Cucumber multi-host strobilurin effect protein CcSP1, coding gene and application thereof

Abstract

The present application belongs to the field of plant disease control research, and relates to a cucumber multi-host coelomyces effector protein CcSP1, a coding gene thereof and application. The present application provides a new cucumber multi-host coelomyces effector protein CcSP1, a coding gene thereof and application. The nucleotide sequence of the coding gene of the multi-host coelomyces effector protein CcSP1 is shown as SEQ ID NO. 1. Transient expression of the CcSP1 gene in N. benthamiana can inhibit hypersensitive necrosis caused by N. benthamiana. A gene deletion mutant ΔCcSP1 is constructed by homologous recombination, and the deletion of the gene does not affect the vegetative growth, but significantly reduces the pathogenicity when invading the cucumber leaves. It is shown that CcSP1 is involved in the lesion expansion of the plant after the invasion of the multi-host coelomyces, and plays an important role in the pathogenic process of the multi-host coelomyces. The present application has important significance for analyzing the related molecular mechanism of cucumber coelomyces leaf spot and establishing the comprehensive control technology strategy of the plant cucumber coelomyces leaf spot.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant disease control research, and particularly relates to a cucumber Corynespora cassiicola effector protein. BACKGROUND

[0002] Corynespora cassiicola Corynespora cassiicola is an important plant pathogenic fungus with worldwide distribution, which has a wide host range and strong parasitic specialization, and can infect more than 530 species of plants belonging to nearly 380 genera, including Solanaceae, Cucurbitaceae and other vegetable crops, and economic and food crops such as rubber, cotton and soybean.

[0003] Cucumber (Cucumis sativus L.) Cucumis sativus is one of the main vegetable crops in China, with the largest planting area and yield in the world. In recent years, with the rapid popularization of facility cultivation technology, Corynespora leaf spot caused by C. cassiicola has become an important emerging epidemic disease in cucumber production in China. This disease was once a secondary disease in China, but since the 1990s, it has frequently occurred in cucumber production areas in China, causing serious economic losses, with a general yield reduction of 20%, and sometimes up to 60% to 70%. At present, this disease has become an important factor restricting the development of the cucumber industry in China. At present, the comprehensive control strategy for cucumber Corynespora leaf spot mainly relies on chemical control, therefore, breeding and utilizing disease-resistant varieties is still the most economical, safe and effective potential approach to control this disease. However, due to the lack of high-resistance germplasm resources, the breeding of cucumber Corynespora leaf spot-resistant varieties has made very slow progress, especially in the use of genetic engineering for disease-resistant breeding, which is related to the unclear understanding of the interaction mechanism between the pathogen and the host. Patent 201710303171.5 discloses a cucumber disease-resistant gene CsERF004 and its encoded protein and application, and it is found that overexpression of CsERF004 gene significantly increases the content of free salicylic acid in cucumber, and has obvious resistance to downy mildew and Corynespora leaf spot at the seedling stage, providing a new solution to reduce cucumber diseases and pests and improve cucumber resistance to downy mildew and Corynespora leaf spot. Patent 202110901047.5 discloses a C. cassiicola CcTLS1 protein and its encoding gene and application, and it is confirmed that after the CcTLS1 gene of C. cassiicola is knocked out, the obtained C. cassiicola knockout mutant has a significantly reduced lesion area on cucumber leaves compared with the wild strain; the mycelial growth rate and cellobiohydrolase activity of the C. cassiicola knockout mutant are significantly lower than those of the wild type C. cassiicola. It is shown that the deletion of the CcTLS1 gene of the C. cassiicola knockout mutant can lead to a decrease in the ability of C. cassiicola to infect cucumber, which has important significance in the prevention and control of cucumber Corynespora leaf spot.

[0004] Therefore, in-depth analysis of the molecular pathogenesis of C. cucumerina has important scientific and practical significance for further optimizing the prevention and control strategy of the disease. SUMMARY

[0005] To solve the above problems, the application provides a cucumber multi-host Cladosporium effector protein CcSP1, a coding gene thereof and application thereof.

[0006] The technical scheme of the application is as follows:

[0007] In one aspect, the application provides a coding gene of a multi-host Cladosporium effector protein CcSP1, the nucleotide sequence of which is as shown in any one of the following:

[0008] 1) the nucleotide sequence is as shown in SEQ ID No. 1;

[0009] 2) the nucleotide sequence has a similarity of more than 90% with the sequence shown in SEQ ID No. 1

[0010] In a second aspect, the application provides a biological material, which comprises the following cases:

[0011] (1) an expression protein containing the coding gene according to claim 1;

[0012] (2) a recombinant vector containing the expression protein in step (1);

[0013] (3) a microorganism containing the recombinant vector in step (2).

[0014] Preferably, the construction method of the recombinant vector is as follows: the cDNA of C. cucumerina HG3 is used as a template, CcSP1-HF-F and CcSP1-HF-R are used as primer pairs to amplify and recover the target fragment, the amplification product is linked with the PICH vector through one-step cloning to obtain the recombinant vector.

[0015] Preferably, the nucleotide sequence of CcSP1-HF-F is as shown in SEQ ID No. 2, and the nucleotide sequence of CcSP1-HF-R is as shown in SEQ ID No. 3.

[0016] In a third aspect, the coding gene or the biological material is applied to inhibit the pathogenicity of C. cucumerina.

[0017] In a fourth aspect, the coding gene or the biological material is applied to inhibit the hypersensitive necrosis reaction of plants.

[0018] Preferably, the plant is Nicotiana benthamiana or cucumber.

[0019] In a fifth aspect, the application provides use of the above-mentioned coding gene or the above-mentioned biological material in prevention and treatment of Corynespora cassiicola or prevention and treatment of plant diseases caused by Corynespora cassiicola.

[0020] Preferably, the above-mentioned plant disease is a melon plant disease.

[0021] Preferably, the above-mentioned melon plant disease is cucumber Corynespora leaf spot.

[0022] The application has the following beneficial effects:

[0023] The application provides a cucumber Corynespora cassiicola effector protein CcSP1, a coding gene thereof and an application thereof. Transient expression of the CcSP1 gene in Nicotiana benthamiana can inhibit the hypersensitive necrosis reaction caused by the Nicotiana benthamiana. A gene deletion mutant ΔCcSP1 is constructed by homologous recombination, and the deletion of the gene does not affect the vegetative growth, but significantly reduces the pathogenicity when the mutant invades cucumber leaves, indicating that the CcSP1 is involved in the lesion expansion after the Corynespora cassiicola invades the plant and plays an important role in the pathogenic process of the Corynespora cassiicola. The application has important significance for analyzing the related molecular mechanism of cucumber Corynespora leaf spot and establishing a comprehensive prevention and control technical strategy for the cucumber Corynespora leaf spot of plants. BRIEF DESCRIPTION OF DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description are only some embodiments of the application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of these drawings.

[0025] Figure 1 It is a schematic diagram for construction of a gene knockout kit.

[0026] Figure 2 It is for obtaining a knockout mutant; wherein A is the size of the electrophoresis detection map of the upstream and downstream fragments L1 and L2, B is the electrophoresis detection map of L1H1 and L2H2, and C is CcSP1 It is a detection map of four pairs of primers of the deletion mutant.

[0027] Figure 3 It is for obtaining a complemented strain; wherein A is CcSP1 It is amplification of a target gene for complementation; B is CcSP1 It is identification of the complemented strain.

[0028] Figure 4 It is for transient expression of the cucumber Corynespora cassiicola effector protein CcSP1 gene in Nicotiana benthamiana leaves to inhibit the cell hypersensitive necrosis reaction.

[0029] Figure 5 It is CcSP1Knockout and complementation strains of C. cucumerina ssp. lagenaria were inoculated in four different media for vegetative growth assays; where A is the colony morphology after 7 days of incubation in 90 mm plates, and B is the statistical plot of colony diameter measured at 7 days.

[0030] Figure 6 To CcSP1 Mutant pathogenicity assays. DETAILED DESCRIPTION

[0031] The technical solutions of the present application will be described clearly and completely below in combination with the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0032] The experimental methods used in the following experimental examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are reagents and materials available through commercial channels unless otherwise specified.

[0033] Example 1 Construction of knockout kit

[0034] Construction of gene knockout cassette: The genomic DNA of C. cucumerina ssp. lagenaria wild type strain HG3 was used as template, and the primer pairs CcSP1-1F (TGGAAAGAAGGACCACAATC) / CcSP1-2R (TTGACCTCCACTAGCTCCAGCCAAGCCGGTGACTGGATTGATAGGA) and CcSP1-3F (GAATAGAGTAGATGCCGACCGCGGGTTCTCTAAGATGCTTTTTGGAGGTGGA) / CcSP1-4R (ACGCAACAAGAGAGGAGTG) were used to amplify the L1 and L2 fragments of the target gene CcSP1, respectively. The size of L1 was 1136 bp, and the size of L2 was 1138 bp. Figure 2A) The full length of hygromycin phosphotransferase (hph) gene was amplified with primers HYG / F (GGCTTGGCTGGAGCTAGTGGAGGTCAA) and HYG / R (GAACCCGCGGTCGGCATCTACTCTAT) using pKOV21 plasmid as template. The PCR product was recovered by cutting the 1.2% agarose gel electrophoresis. The PCR reaction system: 2 x NG PCR master Mix 10 μL, 1 μL of each of the upstream and downstream primers, 1 μL of DNA template, supplemented with ddH2O to 20 μL. The PCR reaction program: 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 1 min 20 s, 35 cycles; 72°C extension for 7 min, 16°C preservation. The concentration of the recovered L1 L2 fragment product was diluted to 50 ng / μL. The upstream fragment L1, the downstream fragment L2 and the hph fragment were used as templates in the proportion of 1:1:3 to perform fusion PCR by Split-marker recombination technology. The PCR reaction system: 2 x Super Pfx MasterMix 5 μL, 1 μL of each of the upstream and downstream fragments L1, L2, 5 μL of the hygromycin fragment HYG, supplemented with ddH2O to 25 μL. The PCR reaction program: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 58°C annealing for 30 s, 72°C extension for 2 min 30 s, 15 cycles; 72°C extension for 7 min, 16°C preservation. The fusion PCR product was used as a template to amplify the upstream and downstream fusion fragments LIH1 and L2H2 with primers CcSP1-1F / HY-R (GTATTGACCGATTCCTTGCGGTCCGAA) and YG-F (GATGTAGGAGGGCGTGGATATGTCCT) / CcSP1-4R, respectively. The size of L1H1 was 1900 bp and the size of L2H2 was 2155 bp. Figure 2 B). The PCR product was recovered by cutting the 1.2% agarose gel electrophoresis. The PCR reaction system: 2 x Super Pfx MasterMix 12.5 μL, 0.75 μL of each of the upstream and downstream primers, 1 μL of the previous round product, supplemented with ddH2O to 25 μL. The PCR reaction program: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 58°C annealing for 30 s, 72°C extension for 1 min 10 s, 35 cycles; 72°C extension for 7 min, 16°C preservation. The hygromycin gene was replaced with the CcSP1 gene by using the principle of homologous recombination. Figure 1 .

[0035] Example 2 Construction of complementation strain

[0036] CcSP1 gene and its promoter sequence were amplified from the genomic DNA of wild type HG3 strain using primers CcSP1-HF-F (CTCGAGGTCGACCATCGATACCTCATCGCCATTTGCTAA) / CcSP1-HF-R (GACCTGCAGGCATGCAAGCTGAAGGGGGTGGGCTCCTCAAC), and the fragment size was 2513 bp (SEQ ID NO: 1). Figure 3 The PCR product was obtained by 1.2% agarose gel electrophoresis, and the concentration was diluted to 50 ng / μL and stored at -20°C for standby use. The PCR reaction system was as follows: 2 x Super Pfx Master Mix 12.5 μL, 0.75 μL of each primer, 2 μL of template DNA, and ddH2O to 25 μL. The PCR reaction program was as follows: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 58°C annealing for 30 s, 72°C extension for 2 min 30 s, 35 cycles; 72°C extension for 7 min, and 16°C storage. After the pKNTG plasmid was extracted from E. coli, Hind III was used for single enzyme digestion, and the reaction system was as follows: 10 x NE Buffer 10 μL, Hind III 1 μL, plasmid 1.5 μL, and ddH2O to 50 μL. The enzyme digestion was performed at 37°C overnight for 12 h, and then the enzyme was inactivated by 80°C water bath for 20 min. The Hind III enzyme-digested linearized pKNTG vector was obtained by purification and recovery, and the concentration was diluted to 50 ng / μL and stored at -20°C for standby use. The target gene fragment containing its own promoter was constructed into the Hind III enzyme-digested linearized pKNTG vector by One Step Seamless Cloning Kit, and the reaction system was as follows: 2 x One Step Cloning Mix 5 μL, target gene fragment 2 μL, enzyme-digested linearized pKNTG vector 1 μL, and ddH2O to 10 μL. The PCR reaction program was as follows: 50°C for 15 min, and 16°C storage. The ligation product was transformed into E. coli DH5α competent cells, and the selection was performed on an LBA medium plate containing AMP. After the transformants were verified by colony PCR using CcSP1-5F (TGAACAGCCAGCAAACAG) / GFP-R (GATGCCCTTCAGCTCGATGCGGTTCA), sequencing was performed, and the positive transformants were shaken and the recombinant plasmid was extracted.

[0037] Example 3 Construction of CcSP1 Transient Expression Vector

[0038] According to the whole genome sequence of Cucumber Monosporium HG3, the CDS sequence of CcSP1 was obtained by bioinformatics, and the CDS full length of CcSP1 was designed (CcSP1-HF-F (SEQ ID No. 2): TTACAATTATCGATACAATGTACCCATACGACGTCCCAGACTACGCTATGCGCTCTTTCGTTGCTGTGGCT, CcSP1-HF-R (SEQ ID No. 3): CTCATTAAAGCAGGACAAGCGAAGGGGGTGGGCTCCTCAAC), and the full length of CcSP1 was obtained by PCR amplification with the cDNA of Cucumber Monosporium HG3 as the template, and the full length of CcSP1 was obtained by PCR amplification with the cDNA of Cucumber Monosporium HG3 as the template. ΔSP -F (TTACAATTATCGATACAATGTACCCATACGACGTCCCAGACTACGCTATGTGCAATGGCGTAGGAGGTTG), and the fragment without signal peptide was amplified by CcSP1-HF-R, and KOD OneTM PCR Master Mix-Blue- of Toyobo Company was used for amplification, and the PCR reaction system was as follows: KOD OneTM PCR Master Mix-Blue- 12.5 μL, forward and reverse primers 0.75 μL, and ddH2O was added to 25 μL. The reaction conditions were as follows: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s; 56℃ annealing for 5 s; 68℃ extension for 30 s for 35 cycles; 68℃ final extension for 7 min; 16℃ storage. After agarose gel electrophoresis detection of the PCR product, the gel was purified and recovered, and the target fragment was connected with the digested PICH, 50℃ for 50 min; 16℃ storage. The ligation product was transformed into E. coli DH5α cells, and the positive clones were selected for sequencing, and the correct clones were selected for plasmid extraction.

[0039] Example 4 Nicotiana benthamiana leaf transient expression of CcSP1 coding gene

[0040] Recombinant plasmid was introduced into Agrobacterium competent: the correct E. coli strain verified by sequencing was used to extract plasmid DNA with a plasmid kit, Agrobacterium GV3101 competent was thawed on ice, 3 μL plasmid DNA was gently and slowly added to the competent cells, which were cooled on ice for 30 min. The centrifuge tube was sealed with sealing film, frozen in liquid nitrogen for 2 min, and heat shocked at 37°C for 3-5 min. 800 μL of LB liquid medium was added and mixed, and cultured in a 28°C shaker for 3-4 h. The bacteria were collected by centrifugation at 4000 rpm for 2 min, and the bacteria were placed on the corresponding resistant LB medium for screening. After 2 days, the colonies were grown and verified by PCR. The correct Agrobacterium colonies were cultured in LB + 50 μg / mL Kan + 50 μg / mL Rif at 28°C for 24-36 h on a 220 rpm shaker. The bacteria were collected by centrifugation at 5000 rpm for 3 min, and the bacteria were suspended in MMA. The OD of the bacteria liquid was adjusted to 0.6, and the adjusted Agrobacterium liquid with OD = 0.6 was injected into tobacco leaves. The effect protein was injected into tobacco, BAX was injected after 12 h, and the tobacco necrosis was observed after 4 d. The complete effect protein CcSP1 inhibited the hypersensitive necrosis reaction caused by BAX, and the coding region without signal peptide could not inhibit the hypersensitive necrosis reaction caused by BAX, which indicated that the signal peptide played an important role in inhibiting the hypersensitive necrosis reaction caused by BAX Figure 4 ).

[0041] Example 5 Obtaining of knock-out mutant and complemented strain

[0042] Preparation of Protoplasts of Monacrosporium cucurbitarum HG3: Wild type cucumber Monacrosporium cucurbitarum HG3 stored in 30% glycerol in a 4°C refrigerator was activated on prepared PDA medium, and incubated in a 25°C constant temperature incubator for 3 days. The activated colony edge young mycelium was cut into small pieces with a scalpel and placed in prepared 100 mL YPD liquid medium with AMP in a constant temperature shaker, 28°C, 180 rpm, and shaken for 24 h. Then the mycelium was broken with a homogenizer, and YPD medium was added to make up to 100 mL. The mixture was placed in a constant temperature shaker, 28°C, 180 rpm, and shaken for 12 h. The bacterial liquid was filtered with a sterile funnel with non-woven filter cloth to obtain protoplasts, which were repeatedly washed with sterile water until they turned white. An appropriate amount of protoplasts were taken in a sterile small triangular flask, and 200 mg of lysozyme, 100 mg of snailase, and 100 mg of lyticase were weighed and added to a prepared 50 mL centrifuge tube containing 10 mL 0.7 M NaCl solution, wrapped with tin foil to avoid light, and placed in a constant temperature shaker, 30°C, 100 rpm, and shaken for 30 min. After centrifugation at 3500 rpm for 7 min, the supernatant was filtered with a 0.45 μm bacterial filter to remove bacteria and added to the small triangular flask containing protoplasts, wrapped with tin foil to avoid light, and placed in a constant temperature shaker, 30°C, 100 rpm, and lysed for 3 h. The lysed protoplasts were filtered with a sterile small beaker with non-woven filter cloth, washed with 0.7 M NaCl solution, collected in a sterile 50 mL centrifuge tube, centrifuged at 3500 rpm for 7 min, and the supernatant was discarded. 1.5 mL of STC buffer was added to resuspend the protoplast pellet, and then aliquoted into sterile 2 mL centrifuge tubes, centrifuged at 4°C, 4000 rpm for 2 min, and the supernatant was discarded. The protoplasts were resuspended with 500 μL of STC buffer.

[0043] PEG-mediated protoplast transformation: In a sterile 50 mL centrifuge tube, add 200 μL prepared protoplast, then add 10 μL of recovered product L1H1 and L2H2, (add 10 μL of recombinant plasmid to the prepared protoplast in a sterile 50 mL centrifuge tube) mix gently, and place on ice for 30 min; then add 1 mL of PEG dropwise, mix gently, and place at room temperature for 20 min. Add 5 mL of TB3 liquid medium containing AMP to the 50 mL centrifuge tube, and place at room temperature for 2 h (the time can also be extended), then place in a constant-temperature shaker at 25°C and 100 rpm for 12 h. Pour the moderate-temperature PDA medium into the recovered mycelium, dilute to 30 mL, add 30 μL of AMP (AMP concentration is 100 mg / mL) and 30 μL of hygromycin (hygromycin concentration is 50 mg / mL), mix well, and pour two plates. (Dilute to 30 mL, add 30 μL of AMP (AMP concentration is 100 mg / mL) and 30 μL of G418 (G418 concentration is 50 mg / mL), mix well, pour two plates, and place in a constant-temperature incubator at 25°C in the dark. After the mycelium grows, pour a layer of PDA containing AMP and hygromycin (G418 PDA), and then pick a single mycelium under a stereoscope and place it on PDA medium containing AMP and hygromycin to obtain the knockout transformant. Use four pairs of primers for detection, (M: Marker, T: target gene, H: hygromycin phosphotransferase gene, F: upstream recombinant fragment, R: downstream recombinant fragment, WT: wild type control) respectively amplify no band by target gene CcSP1-5F / CcSP1-6R, detect a band of 1380 bp by hygromycin HYG-F / HYG-R, detect a band of 2193 bp by upstream junction site CcSP1-7F / HY-R, and detect a band of 2360 bp by downstream junction site YG-F / CcSP1-8R. Four knockout mutants are obtained by screening with the four pairs of primers ΔCcSP1 -2、 ΔCcSP1 -6、 ΔCcSP1 -9、 ΔCcSP1 -139( Figure 2 -C). Select ΔCcSP1-6 for further study. After the hyphae germinated again, single hyphae were picked under the stereomicroscope and placed on PDA medium containing AMP and G418 to obtain the knock-out transformants. Three pairs of primers were used for detection (primer CcSP1-5F / CcSP1-6R was used to detect whether the target gene was successfully connected with the vector, with a size of 284 bp; primer G852F / G850R was used to detect whether the G418 resistance gene existed, with a size of 650 bp; primer CcSP1-5F / GFP-R was used to detect whether the connection site was correct, with a size of 776 bp). Two strains were obtained by back-supplementation, which were c CcSP1 -6_1 and c CcSP1 -6_3, respectively. Figure 3 -B). c CcSP1 -6_3 was selected for further study. CcSP1 -6, and was used for further study.

[0044] Example 6 Nutritional growth determination of knock-out mutants and back-supplementation mutants

[0045] Wild type HG3, knock-out mutant Δ CcSP1 and back-supplementation mutant c CcSP1 were inoculated into different nutrient media (including CM, OM, MM and PDA). Wild type cucumber Didymella bryoniae HG3, knock-out mutant Δ CcSP1 and back-supplementation strain c CcSP1 were activated on prepared PDA medium, and were cultured in a 25°C constant temperature incubator for 3 days. A 5 mm fungus cake was punched at the edge of the hyphae, and was cultured in a 25°C constant temperature incubator for 7 days. The colony morphology was observed and the colony diameter was counted. It was found that there was no difference in colony morphology of knock-out mutant Δ CcSP1 -6, back-supplementation strain c CcSP1 -6 and wild type HG3 in PDA, OM, CM and MM four different media after 7 days (Fig. Figure 5 -A), and there was also no difference in colony size (Fig. Figure 5 -B).

[0046] Example 7 Effect of knock-out mutants and back-supplementation mutants on pathogenicity of cucumber Didymella bryoniae leaf spot

[0047] Wild type cucumber Didymella bryoniae HG3, knock-out mutant Δ CcSP1 and back-supplementation strain c CcSP1The spores were activated on prepared PDA medium and incubated at 25°C for 3 days. A 5 mm mycelial cake was formed at the edge of the mycelium. Using blank PDA as a control, the culture was incubated at 25°C for 7 days. Colonies were then scraped off with an inoculation needle, rinsed three to four times with sterile water, and the spore suspension was collected by filtration through a funnel containing non-woven filter cloth. The concentration of the spore suspension was adjusted to 1 × 10⁻⁶. 6 Using the spot method, 40 μL of spore suspension was evenly dropped onto cucumber leaves with a diameter of 2 cm using a pipette. The spore suspension was kept at over 95% moisture content for 12 h after inoculation and then placed in a 28℃ greenhouse with alternating light and dark conditions for 12 h. Disease development was observed and photographed after 5 days. This experiment was repeated three times. The reintroduced strain c was found. CcSP1 -6 showed no difference in disease incidence compared to wild-type HG3, while the knockout mutant Δ CcSP1 -6 Compared to wild-type HG3, the knockout mutant Δ CcSP1 -6 significantly reduces pathogenicity when infecting cucumber leaves ( Figure 6 ).

[0048] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of the gene encoding the multi-headed spirochete effector protein CcSP1 in reducing the pathogenicity of multi-headed spirochete to cucumber, characterized by: The application involves knocking out the gene encoding the multi-branch effector protein CcSP1 in *C. multibranch* to reduce the pathogenicity of *C. multibranch* to cucumber. The nucleotide sequence of the gene encoding the multimaster spore effector protein CcSP1 is shown in SEQ ID No.

1.

2. The application of the gene encoding the multi-master spore effector protein CcSP1 in inhibiting the hypersensitive necrosis response in plants, characterized by: The plant is *Nicotiana benthamiana*, and the application includes constructing a recombinant vector containing the encoding gene of the multi-master spore effector protein CcSP1 shown in SEQ ID No. 1, and transferring the recombinant vector into *Nicotiana benthamiana* via Agrobacterium-mediated transformation to inhibit the allergic necrosis response of *Nicotiana benthamiana*.

3. The application according to claim 2, characterized in that: The recombinant vector was constructed using cDNA of *Corynebacterium cucumeri* HG3 as a template, and the target fragment was amplified and recovered using CcSP1-HF-F and CcSP1-HF-R primers. The amplified product was then ligated to the intermediate vector using a one-step cloning method to obtain the recombinant vector. The nucleotide sequence of CcSP1-HF-F is shown in SEQ ID No. 2, and the nucleotide sequence of CcSP1-HF-R is shown in SEQ ID No.

3.

4. The application of the gene encoding the multi-master spirochete effector protein CcSP1 in the control of plant diseases caused by multi-master spirochete, characterized by: The plant disease is Cucumber Corynebacterium leaf spot, and the application is to control Cucumber Corynebacterium leaf spot by knocking out the gene encoding the multi-master Corynebacterium effector protein CcSP1 in Corynebacterium multimasterium. The nucleotide sequence of the gene encoding the multimaster spore effector protein CcSP1 is shown in SEQ ID No. 1.

Images