cells; the tissues are muscle tissues or heart tissues.
Citation Information
Patent Citations
Adeno-associated virus mutants and their applications
CN116041443B
Adeno-associated virus mutant and application thereof
CN117903261A
Recombinant adeno-associated virus targeting skeletal muscle and application thereof
CN118108810A