A mixed microbial agent and its application in alleviating tobacco continuous cropping obstacles and promoting growth

Abstract

The invention relates to the technical field of bio-utilization, in particular to a mixed microbial agent and application thereof in alleviating tobacco continuous cropping obstacles and promoting growth; the mixed microbial agent consists of Pseudomonas koreensis and Aerococcus urinaeequi; the mixed microbial strain used in the invention is separated and extracted from the rhizosphere of a tobacco CrRLK47 mutant, and then used in tobacco planting, and according to the homology of the microorganisms, effectively improves the physical and chemical properties of the soil, reduces the occurrence of diseases and insect pests, and enhances the disease resistance of plants, thereby alleviating the obstacle problem of tobacco continuous cropping; at the same time, the mixed microbial strain used in the invention directly acts on tobacco planting, and retains the activity of the strain to the maximum extent, and it is found through repeated experiments that the mixed microbial strain can alleviate the continuous cropping obstacles and has a positive effect of promoting tobacco growth.

Description

Technical Field

[0001] The invention relates to the technical field of biological utilization, in particular to a mixed microbial agent and application thereof in alleviating tobacco continuous cropping obstacles and promoting growth. Background Art

[0002] Due to the limited arable land area and the reduction in the amount of new arable land, continuous cropping has become the most common planting pattern in intensive and large-scale agriculture. Long-term continuous cropping will lead to a series of problems such as deterioration of soil physical and chemical properties, reduction of soil enzyme activity, accumulation of self-toxic substances, and changes in microbial communities. The tobacco planting area in my country is 12-15 million mu per year, and continuous cropping has had a serious impact on agricultural production, including tobacco.

[0003] Microorganisms are the most active and sensitive components of soil and play a vital role in agricultural systems by maintaining soil health and sustainability. The largest and most diverse microbial group per gram of soil is bacteria, with an estimated 10 to 10 billion cells and 6 × 103 to 5 × 104 bacterial species. Soil bacterial communities play a vital role in the occurrence of crop diseases. Previous studies have shown that soil bacteria are affected by a variety of factors, such as agricultural management practices (e.g., fertilization and crop rotation), crop types, and soil types. Tobacco continuous cropping changes the biomass and diversity of soil microorganisms and is the main cause of continuous cropping problems. So far, the response to continuous cropping problems has been mainly carried out from three aspects: biological, chemical, and agricultural measures. Biological control mainly uses the ability of long-term continuous cropping of tobacco to recruit self-toxic substance-degrading microorganisms to alleviate continuous cropping problems by degrading self-toxic substances; the chemical aspect mainly develops functional organic fertilizers (FOFs) to alleviate tobacco continuous cropping problems by improving soil physical and chemical properties and bacterial community structure; agricultural measures include breeding and cultivation of disease-resistant varieties, reasonable crop rotation, supplementary fertilizers, and strengthening field management. Among them, biological control is an important technical measure to prevent and control continuous cropping problems. Compared with other control methods, biological control can not only improve soil physical and chemical properties, reduce the occurrence of pests and diseases, and enhance plant disease resistance, but also promote crop growth and improve fruit quality and yield. However, there are still many problems with biological control, including the incomplete understanding of the pathogenic mechanism of microorganisms, insufficient monitoring of the dynamic changes of soil microbial communities, and immature application technology of microbial preparations. Therefore, from the perspective of green and sustainable agricultural development, finding an efficient and green biological method to deal with continuous cropping problems and promote tobacco growth has become a difficult problem that researchers urgently need to solve. Summary of the invention

[0004] The purpose of the present invention is to provide a mixed microbial agent and its application in alleviating tobacco continuous cropping obstacles and promoting growth. The biological agent can improve the physical and chemical properties of soil, reduce the occurrence of diseases and insect pests, alleviate the obstacles to tobacco continuous cropping, and significantly promote tobacco growth.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] A mixed microbial agent is prepared by mixing Pseudomonas koreensis and Aerococcus urinaeequi in a volume ratio of 1:0.3-1.2.

[0007] Furthermore, the mixed microbial agent is composed of Pseudomonas koreensis and Aerococcusurinaeequi mixed in a volume ratio of 1:1.

[0008] Furthermore, the Pseudomonas koreensis is a Gram-negative bacterium without spores. The bacterial body is rod-shaped or slightly curved, with a size of about (0.7-1.1)×(2.0-4.0) microns and flagella. Its colony morphology is characterized by white round opaque colonies with a smooth surface and relatively neat edges.

[0009] Furthermore, the 16SrDNA sequence of the above-mentioned Pseudomonas koreensis is shown in SEQ ID NO.1:

[0010]

[0011] Furthermore, the Aerococcus urinaeequi is a Gram-positive coccus without capsule and spores, usually arranged in quadruplets or clumps, and sometimes arranged in pairs; its colony morphology is characterized by a colony size of about 2-3 cm, grayish yellow, moist, round, with a central bulge, opaque, and neat edges, and its morphological characteristic is that the colonies are round.

[0012] Furthermore, the 16SrDNA sequence of the above-mentioned Aerococcus urinaeequi is shown in SEQ ID NO.2:

[0013] TTACCTCACCGACTTCGGGTGTTACAAACTCTCGTGGTGTGACGGGC

[0014] GGTGTGTACAAGACCCGGGAACGTATTCACCGTGGCGTGCTGATCCACG

[0015]

[0016] Furthermore, the Pseudomonas koreensis and Aerococcus urinaeequi were both isolated from the rhizosphere of tobacco CrRLK47 mutant.

[0017] Further, the OD600 value of Pseudomonas koreensis is 0.1;

[0018] Further, the OD600 value of the Aerococcus urinaeequi is 0.1;

[0019] Furthermore, the preparation method of the mixed microbial agent includes the following method:

[0020] 1) Place the rhizosphere of the CrRLK47 mutant tobacco seedlings in a 50 mL centrifuge tube containing 15-25 mL of sterile PBS buffer and shake on a shaker for 30 min;

[0021] 2) Take out the rhizosphere, and the remaining liquid is the rhizosphere sample;

[0022] 3) Take the rhizosphere sample and add it into sterile PBS solution, and the gradient dilution is recorded as 10 -1 , diluted to 10 -3 , 10 -4 , 10 -5 Three gradients, take 100 ml of these three gradient dilutions and spread them on a 9 cm culture dish, and use TSB medium to isolate bacteria;

[0023] 4) Cultivate in a constant temperature incubator at 28°C, and after 2, 4, 7, and 14 days of cultivation, pick a single colony or a single clone according to the target colony morphology to obtain the target strain;

[0024] 5) The separated single target strains are directly mixed to obtain a mixed microbial agent.

[0025] Furthermore, the shaking table oscillates at a rotation speed of 150-250 rpm.

[0026] Furthermore, in step 3), the volume ratio of the rhizosphere sample to the sterile PBS solution is 0.8-1.2:7-11.

[0027] Furthermore, the mixed microbial agent is used in alleviating tobacco continuous cropping obstacles.

[0028] Furthermore, the mixed microbial agent is used to promote tobacco growth.

[0029] Bacterial identification: Take 20 bacterial liquids from the 96-well plate and use a kit (Tiangen, DP302) to extract genomic DNA. In order to improve the identification efficiency and reduce the sequencing cost, 96 pairs of barcodes were designed using the BARCOSEL high-throughput barcode (barcodé) software to distinguish different bacterial strains. The designed 96 pairs of barcodes were connected to the 5 ends of the primers for amplification of the V4 region of 16SrDNA, where the barcode connected to the forward primer was used to distinguish the position of the wells in the 96-well plate, and the barcode of the reverse primer was used to distinguish different 96-well plates. The genomic DNA of each well was PCR amplified with the corresponding primers, and the PCR products were tested for successful amplification by 1% agarose electrophoresis. The PCR products of each row of wells (12) were equally divided and mixed into 1 mixed solution, and the PCR products were recovered using an agarose gel DNA recovery kit and sent to the sequencing company for I1lumina sequencing. The sequencing results were removed from duplicate strains according to the barcode information of the primers, and the remaining sample sequences were aligned to the 16SDNA database for species annotation;

[0030] Furthermore, the DNA kit is model DP302 and the manufacturer is Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0031] Further, the BARCOSEL high-throughput barcode software is available at: http: / /

[0032] / / ekhidna2.biocenter.helsinki.fi / barcosel. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Isolation and identification of Pseudomonas koreensis and Aerococcus urinaeequi; Pseudomonas koreensis and Aerococcus urinaeequi strains were isolated from the rhizosphere of tobacco CrRLK47 mutant.

[0034] Figure 2 Phenotypic analysis of Pseudomonas koreensis and Aerococcus urinaeequi in promoting tobacco growth; the mixed microbial agent composed of Pseudomonas koreensis and Aerococcus urinaeequi can effectively alleviate continuous cropping obstacles and promote tobacco growth.

[0035] Beneficial Effects

[0036] 1. The mixed microbial strain used in the present invention is isolated and extracted from the rhizosphere of the tobacco CrRLK47 mutant, and then used for tobacco planting. According to the homology of the microorganisms, it can effectively improve the physical and chemical properties of the soil, reduce the occurrence of diseases and insect pests, and enhance plant disease resistance, thereby alleviating the obstacles to continuous tobacco cropping.

[0037] 2. At the same time, the mixed microbial strains used in the present invention directly act on tobacco planting, retaining the activity of the strains to the maximum extent. Through repeated experiments, it was found that the mixed microbial strains have a positive effect of promoting tobacco growth;

[0038] On the other hand, the isolated and extracted strains can be used directly, which is highly operational, not affected by geographical and environmental conditions, easy to operate, avoids post-processing methods such as fermentation, and saves costs. DETAILED DESCRIPTION

[0039] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0040] Example 1

[0041] The rhizosphere of CrRLK47 mutant tobacco seedlings was placed in a 50 mL centrifuge tube containing 20 mL sterile PBS buffer and shaken at 200 rpm for 30 min. The rhizosphere was taken out and the remaining liquid was the rhizosphere sample. The rhizosphere sample was added to the sterile PBS solution, and the volume ratio of the rhizosphere sample to the sterile PBS solution was 1:9. The second gradient dilution was recorded as 10 -1 , diluted to 10 -3 , 10 -4 , 10 -5 Three gradients, 100 ml of these three gradient dilutions were spread on a 9 cm culture dish, and the bacteria were isolated using TSB medium; cultured in a 28°C constant temperature incubator, and after 2d, 4d, 7d and 14d of culture, single colonies or single clones were picked according to the target colony morphology to obtain the target strain;

[0042] The above separation method is used to separate Pseudomonas koreensis according to the characteristics of the Pseudomonas koreensis strain.

[0043] Example 2

[0044] Referring to the separation method of Example 1, Aerococcus urinaeequi was isolated and obtained according to the characteristics of the Aerococcus urinaeequi strain using the above separation method.

[0045] Example 3

[0046] Referring to the separation method of Example 1, the above separation method was used to separate and pick Pseudomonas koreensis and Aerococcus urinaeequi according to the properties of the strains. The OD600 values ​​of both strains were adjusted to 0.1 and then directly mixed in a volume ratio of 1:1 to obtain a mixed microbial agent.

[0047] Example 4

[0048] 1) The rhizosphere of the CrRLK47 mutant tobacco seedlings was placed in a 50 mL centrifuge tube containing 15 mL of sterile PBS buffer and shaken at 150 rpm for 30 min;

[0049] 2) Take out the rhizosphere, and the remaining liquid is the rhizosphere sample;

[0050] 3) Take the rhizosphere sample and add it into the sterile PBS solution. The volume ratio of the rhizosphere sample to the sterile PBS solution is 0.8:7. The second gradient dilution is recorded as 10 -1 , diluted to 10 -3 , 10 -4 , 10 -5 Three gradients, take 100 ml of these three gradient dilutions and spread them on a 9 cm culture dish, and use TSB medium to isolate bacteria;

[0051] 4) Cultivate in a constant temperature incubator at 28°C, and after cultivation, pick a single colony or a single clone according to the target colony morphology to obtain the target strain;

[0052] 5) After adjusting the OD600 values ​​of the isolated single target strains Pseudomonas koreensis and Aerococcusurinaeequi to 0.1, they were directly mixed at a volume ratio of 1:0.3 to obtain a mixed microbial agent.

[0053] Example 5

[0054] 1) The rhizosphere of the CrRLK47 mutant tobacco seedlings was placed in a 50 mL centrifuge tube containing 25 mL of sterile PBS buffer and shaken at 250 rpm for 30 min;

[0055] 2) Take out the rhizosphere, and the remaining liquid is the rhizosphere sample;

[0056] 3) Take the rhizosphere sample and add it into the sterile PBS solution. The volume ratio of the rhizosphere sample to the sterile PBS solution is 1.2:11. The sub-gradient dilution is recorded as 10 -1 , diluted to 10 -3 , 10 -4 , 10 -5 Three gradients, take 100 ml of these three gradient dilutions and spread them on a 9 cm culture dish, and use TSB medium to isolate bacteria;

[0057] 4) Cultivate in a constant temperature incubator at 28°C, and after cultivation, pick a single colony or a single clone according to the target colony morphology to obtain the target strain;

[0058] 5) After adjusting the OD600 values ​​of the isolated single target strains Pseudomonas koreensis and Aerococcusurinaeequi to 0.1, they were directly mixed at a volume ratio of 1:1.2 to obtain a mixed microbial agent.

[0059] 1. Experiment on mixed strains against continuous cropping obstacles

[0060] 1. Experimental preparation:

[0061] Step 1

[0062] Wild-type Yunyan 87, biological bacterial solution; pipette and matching sterile pipette tip, 50ml centrifuge tube, sterile PBS buffer, continuous crop soil;

[0063] JTLIANGYOU oscillator, manufacturer: Changzhou Jintan Liangyou Instrument Co., Ltd.

[0064] Baird-Parker agar plate, manufacturer: Wuhu Ouk Biotechnology Co., Ltd.

[0065] Tryptic Soybean Broth TSB, Manufacturer: Jiangsu Duanfeng Biotechnology Co., Ltd.

[0066] 9cm diameter nutrient pot, manufacturer: Yutian County Jiujiu Plastic Products Factory

[0067] Step 2

[0068] 1) preparing a biological bacterial solution, namely, the Pseudomonas koreensis bacterial solution of Example 1, the Aerococcus urinaeequi of Example 2, and the mixed bacterial solution of Example 3;

[0069] 2) Sow the wild-type Yunyan 87 in nutrient pots with a diameter of 9 cm, add 110 g of soil to each nutrient pot, and add water to moisten it, then sow a certain amount of wild-type tobacco Yunyan 87 seeds on the surface, place the nutrient pots in a growth room for cultivation, water them regularly, and transplant the tobacco seedlings after 1 week, transplant 8 tobacco plants in each nutrient pot, and let them grow for 1 week;

[0070] 3) Subsequently, Pseudomonas koreensis was cultured in a shaking table overnight, the OD600 value was measured and the OD600 value was adjusted to 0.1 to obtain biological bacterial solution 1, Aerococcus urinaeequi was cultured in a shaking table overnight, the OD600 value was measured and the OD600 value was adjusted to 0.1 to obtain biological bacterial solution 2, and the Pseudomonas koreensis and Aerococcus urinaeequi obtained separately were mixed, and the two microorganisms were evenly mixed. Each tobacco seedling was filled with 10 ml of the mixed bacterial solution, the OD600 value was measured and the OD600 value was adjusted to 0.1 to obtain biological bacterial solution 3;

[0071] 2. Experimental methods (physical and chemical properties of soil):

[0072] The eight tobacco plants transplanted in the above four nutrient pots were transplanted into the same batch of selected continuous cropping soils and divided into four groups. The first group was watered with biological bacterial solution 1; the second group was watered with biological bacterial solution 2; the third group was watered with mixed bacterial solution; the fourth group was watered with ordinary commercial nutrient solution as a control, and the same concentration of bacterial solution was watered again every other week, and the seedlings continued to grow in the growth room. 30 days after the first watering, the physical and chemical properties of the soil after the bacteria were connected were analyzed with those of the control group;

[0073] In this experiment, the dosage and concentration of irrigation in each group of experiments were the same.

[0074] The continuous cropping soil used after transplanting came from the same continuous cropping experimental plot.

[0075] 2.1 Experimental Data

[0076] Table 1

[0077]

[0078] 2.2 Results and Analysis

[0079] The results showed that the soil pH of the soil irrigated with biological bacterial solution 1 was 6.74±0.19, the organic matter content was 34.73±0.53 (g / kg), and the total nutrient content was 419.3±4.57 (mg / kg); the soil pH of the soil irrigated with biological bacterial solution 1 was 6.71±0.21, the organic matter content was 42.94±0.61, and the total nutrient content was 477.5±3.74 (mg / kg); the soil pH of the soil irrigated with mixed bacterial solution was 6.70±0.14, the organic matter content was 56.46±0.76 (g / kg), and the total nutrient content was 573.4±2.49 (mg / kg). g); Compared with the control, there was no significant difference in pH value after irrigation with biological bacterial solution; after irrigation with biological bacterial solution 1, the content of soil organic matter increased by 11.0%-15.9%, after irrigation with biological bacterial solution 2, the content of soil organic matter increased by 37.6%-43.0%, and after irrigation with mixed bacterial solution, the content of soil organic matter increased by 81.2%-87.7%; after irrigation with biological bacterial solution 1, the total nutrient content of soil increased by 20.8%-25.1%, after irrigation with biological bacterial solution 2, the total nutrient content of soil increased by 38.1%-41.9%, and after irrigation with mixed bacterial solution, the total nutrient content of soil increased by 66.5%-69.7%. It shows that after irrigation with biological bacterial solution 1, biological bacterial solution 2 and mixed bacterial solution, the pH value of soil is almost not affected. After irrigation with biological bacterial solution 1 and biological bacterial solution 2, the organic matter content and total nutrient content of soil can be increased, and the improvement effect of irrigation with mixed bacterial solution is the most significant.

[0080] 2. Experiment on promoting tobacco growth by mixed strains

[0081] The eight tobacco plants transplanted in the above four nutrient pots were transplanted into the same batch of selected continuous cropping soils and divided into four groups. The first group was irrigated with biological bacterial solution 1; the second group was irrigated with biological bacterial solution 2; the third group was irrigated with mixed bacterial solution; the fourth group was irrigated with ordinary commercially available nutrient solution as a control, and the same concentration of bacterial solution was irrigated again every other week, and the seedlings continued to grow in the growth room. The growth indicators of Yunyan 87, including the fresh weight of the aboveground and underground parts of the plants, the root length, etc., were observed and recorded 7 days, 14 days and 21 days after the first irrigation, and the bacterial irrigation treatment was compared with the clear water control, and the growth phenotype of the plants after docking with bacteria was analyzed;

[0082] In this experiment, the dosage and concentration of irrigation in each group of experiments were the same.

[0083] The continuous cropping soil used after transplanting came from the same continuous cropping experimental plot.

[0084] 1. Experimental data

[0085] Table 2

[0086]

[0087] 2. Results and analysis: The results showed that the average aboveground fresh weight of the tobacco plants irrigated with biological solution 1 was 1.65 (g / plant), the underground fresh weight was 0.041 (g / plant), and the root length was 7.2 (cm); the average aboveground fresh weight of the tobacco plants irrigated with biological solution 2 was 1.83 (g / plant), the underground fresh weight was 0.054 (g / plant), and the root length was 7.45 (cm); the average aboveground fresh weight of the tobacco plants irrigated with the mixed solution was 2.30 (g / plant), the underground fresh weight was 0.093 (g / plant), and the root length was 7.25 (cm). Compared with the control, there was no significant difference in root length after irrigation with biological solution; after irrigation with biological solution 1, the fresh weight of the aboveground part increased by 43.5%, after irrigation with biological solution 2, the fresh weight of the aboveground part increased by 59.1%, and after irrigation with mixed solution, the fresh weight of the aboveground part increased by 96.5%; after irrigation with biological solution 1, the fresh weight of the underground part increased by 5.1%, after irrigation with biological solution 2, the fresh weight of the underground part increased by 38.4%, and after irrigation with mixed solution, the fresh weight of the underground part increased by 138.4%; after irrigation with biological solution 1, the root length increased by 1.4%, after irrigation with biological solution 2, the root length increased by 4.9%, and after irrigation with mixed solution, the fresh weight of the underground part increased by 2.1%. It shows that there is no significant difference in the change of root length after irrigation with biological solution 1, biological solution 2 and mixed solution. After irrigation with biological solution 1 and biological solution 2, the fresh weight of the aboveground and underground parts can be increased, and the improvement effect of irrigation with mixed solution is the most significant.

[0088] 3. Experiment on the effect of mixed strains in different proportions on resistance to continuous cropping and growth promotion

[0089] The single strains Pseudomonas koreensis and Aerococcusurinaeequi were isolated according to the methods of Examples 1-2, and the two were divided into four experimental groups according to different proportions: experimental group 1, the two strains were mixed in an equal volume ratio; experimental group 2, the two strains were mixed in a volume ratio of 1:0.3; experimental group 3, the two strains were mixed in a volume ratio of 1:0.8; experimental group 4, the two strains were mixed in a volume ratio of 1:1.2;

[0090] According to the requirements of the above experiment "I. Experiment on mixed strains against continuous cropping obstacles", 8 tobacco plants transplanted in four nutrient pots were transplanted into the same batch of selected continuous cropping soils and divided into four groups, corresponding to the above experimental groups 1-4, and each group of tobacco seedlings was regularly sprayed with the mixed strains prepared from the above experimental groups 1-4. After 30 days of observation, the growth of tobacco seedlings and the soil resistance to continuous cropping obstacles were observed, as shown in Tables 3 and 4; 1. Experimental data (physical and chemical properties of soil)

[0091]

[0092] 2. The results showed that after watering the experimental groups 1-4, the biological strain had no significant effect on the pH and bulk density of the soil. After applying mixed strains in different proportions, the organic matter content and total nutrient content increased significantly. However, the organic matter content and total nutrient content of the mixed bacterial solution with equal volume ratios were relatively balanced, which was more in line with the nutrition required for tobacco growth.

[0093] 3. Experimental data (promoting tobacco growth)

[0094] Table 4

[0095]

[0096]

[0097] 4. Results and analysis: The results showed that there was no significant difference in the change of root length after irrigation with mixed bacterial solutions of different ratios, but both could increase the fresh weight of the aboveground and underground parts. The most significant effect was achieved when the mixed bacterial solutions of equal volume ratios were used.

[0098] All the above experimental results were verified by three replications. In summary, the mixed microbial agent composed of Pseudomonas koreensis and Aerococcus urinaeequi can effectively alleviate the continuous cropping obstacle and promote tobacco growth.

[0099] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A mixed microbial agent, characterized in that: The composition is a mixture of Pseudomonas koreensis and Aerococcusurinaeequi in a volume ratio of 1:0.3-1.

2.

2. The mixed microbial agent according to claim 1, characterized in that: The OD600 value of the Pseudomonas koreensis was 0.1; and the OD600 value of the Aerococcus urinaeequi was 0.

1.

3. The mixed microbial agent according to claim 1, characterized in that: The Pseudomonas koreensis is a Gram-negative bacterium without spores, with a rod-shaped or slightly curved body, a size of (0.7-1.1)×(2.0-4.0) microns, and flagella; its colony morphology characteristics It is a white, round, opaque colony with a smooth surface and relatively neat edges.

4. The mixed microbial agent according to claim 1, characterized in that: The Aerococcus urinaeequi is a Gram-positive coccus without capsule and spores; its colony size is 2-3 cm, grayish yellow, moist, round, with a central bulge, opaque, and neat edges.

5. The mixed microbial agent according to claim 1, characterized in that: The Pseudomonas koreensis and Aerococcus urinaeequi were both isolated from the rhizosphere of the tobacco CrRLK47 mutant.

6. The mixed microbial agent according to claim 5, characterized in that: Preparation method thereof The following methods are included: 1) Place the rhizosphere of the CrRLK47 mutant tobacco seedlings in a 50 mL centrifuge tube containing 15-25 mL of sterile PBS buffer and shake on a shaker for 30 min; 2) Take out the rhizosphere, and the remaining liquid is the rhizosphere sample; 3) Take the rhizosphere sample and add it into sterile PBS solution, and the gradient dilution is recorded as 10 -1 , diluted to 10 -3 , 10 -4 , 10 -5 Three gradients, take 100 ml of these three gradient dilutions and spread them on a 9 cm culture dish, and use TSB medium to isolate bacteria; 4) Cultivate in a constant temperature incubator at 28°C, and after cultivation, pick a single colony or a single clone according to the target colony morphology to obtain the target strain; 5) The separated single target strains are directly mixed according to proportion to obtain a mixed microbial agent.

7. The mixed microbial agent according to claim 6, characterized in that: The shaker was oscillated at a speed of 150-250 rpm.

8. The mixed microbial agent according to claim 6, characterized in that: In step 3), the volume ratio of the rhizosphere sample to the sterile PBS solution is 0.8-1.2:7-11.

9. Use of the mixed microbial agent as claimed in claim 1 in alleviating tobacco continuous cropping obstacles.

10. Use of the mixed microbial agent as claimed in claim 1 in promoting tobacco growth.

Images