Wickerhamomyces anomalus strain YE006, fermentation method, fungicide and application of Wickerhamomyces anomalus strain YE006

Abstract

The invention discloses a Wickerhamomyces anomalus strain YE006, a fermentation method, a fungicide and application of the Wickerhamomyces anomalus strain YE006, and belongs to the technical field of microbial strains and fermentation. According to the present invention, the Wickerhamomyces anomalus YE006 is screened from wine brewing fermented grains, the Wickerhamomyces anomalus YE006 is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number of the Wickerhamomyces anomalus YE006 is CCTCC NO: M 20242319; the Wickerhamomyces anomalus provided by the invention is rich in fragrance and high in total ester yield, can generate nine volatile flavor substances, and can be used as a special ammonia odor reducing, ester and alcohol producing and aroma enhancing strain for food fermentation; the strain is mixed with bacillus subtilis SXD06 (preserved in the China Center for Type Culture Collection with the preservation number of CCTCC NO: M 20242318) for producing plasmin to ferment soybeans, so that the miraculous beans which are free of obvious ammonia odor and stable in quality can be obtained.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial strains and fermentation, and particularly relates to an abnormal Wickham yeast strain YE006, a fermentation method, a bacterial agent and application thereof. Background Art

[0002] Ester-producing yeast is a type of yeast that can produce esters, and has strong oxidation properties and ester-producing ability. Most ester-producing yeasts belong to Hansenula, and a few belong to Torulopsis. At present, the high-ester-producing yeasts reported at home and abroad include Zygosaccharomyes rouxii, Pichia anomala, Kluyveromyces marxianus, Saccharomycopsis fibuligera, Wickerhamomyces anomalus and Hanseniaspora uvarum. Ester-producing yeasts produce esters, alcohols, acids, alkanes, aromatic hydrocarbons, ketones, etc. during the fermentation process. The contents of these substances vary, which constitute the unique fermentation aroma of different yeasts. These substances can significantly improve the flavor quality of fermented products, so they are widely used in food fermentation industries such as wine and condiments.

[0003] Abnormal Wickham yeast (Wickerhamomyces anomalus) is widely used in the brewing industry and is often used to brew koji wine and light-flavor liquor. This yeast can secrete a variety of glycosidases, has the ability to produce fragrance, esters and alcohol, can significantly improve the sensory quality of wine, and is an important functional microorganism in the fermentation process of fermented grains. There is often a phenomenon of obvious ammonia odor in food fermentation, especially when bacteria such as Bacillus natto, Bacillus subtilis and Lactobacillus plantarum decompose proteins and carbohydrates in food, they will produce compounds with ammonia odor, which significantly reduces the flavor quality of food. The current commonly used method to reduce ammonia odor is to optimize fermentation culture conditions or adjust the fermentation ratio, but such methods have high production costs, complex processes, and difficult operations, and may also affect product quality. Therefore, obtaining microbial strains that can efficiently remove ammonia odor and increase food flavor quality is the basis and key to the research and development of flavor-enhancing and ammonia-removing bacterial agent products, which has important practical significance for food fermentation.

[0004] Fairy beans are a kind of fermented bean snack fermented by the people in northern Anhui Province. They are prepared through traditional processes such as selection, soaking, steaming, fermentation, and blending. The fermentation strains are mainly Bacillus, which belongs to bacterial type fermented black beans. At present, most of the production of fairy beans is natural fermentation of Bacillus, and the strains used are relatively single, so the fermentation will produce a relatively obvious ammonia smell and the product quality stability is poor, which limits the development of fairy beans products. Summary of the invention

[0005] In view of the technical difficulties and existing problems at this stage, the present invention provides an abnormal Wickham yeast strain YE006, a fermentation method, a bacterial agent and applications thereof, so as to solve the problem of obvious ammonia odor in food fermentation.

[0006] The invention provides an abnormal Wickham yeast strain YE006, which is classified and named as abnormal Wickham yeast (Wickerhamomyces anomalus), and is preserved in China Center for Type Culture Collection with a preservation number of CCTCC NO: M20242319.

[0007] Furthermore, the DNA sequence of the abnormal Wickham yeast strain YE006 is shown in SEQ ID No.1.

[0008] The invention provides a fermentation method of abnormal Wickham yeast strain YE006. The method comprises the following steps: transferring the abnormal Wickham yeast strain YE006 to a yeast liquid seed culture medium, and culturing the culture medium at 28-32° C. and 180 r / min for 24-72 hours.

[0009] Preferably, the fermentation method of the abnormal Wickham yeast strain YE006 is: transferring the abnormal Wickham yeast strain YE006 to a yeast liquid seed culture medium, and culturing at 30° C. and 180 r / min for 24 hours.

[0010] The present invention provides a fermentation liquid of abnormal Wickham yeast strain YE006, wherein the fermentation liquid is obtained by fermenting the abnormal Wickham yeast strain YE006 according to the above fermentation method.

[0011] The present invention provides a bacterial agent, wherein the active ingredients of the bacterial agent include abnormal Wickham yeast strain YE006 or the fermentation liquid of abnormal Wickham yeast strain YE006.

[0012] The invention provides an application of an abnormal Wickham yeast strain YE006 or a fermentation liquid of the abnormal Wickham yeast strain YE006 or a bacterial agent whose active ingredient is the abnormal Wickham yeast strain YE006 or the fermentation liquid of the abnormal Wickham yeast strain YE006 in producing ester or alcohol flavor substances.

[0013] Furthermore, the application is to produce ester substances in soy products, vinegar, soy sauce or wine, and the application is to produce alcohol substances in soy products, vinegar, soy sauce or wine.

[0014] Furthermore, the ester substance is any one or more of ethyl acetate, ethyl lactate and phenylethyl acetate.

[0015] Furthermore, the alcohol substance is any one or more of propylene glycol, isopentanol, 2,3-butanediol and phenylethyl alcohol.

[0016] Furthermore, the abnormal Wickham yeast strain YE006 is an ester-producing strain, and the total ester content reaches 3.57 g / L after 3 days of cultivation.

[0017] The invention provides an application of abnormal Wickham yeast strain YE006 or abnormal Wickham yeast strain YE006 fermentation liquid or a bacterial agent whose active ingredient is abnormal Wickham yeast strain YE006 or abnormal Wickham yeast strain YE006 fermentation liquid, and the application is to reduce ammonia odor in food fermentation.

[0018] Furthermore, the application is to reduce the ammonia odor during fermentation of soy products.

[0019] Furthermore, the bean product is bacterial-type fermented black beans.

[0020] Furthermore, the bacterial fermented black beans include fairy beans.

[0021] The invention provides a magic bean, which is obtained after abnormal Wickham yeast strain YE006 is added in a soybean fermentation process.

[0022] Furthermore, Bacillus subtillis SXD06 is also added in the soybean fermentation process. The Bacillus subtillis SXD06 is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M20242318.

[0023] Bacillus subtilis SXD06 was isolated and screened from the microbial flora on the surface of traditional northern Anhui fairy beans. It is a functional fermentation strain that can produce fibrinolytic enzyme.

[0024] Furthermore, the fairy beans are used to prepare fairy beans products, and the fairy beans products are obtained by the following preparation method:

[0025] Inoculate the steamed and cooled soybeans with Bacillus subtilis SXD06 at an inoculation rate of 1.1-3.5% and the abnormal Wickham yeast strain YE006 at an inoculation rate of 3.5-6%, and ferment at a temperature of 26-36° C. for 48-108 hours to obtain the fairy beans;

[0026] Then, the magic beans, edible salt, chili powder, star anise powder, cinnamon, bay leaves and edible alcohol are uniformly mixed in a mass ratio of 71-98%: 2-12%: 0-5%: 0-0.5%: 0-0.5%: 0-1%: 0-10% to obtain a magic bean product.

[0027] In summary, compared with the prior art, the present invention has the following advantages and effects:

[0028] (1) The abnormal Wickham yeast strain YE006 disclosed in the present invention is isolated and screened from brewing grains, and is a functional strain that can enhance aroma, produce esters, produce alcohol, and reduce the ammonia smell in food fermentation. The abnormal Wickham yeast strain YE006 can, on the one hand, use ammonia substances such as ammonia to produce bacterial proteins, and on the other hand, can produce a large amount of ester flavor substances such as ethyl acetate, ethyl lactate, and phenylethyl acetate, and produce alcohol flavor substances such as glycerol, 2,3-butanediol, and phenylethanol. It is widely used in food fermentation, especially in the fermentation and brewing of soy products, and can significantly reduce the ammonia smell produced by food fermentation and improve food quality; the abnormal Wickham yeast strain YE006 can also be used to develop related functional bacterial agents.

[0029] (2) The present invention discloses that abnormal Wickham yeast strain YE006 and Bacillus subtilis SXD06 can be used to prepare fairy beans. The present invention is the first to use abnormal Wickham yeast strain YE006 and Bacillus subtilis SXD06 to mix and ferment to brew fairy beans. Bacillus subtilis is the main dominant strain in soybean paste fermentation. The present invention isolates and screens a functional fermentation strain Bacillus subtilis SXD06 that can produce fibrinolytic enzyme from the microbial flora on the surface of traditional northern Anhui fairy beans. The fibrinolytic enzyme activity of the strain after fermentation for 24 hours reaches 2843 IU / g. The fairy beans were brewed by mixed fermentation of abnormal Wickham yeast strain YE006 and Bacillus subtilis SXD06. The fairy beans product obtained had the highest sensory score and no obvious ammonia smell. This solves the current problems in the brewing of fairy beans, such as serious ammonia odor, backward production methods, low production efficiency, and poor quality stability. It provides reliable technical support for the development of low-ammonia odor, high-quality fairy beans products that meet the public's preferences, and can also promote the updating of bean product processing technology and product upgrading in northern Anhui, increase the added value of soybeans, and drive local economic development.

[0030] Description of biological material deposit

[0031] Wickerhamomyces anomalus YE006, referred to as abnormal Wickham yeast strain YE006 in the present invention, has been deposited in the China Center for Type Culture Collection on October 24, 2024, with a deposit number of CCTCC NO: M20242319. The address of the depository is Wuhan University, Wuhan, China, Postal Code: 430072, and the classification name is: Wickerhamomyces anomalus.

[0032] Bacillus subtillis SXD06, referred to as Bacillus subtilis SXD06 in the present invention, has been deposited in the China Center for Type Culture Collection on October 24, 2024, with a deposit number of CCTCC NO: M20242318. The address of the depository is Wuhan University, Wuhan, China, Postal Code: 430072, and the classification name is: Bacillus subtillis. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a graph of the ester production ability of the rescreened yeast;

[0034] Figure 2 The morphology (a) and microscopic structure (b) of the abnormal Wickham yeast strain YE006;

[0035] Figure 3 The molecular development tree of the abnormal Wickham yeast strain YE006;

[0036] Figure 4 This is a diagram of the enzyme production capacity of the isolated and cultured Bacillus strains;

[0037] Figure 5 The morphological image (a) and Gram staining microscopic image (b) of Bacillus subtilis SXD06 strain;

[0038] Figure 6 is the phylogenetic tree of Bacillus subtilis SXD06 strain;

[0039] Figure 7 The figures are the effects of different single factor conditions on the sensory evaluation and amino acid nitrogen content of fairy beans fermentation; Figure (a) is the effect of different Bacillus subtilis SXD06 inoculation amounts on sensory evaluation and amino acid nitrogen content, Figure (b) is the effect of different abnormal Wickham yeast strain YE006 inoculation amounts on sensory evaluation and amino acid nitrogen content, Figure (c) is the effect of different fermentation temperatures on sensory evaluation and amino acid nitrogen content, and Figure (d) is the effect of different fermentation times on sensory evaluation and amino acid nitrogen content.

[0040] Figure 8It is a response surface diagram of the fermentation process of fairy beans; Figure (a) is a response surface diagram of the interaction between A and B on the sensory evaluation, Figure (b) is a response surface diagram of the interaction between A and C on the sensory evaluation, Figure (c) is a response surface diagram of the interaction between A and D on the sensory evaluation, Figure (d) is a response surface diagram of the interaction between B and C on the sensory evaluation, Figure (e) is a response surface diagram of the interaction between B and D on the sensory evaluation, and Figure (f) is a response surface diagram of the interaction between C and D on the sensory evaluation; wherein A represents the inoculation amount of Bacillus subtilis SXD06, B represents the inoculation amount of abnormal Wickham yeast strain YE006, C represents the fermentation temperature, and D represents the fermentation time;

[0041] Fig. 9 The SDS-PAGE electrophoresis diagram of the control group (unfermented soybeans) and the experimental group (magic beans);

[0042] Fig.10 This is a preparation flow chart of the fairy bean product;

[0043] Fig.11 Figure 1 is the influence diagram of different single factor conditions on the sensory evaluation of the preparation of fairy beans products; Figure (a) is the influence diagram of different salt addition amounts on the sensory evaluation of fairy beans products, Figure (b) is the influence diagram of different star anise addition amounts on the sensory evaluation of fairy beans products, Figure (c) is the influence diagram of different cinnamon addition amounts on the sensory evaluation of fairy beans products, Figure (d) is the influence diagram of different chili powder addition amounts on the sensory evaluation of fairy beans products, Figure (e) is the influence diagram of different alcohol addition amounts on the sensory evaluation of fairy beans products, and Figure (f) is the influence diagram of different bay leaf addition amounts on the sensory evaluation of fairy beans products;

[0044] Fig.12 It is a response surface diagram of the preparation process of the fairy bean product; Figure (a) is a response surface diagram of the interaction between A and B on the sensory evaluation, Figure (b) is a response surface diagram of the interaction between A and C on the sensory evaluation, Figure (c) is a response surface diagram of the interaction between A and D on the sensory evaluation, Figure (d) is a response surface diagram of the interaction between A and E on the sensory evaluation, Figure (e) is a response surface diagram of the interaction between A and F on the sensory evaluation, and Figure (f) is a response surface diagram of the interaction between B and C on the sensory evaluation; wherein A represents the amount of edible salt added, B represents the amount of star anise added, C represents the amount of cinnamon added, D represents the amount of chili powder added, E represents the amount of edible alcohol added, and F represents the amount of bay leaf added;

[0045] Fig.13It is a response surface diagram of the preparation process of fairy beans product; Figure (a) is the response surface diagram of the interaction between B and D on the sensory evaluation, Figure (b) is the response surface diagram of the interaction between B and E on the sensory evaluation, Figure (c) is the response surface diagram of the interaction between B and F on the sensory evaluation, Figure (d) is the response surface diagram of the interaction between C and D on the sensory evaluation, Figure (e) is the response surface diagram of the interaction between C and E on the sensory evaluation, and Figure (f) is the response surface diagram of the interaction between C and F on the sensory evaluation; wherein B represents the amount of star anise added, C represents the amount of cinnamon added, D represents the amount of chili powder added, E represents the amount of edible alcohol added, and F represents the amount of bay leaf added;

[0046] Fig.14 It is the response surface diagram of the preparation process of the fairy bean product; Figure (a) is the response surface diagram of the interaction between D and E on the sensory evaluation, Figure (b) is the response surface diagram of the interaction between D and F on the sensory evaluation, and Figure (c) is the response surface diagram of the interaction between E and F on the sensory evaluation; where D represents the amount of chili powder added, E represents the amount of edible alcohol added, and F represents the amount of bay leaf added; DETAILED DESCRIPTION

[0047] In order to enable those skilled in the art to better understand and implement the technical solution of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings.

[0048] In the description of the present invention, unless otherwise specified, all reagents used are commercially available and all methods used are conventional techniques in the art.

[0049] There is often a noticeable ammonia smell in food fermentation, especially when bacteria such as Bacillus natto, Bacillus subtilis and Lactobacillus plantarum decompose proteins and carbohydrates in food, they will produce a large amount of compounds with ammonia smell, which significantly reduces the flavor quality of food. The existing methods for reducing ammonia smell are to optimize fermentation culture conditions or adjust fermentation ratios, but such methods have high production costs, complex processes, and difficult operations, and may also affect product quality.

[0050] The present invention provides an abnormal Wickham yeast strain YE006 (hereinafter referred to as yeast YE006) that produces esters, alcohols, enhances fragrance, and can reduce ammonia odor. The yeast or the fermented liquid of the yeast or the bacterial agent with the yeast as an active ingredient is added to food for fermentation, which can significantly reduce the ammonia odor produced by food fermentation. The yeast YE006 and Bacillus subtilis SXD06 (hereinafter referred to as Bacillus SXD06) are mixed and fermented to brew fairy beans, and the fermentation conditions and the blending process are optimized by using a response surface to obtain a fairy bean product with no obvious ammonia odor and high quality.

[0051] The culture medium and its composition involved in the embodiments of the present invention are as follows:

[0052] YEPD solid medium / yeast slant medium: 20g yeast extract, 20g peptone, 20g glucose, 20g agar, 1L distilled water.

[0053] Yeast liquid seed medium: 20 g yeast extract, 20 g peptone, 20 g glucose, 1 L distilled water.

[0054] PDA medium: 200 g potato, 20 g glucose, 19 g agar, 1 L distilled water.

[0055] PD medium: 200 g potato, 20 g glucose, 1 L distilled water.

[0056] Bacillus plate isolation medium / Bacillus slant medium: 5g yeast extract, 10g peptone, 5g sodium chloride, 20g agar, 1L distilled water.

[0057] Bacillus liquid seed medium: 5 g yeast extract, 10 g peptone, 5 g sodium chloride, 1 L distilled water.

[0058] Soybean casein agar plate: 15 g tryptone, 5 g soytone, 5 g sodium chloride, 20 g agar.

[0059] Example 1: Obtaining excellent yeast strains

[0060] 1. Preliminary screening of bacterial strains

[0061] Take 10g of brewer's grains sample and add it to a triangular flask containing 90mL of sterile water. After shaking at room temperature at 180r / min for 15min, perform gradient dilution. Take 1μL of the appropriate dilution bacterial solution and spread it on YEPD solid medium containing 0.1% chloramphenicol. After culturing for 48h at 30℃, mark the yeasts with different colony characteristics and different aromas grown in the culture dish. After multiple plate streaking, obtain pure strains and preserve the strains at 4℃. Six strains with better aroma were initially screened and numbered as YE001~YE006. The aroma experiment showed that the aroma of yeast YE006 was the most obvious when it was cultured for 6d. The test results are shown in Table 1.

[0062] Table 1 Test results of aroma production of different yeasts

[0063] Strain number 1d 2d 3d 4d 5d 6d 7d YE001 N + + + ++ ++ ++ YE002 N + + + ++ ++ ++ YE003 N N + + ++ ++ ++ YE004 + ++ ++ ++ ++ ++ ++ YE005 + + ++ ++ ++ ++ +++ YE006 + ++ +++ +++ +++ +++ +++

[0064] Note: The more +s there are, the stronger the aroma is; N means there is no obvious aroma.

[0065] 2. Strain rescreening

[0066] Use an inoculation loop to select 2 loops of yeast moss on the slant medium and inoculate them into the yeast liquid seed medium, and culture them at 30°C and 180r / min for 24h. After the culture is completed, inoculate them into PD medium at a 10% inoculation rate, place them in a 30°C incubator for 3 days, and determine the total ester content.

[0067] Depend on Figure 1 It can be seen that the yeast strain YE006 has the most outstanding ester production ability, and the total ester content reaches 3.57g / L. The fermentation products obtained were analyzed by GC-MS for volatile flavor substances, and the results are shown in Table 2. As shown in Table 2, the yeast fermentation products of the six yeast strains mainly contain 11 volatile flavor substances, including 4 alcohol substances, 1 acid substance, 3 ester substances and 1 siloxane compound substance. Alcohols include glycerol, isopentanol, 2,3-butanediol, and phenylethanol. When the isopentanol content is high, it will cause spicy bitterness and bring adverse effects to the fairy beans. Glycerol and 2,3-butanediol have a sweet taste. Phenylethanol has a rose aroma flavor. Therefore, in the fermentation product, relatively high contents of glycerol, 2,3-butanediol, and phenylethanol have a promoting effect on the aroma. The fermentation product of yeast strain YE006 contains high levels of glycerol, 2,3-butanediol, and phenylethyl alcohol, while the content of isoamyl alcohol is relatively low. In addition, the fermentation product contains high levels of acetic acid, ethyl acetate, and phenylethyl acetate, which have a positive effect on the flavor of fairy beans. Therefore, the present invention selects yeast strain YE006 for subsequent fairy beans brewing experiments.

[0068] Table 2 Results of volatile flavor substances produced in yeast fermentation products

[0069]

[0070] Note: ND means not detected.

[0071] 3. Strain identification

[0072] (1) Morphological observation

[0073] Yeast strain YE006 was inoculated on PDA medium and the colony characteristics were observed. Figure 2 As shown in (A), after 3 days of culture in PDA medium, the colony surface was smooth, slightly convex in the middle, with rounded edges, uniform milky white color, uniform texture, and easy to pick up with sticky texture. Figure 2 As shown in (B), under an optical microscope, YE006 cells are approximately 2 to 5 μm in width (diameter) and 3 to 10 μm in length. They are oval, elliptical, and cylindrical, and may be single, double, or multiple.

[0074] (2) Molecular identification

[0075] The DNA of yeast YE006 was extracted using the Ezup column yeast genomic DNA extraction kit (purchased from Shanghai Bioengineering Co., Ltd.), and the ITS gene sequence of the strain was amplified by PCR using universal primers ITS1 and ITS4. The PCR product was purified using the EZ-10 column PCR product purification kit (purchased from Shanghai Bioengineering Co., Ltd.) and then sequenced.

[0076] The sequence of ITS1 is shown in SEQ ID No. 1: 5′-TCCGTAGGTGAACCTGCG-3′;

[0077] The sequence of ITS4 is shown in SEQ ID No. 2: 5′-TCCTCCGCTTATTGATATGC-3′;

[0078] The DNA sequence of yeast strain YE006 is shown in SEQ ID No.3:

[0079] TTCCGTAGGTGAACCTGCGGAAGGATCATTATAGTATTCTATTGCCAGCGC

[0080] TTAATTGCGCGGCGATAAACCTTACACACATTGTCTAGTTTTTTTGAACTTT

[0081] GCTTTGGGTGGTGAGCCTGGCTTACTGCCCAAAGGTCTAAACACATTTTTTT

[0082] TAATGTTAAAACCTTTAACCAATAGTCATGAAAATTTTTAACAAAAATTAA

[0083] AATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCAACGATGAAG

[0084] AACGCAGCGAAATGCGATACGTATTGTGAATTGCAGATTTTCGTGAATCAT

[0085] CGAATCTTTGAACGCACATTGCACCCTCTGGTATTCCAGAGGGTATGCCTG

[0086] TTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACT

[0087] CTGTCAAGGGTTAACTTGAAATATTGACTTAGCAAGAGTGTACTAATAAGC

[0088] AGTCTTTCTGAAAATAATGTATTAGGTTCTCCAACTCGTTATATCAGCTAGG

[0089] CAGGTTTAGAAGTATTTTAGGCTCGGCTTAACAACAATAAACTAAAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAA.

[0090] The sequencing results were submitted to GenBank for BLAST analysis. ClustalX 1.8 was used to align the model strain and test strain sequences downloaded from the GenBank database, and BioEdit was used to manually delete the uneven sequences at both ends. The phylogenetic tree was then constructed using Mega 11.0 software, and 1000 bootstraps tests were performed to calculate the support rate.

[0091] The results are as follows Figure 3 As shown, the ITS sequence of yeast strain YE006 has the highest homology (100%) with the ITS sequence of Wickerhamomyces anomalus. Combining morphology and molecular biology, yeast strain YE006 was identified as Wickerhamomyces anomalus.

[0092] Example 2: Obtaining excellent Bacillus

[0093] 1. Strain screening

[0094] Weigh 10g of fairy beans samples from different sources and add them to a triangular flask filled with 90mL of sterile water, shake at 180r / min for 20min, and dilute them 10 times in a water bath at 80℃ for 10min. Take different gradient dilutions and spread them on the Bacillus plate separation medium. After culturing at 37℃ for 24h, pick out colonies with different morphologies and obvious hydrolysis transparent circles, purify them and inoculate them on the Bacillus slant medium and store them in a refrigerator at 4℃ for standby use. Select 2 rings of bacterial moss on the slant medium and inoculate them into the Bacillus liquid seed medium. After culturing at 37℃ and 180r / min for 24h, obtain the seed liquid. According to the 2% inoculation amount, they are respectively inoculated into the soaked, steamed and cooled soybeans, stirred well and placed in a 30℃ incubator for fermentation for 72h. 10g of fairy beans fermented by different strains were added to 200mL PBS buffer, extracted at 4℃ for 24h, filtered through double-layer gauze, and the filtrate was centrifuged at 4℃ and 5000r / min for 20min to obtain the supernatant for enzyme activity analysis. Plasmin is a protein hydrolase that specifically degrades fibrin gel. Under certain conditions, the higher the activity of plasmin, the faster its catalytic conversion rate. After plate separation and culture, 6 strains with larger hydrolysis transparent zone diameters were screened out, and the supernatant crude enzyme solution was taken to determine the plasmin activity. The screening results are shown in Figure 4 It can be seen that the SXD06 strain has the highest enzyme production capacity, and its fibrinolytic enzyme activity reaches 2843 IU / g after 24 hours of fermentation. Therefore, the SXD06 strain was selected as a high-producing fibrinolytic enzyme strain for identification.

[0095] 2. Strain morphology and physiological and biochemical identification

[0096] The strain SXD06 with the highest enzyme activity was subjected to Gram staining to observe the bacterial morphology. Figure 5 (a) It can be seen that the colonies of SXD06 form small round, concave, sticky colonies on solid plates, and transparent circles on casein plates. They are milky white in color, with regular edges, dull, slightly raised, and opaque. The colony diameter is 2.0 to 2.8 mm. The strain was identified as a Gram-positive bacterium by staining. The cells are rod-shaped and arranged singly, in pairs or chains. The spores are mesial or submesial. It is preliminarily judged to be Bacillus. The bacterial morphology under the microscope is shown in Figure 5 (b).

[0097] The strain was subjected to physiological and biochemical identification tests such as contact enzyme test, VP test, anaerobic growth, starch hydrolysis test, and sugar fermentation test. The identification results are shown in Table 3. The results of contact enzyme and VP tests were positive. The anaerobic test was negative, and the strain could not ferment sorbose, rhamnose, galactose, lactose, xylitol, and rock sugar. The SXD06 strain was preliminarily determined to be Bacillus subtilis.

[0098] Table 3 Physiological and biochemical identification results of SXD06 strain

[0099]

[0100]

[0101] Note: + represents positive, - represents negative.

[0102] 3. Molecular biological identification of strains

[0103] The DNA of SXD06 strain was extracted by Ezup column bacterial genomic DNA extraction kit (purchased from Shanghai Shenggong Company), and the 16S rDNA sequence of the strain was amplified by PCR using primers Eu27F and 1492R. The PCR product was purified by EZ-10 column PCR product purification kit (purchased from Shanghai Shenggong Company) and then sequenced. The sequencing results were submitted to GenBank for BLAST analysis. The analysis results showed that the gene had a 100% similarity with the 16S rDNA gene of Bacillus subtilis.

[0104] The sequence of Eu27F is shown in SEQ ID No. 4: 5′-AGAGTTTGATCATGGCTCAG-3′;

[0105] The 1492R sequence is shown in SEQ ID No. 5: 5'-TACGGCTACCTTGTTACGACTT-3'.

[0106] Clustal X 1.8 was used to align the sequences of the model strain and the test strain in the GenBank database (Aligment), and the sequences with uneven ends were manually deleted using BioEdit. Then, the phylogenetic tree was constructed using Mega 11 software. The results are shown in the figure. Figure 6 Phylogenetic analysis results showed that strain SXD06 was in the same branch as Bacillus subtillis. Combined with the previous morphological and physiological and biochemical identification results, strain SXD06 was finally identified as Bacillus subtillis.

[0107] Embodiment 3: Magic Bean Fermentation Process

[0108] 1. Fermentation process steps of fairy beans

[0109] S1: Ingredients and pretreatment. Select commercially available soybeans with full, uniform grains and light yellow color, wash them and immerse them in 4 times the volume of water at 4℃ for 24h;

[0110] S2: Steaming. Take out the soaked soybeans and steam them in a steamer for 60 minutes;

[0111] S3: Inoculation. After the cooked beans are cooled naturally, a certain amount of yeast YE006 and Bacillus SXD06 are inoculated, mixed and placed under a certain temperature for fermentation to obtain magic beans.

[0112] 2. Sensory evaluation of the brewing process of fairy beans

[0113] The brewed fairy beans were subjected to sensory evaluation. The sensory scoring criteria are shown in Table 4, and the average score was taken as the final score of the single-factor experimental sensory evaluation.

[0114] Table 4 Sensory evaluation scoring criteria

[0115]

[0116] According to the fuzzy transformation principle, a fuzzy matrix Aj from W to ω is established for each evaluated factor, and a relatively accurate comprehensive evaluation result for each product can be obtained.

[0117]

[0118] In the above formula, j = 1, 2, 3, 4 represents the sample number; i = 1, 2, 3, 4 represents the quality evaluation factor; ri1, ri2, ri3, ri4 respectively represent the membership of the i-th evaluation factor to each comment. The calculation result B = X × A, where X is the weight set and B is the fuzzy matrix. The comprehensive evaluation result is calculated as: ω score × ω evaluation times, and the final value is the comprehensive score of each product.

[0119] 3. Single factor influence experiment on the brewing process of fairy beans

[0120] Effect of different inoculation amounts of Bacillus SXD06 on the brewing of fairy beans: Based on the brewing method of fairy beans in this example, 1%, 1.5%, 2%, 2.5%, 3%, and 3.5% (w / v) of Bacillus SXD06 seed liquid were inoculated into the steamed and cooled soybeans, respectively, and placed at 30°C for fermentation for 3 days, the amino nitrogen content was determined, and sensory evaluation was performed. Figure 7 (a) It can be seen that when the inoculation amount is 1.5%, the amino nitrogen content reaches the peak value and the sensory evaluation score is the highest. Therefore, the optimal inoculation amount of Bacillus SXD06 is determined to be 1.5%.

[0121] Effects of different inoculation amounts of yeast YE006 on the brewing of fairy beans: Based on the optimal inoculation amount of Bacillus SXD06 obtained in this example, 3.5%, 4%, 4.5%, 5%, 5.5%, and 6% (w / v) of yeast seed liquid of yeast YE006 were inoculated, placed at 30°C for fermentation for 3 days, and the amino nitrogen content was determined and sensory evaluation was performed. Figure 7(b) It can be seen that as the inoculation amount of yeast YE006 increases, the ammonia smell in the fairy beans gradually decreases. When the inoculation amount reaches 4%, the ammonia smell is not obvious and the amino nitrogen content does not change significantly. As the inoculation amount continues to increase, the amino nitrogen content gradually decreases. The optimal inoculation amount of yeast YE006 is determined to be 4%.

[0122] Effect of different temperatures on the brewing of fairy beans: Based on the optimal inoculation amount of Bacillus SXD06 and yeast YE006 obtained in this example, the fermentation was carried out at 26°C, 28°C, 30°C, 32°C, 34°C, and 36°C for 3 days, and the samples were used to determine the amino nitrogen content and conduct sensory evaluation. Figure 7 (c) It can be seen that under the conditions of optimal Bacillus and aroma-producing yeast inoculation amounts, the amount of amino acid nitrogen in the fairy beans increased with the increase of fermentation temperature, reaching a maximum value at 34°C, with the highest sensory score, and then began to decline. The optimal fermentation temperature was determined to be 34°C.

[0123] Effect of different fermentation times on the brewing of fairy beans: Based on the inoculation amount of Bacillus SXD06, the inoculation amount of yeast YE006 and the optimal brewing temperature obtained in this example, the fermentation was allowed to stand for 48h, 60h, 72h, 84h, 96h and 108h respectively. The samples were used to determine the amino nitrogen content and conduct sensory evaluation. Figure 7 (d) It can be seen that the amount of amino acid nitrogen and sensory score in the fairy beans reached the maximum value when the fermentation time was 84h, which was determined to be the optimal fermentation time.

[0124] 4. Construction of the fermentation model of fairy beans

[0125] The results of the single-factor experiment were comprehensively analyzed, and the inoculum amount of Bacillus SXD06 (A), yeast YE006 (B), fermentation temperature (C) and fermentation time (D) were selected as the fermentation factor levels. The CCD model in Design Expert 13 software was used, and the sensory evaluation of fairy beans (R1) was used as the response value to design an experiment with 4 factors and 5 levels, as shown in Table 5. The final model was subjected to variance analysis, and multiple parallel experiments were performed to verify the experimental results, and the optimal fermentation process was obtained.

[0126] Table 5 CCD analysis test factor level table

[0127]

[0128]

[0129] The sensory score (Y) regression equation obtained by secondary analysis of the evaluation scores is as follows:

[0130] Y=87.67-1.50×A-1.83×B+0.50×C+0.67D-0.25×AB+1.50×AC-1.38×AD+1.75×BC+0.63×BD+2.13×CD-0.15×A2-1.40×B2-2.15×C2-3.52×D2

[0131] The regression model was subjected to a significant data test variance analysis, as shown in Table 6. The results show that the regression model F = 23.53, p < 0.01, that is, the model is extremely significant. At the same time, the lack of fit term p = 0.2400> 5%, that is, the lack of fit term test is not significant, and the fitting difference between the model prediction value and the actual value is relatively small. The regression equation coefficient R 2 =0.9564, the adjusted coefficient of determination is R 2 A dj =0.9158, indicating that the model has a high degree of fit with the experiment, and can be used to analyze and predict the sensory evaluation results of fairy beans. As can be seen from Table 6, the quadratic term B 2 , C 2 , D 2 , AC, AD, and BC are extremely significant, that is, the quadratic response value has a significant impact on the test results, and it is not a single linear influence relationship.

[0132] Table 6 Analysis of variance of regression model

[0133]

[0134]

[0135] The response surface diagram is as follows Figure 8 As shown in (a) and (f), it can be seen that Figure 8 (f) The response surface has a large curvature, indicating that the interaction between fermentation temperature and fermentation time has a significant effect on the sensory evaluation of fairy beans; followed by Figure 8 (e) The response surface is relatively curved, and the interaction between the inoculation amount of yeast YE006 and the fermentation time has a significant effect on the sensory evaluation of fairy beans. The interaction between the two factors shown in the other curves has no significant effect on the sensory score of fairy beans.

[0136] Verification test: According to the response surface analysis of Design-Expert 13 software, the optimal fermentation conditions of fairy beans can be obtained from the regression model as Bacillus SXD06 inoculation amount of 1.1%, yeast YE006 inoculation amount of 4.2%, fermentation temperature of 34℃, and fermentation time of 84.2h. The final score of the preliminary prediction of sensory score is 91.5 points. After repeating the verification test 3 times, the average score of sensory evaluation is 90.65±1.66 points, which is close to the model prediction value, with a high degree of fit, and the parameters are reasonable and effective.

[0137] 5. SDS-polyacrylamide gel electrophoresis

[0138] Weigh 5 g of fermented mature fairy beans, grind them under liquid nitrogen protection, make the volume to 100 mL with deionized water, treat them ultrasonically for 10 min, and then centrifuge them at 10000 r / min for 5 min to obtain the supernatant. Take 20 μL of the supernatant and add an equal amount of 2×SDS loading buffer, then boil it in a boiling water bath for 5 min to obtain the sample. Take 10 μL of the sample for SDS-polyacrylamide gel electrophoresis (SDS-PAGE) detection, and the same batch of steamed soybeans is used as the control group.

[0139] Fig. 9 These are the SDS-PAGE electrophoresis pictures of the control group and the experimental group. From left to right, the lanes are Marker, unfermented soybeans, and fairy beans. By comparing the protein bands, it was found that compared with the control group, the total number of bands in the experimental group lanes was less and the bands were thinner, indicating that in the process of preparing fairy beans, most of the protein in soybeans has been converted into amino acids, and the quality of fairy beans is better.

[0140] Embodiment 4: Magic Bean Product Preparation Process

[0141] 1. Preparation method of fairy bean products

[0142] Fig.10 The preparation flow chart of the fairy bean product is as follows: Fig.10 As shown, the magic beans prepared in Example 3 are evenly mixed with a certain mass of edible salt, chili powder, star anise powder, cinnamon, bay leaves, and edible alcohol to obtain a magic bean product.

[0143] 2. Sensory evaluation of fairy beans products

[0144] The sensory evaluation of the blending process of the fairy bean product was carried out. The sensory evaluation criteria are shown in Table 7. The average score of the sensory scores of the reviewers was used as the final score of the sensory evaluation in the single-factor experiment.

[0145] Table 7 Sensory scoring standards for fairy beans products

[0146]

[0147] 3. Single factor influence experiment on the preparation process of fairy beans

[0148] Effect of different amounts of edible salt added on the quality of fairy beans: 2%, 4%, 6%, 8%, 10%, and 12% edible salt were added to the fairy beans prepared in Example 3, and after mixing, samples were obtained for determination of amino nitrogen content and sensory evaluation. Fig.11 As shown in (a), when the salt addition amount is 6%, the flavor of the fairy bean product is the best.

[0149] Effect of different amounts of star anise on the quality of fairy beans: Based on the optimal amount of edible salt added in Example 4, 0.0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of star anise were added respectively. After mixing, samples were obtained for determination of amino nitrogen content and sensory evaluation. Fig.11 As shown in (b), when the star anise addition amount is 0.3%, the flavor of the fairy bean product is the best.

[0150] Effect of different cinnamon addition amounts on the quality of fairy beans: Based on the optimal salt and star anise addition amounts obtained in Example 4, 0.0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% cinnamon were added respectively, and after mixing, samples were obtained for determination of amino nitrogen content and sensory evaluation. Fig.11 As shown in (c), when the cinnamon addition amount is 0.2%, the flavor of the fairy bean product is the best.

[0151] Effect of different amounts of chili added on the quality of fairy beans: The experiment was based on the optimal amount of edible salt, star anise, and cinnamon added in Example 4, and 0%, 1%, 2%, 3%, 4%, and 5% chili were added respectively. After mixing, samples were obtained for determination of amino nitrogen content and sensory evaluation. Fig.11 As shown in (d), when the amount of chili powder added is 2%, the flavor of the fairy bean product is the best.

[0152] Effect of different amounts of finished edible alcohol on the quality of fairy beans: Based on the optimal amounts of edible salt, star anise, cinnamon and chili obtained in Example 4, 0%, 2%, 4%, 6%, 8% and 10% edible alcohol were added respectively. After mixing, samples were obtained for determination of amino nitrogen content and sensory evaluation. Fig.11 As shown in (e), compared with the control group (the amount of edible alcohol added was 0%), the flavor of the fairy bean product was the best when the amount of edible alcohol added was 4%.

[0153] Effect of different amounts of bay leaves on the quality of fairy beans: Based on the optimal amount of edible salt, star anise, cinnamon, chili and edible alcohol obtained in Example 4, 0.0%, 0.2%, 0.4%, 0.6%, 0.8% and 1.0% of bay leaves were added respectively, and after mixing, samples were obtained for determination of amino nitrogen content and sensory evaluation. Fig.11 As shown in (f), compared with the control group (the amount of bay leaves added was 0%), the flavor of the fairy bean product was the best when the amount of bay leaves added was 2%.

[0154] 4. Construction of the product formulation model of Shenxiandou

[0155] The results of the single-factor experiment were comprehensively analyzed, and the addition of edible salt (A), star anise (B), cinnamon (C), chili (D), edible alcohol (E) and bay leaf (F) were selected as the blending factor levels. The CCD model in DesignExpert 13 software was used, and the sensory evaluation of the fairy bean product (R1) was used as the response value to design an experiment with 6 factors and 5 levels, as shown in Table 8. The final model was subjected to variance analysis, and multiple parallel experiments were performed to verify the experimental results, and the optimal blending process was obtained.

[0156] Table 8 CCD analysis test factor level table

[0157]

[0158]

[0159] The secondary analysis of sensory scores (Y) resulted in the following regression equation:

[0160] Y=84.27-3.71A+0.82B+4.41C-2.92D+5.67E+1.85F-0.23AB-5.14AC+5.47AD-6.45AE-2.60AF+2.44BC-1.07BD-38B E-1.19BF-4.28CD+3.70CE+1.46CF-4.62DE-5.17DF-6.43EF-12.41A2-12.52B2-13.04C2-16.11D2-7.71E2-1.94F2

[0161] The results of the variance analysis of the regression model are shown in Table 9. The analysis results show that the regression model F = 7.16, p < 0.01, that is, the model is extremely significant. 2 =0.9902, and the adjusted coefficient of determination is R 2 Adj =0.9710, which means that the model has a high degree of fit with the test results and can be used to analyze and predict the evaluation results. 2 , B 2 , C 2 , D 2 Very significant, E 2 Significant, that is, the quadratic response value has a significant impact on the test results, not a single linear influence relationship.

[0162] Table 9 Analysis of variance of the blending process regression model

[0163]

[0164]

[0165] The response surface diagram is a three-dimensional surface diagram composed of the response value and any two experimental factors; it reflects the curve diagram of the six experimental factors of edible salt, star anise powder, cinnamon, chili powder, edible alcohol, and bay leaf addition with sensory scores as response values, such as Figure 12 to Figure 14 As shown. Figure 12 to Figure 14 From the response surface in the figure, we can see that if the opening direction of the response surface 3D graph is downward, it means that within a certain range, each factor is proportional to the response value; when the maximum response value is reached, each factor is inversely proportional to the response value. Fig.13 The curve of (a) has the largest curvature, indicating that the interaction between the amount of chili added and the amount of star anise added has a very significant effect on the sensory evaluation of the fairy bean product. Fig.12 (a) Fig.12 (b) Fig.12 (c) Fig.12 (e) Fig.12 (f) Fig.13 (b) Fig.13 (c) Fig.13 (d) Fig.13 (e) Fig.13 (f) and Fig.14 The curve of (a) is relatively curved, indicating that the interaction between the amount of edible salt added and the amount of star anise, the amount of edible salt added and the amount of cinnamon, the amount of edible salt added and the amount of chili, the amount of star anise added and the amount of cinnamon, the amount of edible salt added and the amount of bay leaf added, the amount of star anise added and the amount of edible alcohol added, the amount of star anise added and the amount of bay leaf added, the amount of cinnamon added and the amount of chili added, the amount of cinnamon added and the amount of edible alcohol added, the amount of bay leaf added and the amount of cinnamon added, and the amount of edible alcohol added and the amount of chili added have a more obvious effect on the sensory evaluation of the fairy bean product. The interaction between the two factors shown in the rest is not significant.

[0166] Verification test: Through the optimization analysis of mathematical models, the best process was obtained, which was 5.5% salt, 0.26% star anise powder, 0.25% cinnamon, 1.5% chili powder, 4.5% edible alcohol, and 0.28% bay leaf. The final score of the preliminary prediction of sensory score was 96.99 points. After repeated tests for 3 times, the average score was 96.65±0.56 points, which was very close to the model prediction value, with a high degree of fit, reasonable parameters, and true and effective.

[0167] In summary, the present invention obtains an abnormal Wickham yeast strain YE006 with the functions of reducing ammonia odor, producing ester, producing alcohol and enhancing aroma by separating and screening from brewer's grains; the abnormal Wickham yeast strain YE006 is added to food fermentation, and the fermented strain can significantly reduce the ammonia odor generated in food fermentation; the abnormal Wickham yeast strain YE006, Bacillus subtilis SXD06 and steamed and cooled soybeans are mixed and fermented to obtain a fairy bean; the fermentation conditions and the preparation process of the fairy bean are optimized by using the response surface to obtain a fairy bean product without obvious ammonia odor, which solves the problems of obvious ammonia odor, low production efficiency and poor quality stability of the current fairy bean, and provides reliable technical support for the production of high-quality fairy bean products.

[0168] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. An abnormal Wickham yeast strain YE006, characterized in that: The strain is a Wickerhamomyces anomalus strain, which is deposited in China Center for Type Culture Collection with a deposit number of CCTCC NO: M20242319.

2. A fermentation method of the abnormal Wickham yeast strain YE006 according to claim 1, characterized in that: The following steps are involved: The abnormal Wickham yeast strain YE006 was transferred to a yeast liquid seed culture medium, cultured at 28-32° C. and 180 r / min for 24-72 h, and the fermentation broth was collected.

3. A fermentation liquid obtained by the fermentation method of abnormal Wickham yeast strain YE006 according to claim 2.

4. A bacterial agent, characterized in that The active ingredient of the bacterial agent includes the abnormal Wickham yeast strain YE006 described in claim 1 or the fermentation broth described in claim 3.

5. Use of the abnormal Wickham yeast strain YE006 according to claim 1 or the fermentation liquid of the abnormal Wickham yeast strain YE006 according to claim 3 or the bacterial agent according to claim 4 in producing ester substances or alcohol substances.

6. The use according to claim 5, characterized in that: The ester substance is any one or more of ethyl acetate, ethyl lactate and phenylethyl acetate, and the alcohol substance is any one or more of glycerol, isopentanol, 2,3-butanediol and phenylethyl alcohol.

7. The use according to claim 5, characterized in that: The abnormal Wickham yeast strain YE006 or the fermentation liquid of the abnormal Wickham yeast strain YE006 or the bacterial agent is used for reducing ammonia odor in food fermentation.

8. A fairy bean, characterized in that: The yeast is obtained by adding the abnormal Wickham yeast strain YE006 described in claim 1 during soybean fermentation.

9. The fairy beans according to claim 8, characterized in that: Bacillus subtillis SXD06 is also added in the soybean fermentation process. The Bacillus subtillis SXD06 is preserved in the China Center for Type Culture Collection with a preservation number of CCTCC NO: M 20242318.

10. The magic bean according to claim 9, characterized in that: The fairy beans are used to prepare fairy beans products, and the fairy beans products are obtained by the following preparation method: Inoculate soybeans with Bacillus subtilis SXD06 at an inoculation rate of 1.1-3.5% and abnormal Wickham yeast strain YE006 at an inoculation rate of 3.5-6%, and ferment at a temperature of 26-36° C. for 48-108 hours to obtain the fairy beans; Then the magic beans, edible salt, chili powder, star anise powder, cinnamon, bay leaves and edible alcohol are mixed in a mass ratio of 71-98%: 2-12%: 0-5%: 0-0.5%: 0-0.5%: 0-1%: 0-10% to obtain a magic bean product.

Images