Heat-resistant high-yield t7 rna polymerase mutant and preparation method and application thereof

By substituting specific amino acid positions in T7 RNA polymerase, a thermostable mutant was prepared, which solved the problem of low transcription efficiency of T7 RNA polymerase under high temperature conditions and achieved higher transcription yield and activity.

CN119752838BActive Publication Date: 2025-11-21ACCURATE BIOTECHNOLOGY(HUNAN) CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411757182.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-03
Publication Date
2025-11-21
Estimated Expiration
2044-12-03

AI Technical Summary

Technical Problem

The existing T7 RNA polymerase has poor thermostability during RNA synthesis, resulting in numerous byproducts and low transcription efficiency.

Method used

By substituting specific amino acid positions in wild-type T7 RNA polymerase, T7 RNA polymerase mutants with high thermostability were prepared, including combinations such as K206P/D388E/S430P/H523E, V185K/H205S/M226I/I581K, V185R/H205T/M226L/I581K, and V185K/D388E/S430P/I581R, which enhanced its transcriptional activity under high-temperature conditions.

Benefits of technology

The transcription yield and activity of T7 RNA polymerase were improved under high temperature conditions. The mutants showed higher transcription capacity and yield at 37℃ and 52℃. Some mutants, such as T7-m4, achieved an RNA yield of 10.6 times that of the wild type at 52℃.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005166612530000011
    Figure HDA0005166612530000011
  • Figure HDA0005166612530000012
    Figure HDA0005166612530000012
  • Figure HDA0005166612530000021
    Figure HDA0005166612530000021
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering, and discloses a heat-resistant high-yield T7 RNA polymerase mutant, a preparation method and application thereof.The T7 RNA polymerase mutant of the present application is a protein as described in A1) or A2) below: A1) a protein obtained by substituting amino acids at at least four positions of V185, H205, K206, M226, D388, S430, H523 and I581 of a wild-type T7 RNA polymerase; wherein the amino acid sequence of the wild-type T7 RNA polymerase is shown in SEQ ID NO:1; A2) a fusion protein obtained by connecting a tag to the N terminus and / or C terminus of the amino acid sequence described in A1).Compared with the wild-type T7 RNA polymerase, the T7 RNA polymerase mutant of the present application exhibits better heat resistance and transcription activity.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of protein engineering, and in particular to a heat-resistant high-yield T7 RNA polymerase mutant, a preparation method and application thereof. BACKGROUND

[0002] RNA polymerase is an enzyme that synthesizes RNA by catalyzing phosphodiester bond polymerization with one DNA strand or RNA as a template and ribonucleoside triphosphate as a substrate. It is also called transcription enzyme because it is related to the transcription of genetic information of DNA into RNA in cells.

[0003] In related technologies, bacteriophage T7 RNA polymerase is one of the simplest enzymes that catalyze RNA synthesis. It is isolated from Escherichia coli cells infected with bacteriophage T7. It has a total of 883 amino acids, and the protein molecular weight is 99 kDa. Bacteriophage T7 RNA polymerase can catalyze RNA synthesis from 5' to 3', has high specificity for T7 bacteriophage promoters, recognizes specific T7 promoter sequences and initiates the transcription process, uses ATP, CTP, GTP and UTP as substrates, and synthesizes RNA by base pairing with the DNA template according to the principle of base complementary pairing. T7 RNA polymerase needs DNA template and Mg 2+ as a cofactor to participate in the synthesis of RNA. In the field of mRNA vaccines and drugs, T7 RNA polymerase is often used to produce mRNA. However, although T7 RNA polymerase is widely used in in vitro RNA synthesis, in vivo protein expression (bacterial high expression system), etc., there are also some non-negligible shortcomings as an in vitro RNA synthesis tool, such as poor thermal stability, and many by-products may be produced during RNA synthesis, including oligonucleotides produced during transcription initiation, interrupted RNA products caused by termination signals, and 3' end extension products caused by RNA-dependent RNA polymerase activity.

[0004] Therefore, it is urgent to seek a T7 RNA polymerase with high thermal stability and high transcription efficiency. SUMMARY

[0005] The present application aims to solve one of the technical problems existing in the prior art. To this end, the present application proposes a T7 RNA polymerase mutant, a preparation method and application thereof. The T7 RNA polymerase mutant has better transcription activity under high-temperature transcription conditions compared to the wild-type T7 RNA polymerase, that is, more transcription yield can be obtained under the same conditions.

[0006] The present application also proposes a biological material related to the T7 RNA polymerase mutant.

[0007] The application further provides an enzyme preparation.

[0008] The application further provides a preparation method of the T7 RNA polymerase mutant.

[0009] The application further provides a method for amplifying RNA molecules in vitro.

[0010] The application further provides an application of the T7 RNA polymerase mutant in preparation of nucleic acid amplification products.

[0011] The application further provides an application of the T7 RNA polymerase mutant or the enzyme preparation in nucleic acid amplification.

[0012] The application further provides a kit for nucleic acid amplification.

[0013] In a first aspect of the application, a T7 RNA polymerase mutant is provided, which is a protein as described in A1) or A2) below:

[0014] A1) a protein obtained by substituting amino acids at at least four positions of V185, H205, K206, M226, D388, S430, H523 and I581 of a wild-type T7 RNA polymerase; wherein the amino acid sequence of the wild-type T7 RNA polymerase is shown as SEQ ID NO: 1;

[0015] A2) a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of the amino acid sequence described in A1).

[0016] In some embodiments of the application, the T7 RNA polymerase mutant comprises amino acid substitution sites selected from the following combinations of positions: K206 / D388 / S430 / H523, V185 / H205 / M226 / I581, V185 / H205 / M226 / I581, V185 / D388 / S430 / I581.

[0017] In some embodiments of the application, the T7 RNA polymerase mutant comprises amino acid substitution at the position of V185, and the substituted amino acid can be selected from K or R.

[0018] In some embodiments of the application, the T7 RNA polymerase mutant comprises amino acid substitution at the position of H205, and the substituted amino acid can be selected from S or T.

[0019] In some embodiments of the application, the T7 RNA polymerase mutant comprises amino acid substitution at the position of K206, and the substituted amino acid can be selected from P.

[0020] In some embodiments of the present application, the T7 RNA polymerase mutant comprises an amino acid substitution at position M226, and the substitution amino acid can be selected from L.

[0021] In some embodiments of the present application, the T7 RNA polymerase mutant comprises an amino acid substitution at position D388, and the substitution amino acid can be selected from E.

[0022] In some embodiments of the present application, the T7 RNA polymerase mutant comprises an amino acid substitution at position S430, and the substitution amino acid can be selected from P.

[0023] In some embodiments of the present application, the T7 RNA polymerase mutant comprises an amino acid substitution at position H523, and the substitution amino acid can be selected from E.

[0024] In some embodiments of the present application, the T7 RNA polymerase mutant comprises an amino acid substitution at position I581, and the substitution amino acid can be selected from K or R.

[0025] In some embodiments of the present application, the T7 RNA polymerase mutant comprises an amino acid substitution at a position selected from the following combinations of mutations:

[0026] K206P / D388E / S430P / H523E, V185K / H205S / M226I / I581K, V185R / H205T / M226L / I581K, V185K / D388E / S430P / I581R.

[0027] According to the T7 RNA polymerase mutant of the embodiments of the present application, at least the following beneficial effects are achieved:

[0028] The T7 RNA polymerase mutant of the present application has higher transcription yield under high temperature conditions than the wild-type T7 RNA polymerase, that is, it has higher band brightness under the same high-temperature transcription conditions, and shows this advantage in multiple template tests. Moreover, it has higher transcription activity than the wild-type T7 RNA polymerase.

[0029] In some embodiments of the present application, the tag comprises at least one of a tag facilitating the solubilization, purification and detection of the T7 RNA polymerase mutant.

[0030] In some embodiments of the present application, the tag is a histidine tag.

[0031] It can be understood that the T7 RNA polymerase mutant of the present application can comprise one or more tags; the plurality of tags can comprise a combination of a plurality of same tags, or a combination of a plurality of different tags. For example: the tag beneficial to the dissolution of the T7 RNA polymerase mutant includes but is not limited to a nus tag or a maltose binding protein tag; the tag beneficial to the purification of the T7 RNA polymerase mutant includes but is not limited to a strep tag, a His tag, a GST tag, a pelB signal tag or an ompA signal tag; the tag beneficial to the detection of the T7 RNA polymerase mutant includes but is not limited to a horseradish peroxidase (HRP) tag, a beta-galactosidase tag, a luciferase tag, a green fluorescent protein (GFP) tag, an HcRed tag, a DsRed tag or a cyan fluorescent protein (CFP) tag. The tag can be a His tag in particular.

[0032] In a second aspect of the present application, there is provided a biological material related to the T7 RNA polymerase mutant of the first aspect, the biological material being any one of B1) to B4):

[0033] B1), a nucleic acid molecule encoding the T7 RNA polymerase mutant of the first aspect;

[0034] B2), an expression cassette comprising the nucleic acid molecule of B1);

[0035] B3), a recombinant vector comprising the nucleic acid molecule of B1) or the expression cassette of B2);

[0036] B4), a recombinant biological cell comprising the nucleic acid molecule of B1), the expression cassette of B2) or the recombinant vector of B3).

[0037] In some embodiments of the present application, the nucleic acid molecule has any one of B11) to B16):

[0038] B11), a DNA molecule having the nucleotide sequence as shown in SEQ ID NO: 3;

[0039] B12), a DNA molecule having the nucleotide sequence as shown in SEQ ID NO: 4;

[0040] B13), a DNA molecule having the nucleotide sequence as shown in SEQ ID NO: 5;

[0041] B14), a DNA molecule having the nucleotide sequence as shown in SEQ ID NO: 6;

[0042] B15), a DNA molecule having 80%, 85% or 90% or more homology with the nucleotide sequence as shown in any one of B11) to B14), and encoding the T7 RNA polymerase mutant.

[0043] B16) a DNA molecule hybridizing to the nucleotide sequence defined in any one of B11) to B14) under stringent conditions and encoding the T7 RNA polymerase mutant.

[0044] In some embodiments of the present application, the expression cassette refers to a DNA capable of expressing the T7 RNA polymerase mutant in a host cell. The DNA can include not only a promoter initiating transcription of the T7 RNA polymerase mutant gene, but also a terminator terminating transcription of the T7 RNA polymerase mutant gene. Further, the expression cassette can also include an enhancer sequence.

[0045] In some embodiments of the present application, the vector can be a plasmid, a cosmid, a bacteriophage or a viral vector. For example, it can be a PET-28a vector.

[0046] In some embodiments of the present application, the recombinant vector can be a recombinant vector obtained by inserting a DNA molecule encoding the T7 RNA polymerase mutant into a multiple cloning site of the vector.

[0047] In some embodiments of the present application, the biological cell includes a prokaryotic cell and a eukaryotic cell. The prokaryotic cell includes a bacterium or an alga. The eukaryotic cell includes a fungus, a mammalian cell or an insect cell. Among them, the bacterium can be E. coli, such as E. coli DH5a or E. coli BL21. The recombinant organism does not contain reproductive material.

[0048] In some embodiments of the present application, the recombinant biological cell is a recombinant biological cell obtained by introducing the nucleic acid molecule of B1), the expression cassette of B2) or the recombinant vector of B3) into a biological cell. Specifically, it can be a recombinant E. coli obtained by introducing a recombinant vector into E. coli DH5a or E. coli BL21.

[0049] In a third aspect of the present application, an enzyme preparation is provided, which comprises the T7 RNA polymerase mutant of any one of the first aspect.

[0050] In some embodiments of the present application, the enzyme preparation further comprises a reaction premix or an enzyme storage solution.

[0051] In some embodiments of the present application, the reaction premix comprises at least one of an RNase inhibitor, spermidine, Tris-HCl, DTT, NTPs, Mg 2+

[0052] In some embodiments of the present application, the enzyme storage solution comprises at least one of KPB, NaCl, DTT, EDTA, glycerol.​

[0053] It can be understood that the reaction premix, the enzyme storage solution are suitable for not affecting the activity of the T7 RNA polymerase mutant.

[0054] In a fourth aspect of the present application, a preparation method of the T7 RNA polymerase mutant of any one of the first aspect is provided, comprising:

[0055] The coding gene of the T7 RNA polymerase mutant in the first aspect is introduced into a biological cell, and the coding gene is expressed, so as to obtain the T7 RNA polymerase mutant.

[0056] In some embodiments of the present application, the biological cell includes prokaryotic cells and eukaryotic cells.

[0057] In some embodiments of the present application, the prokaryotic cell includes bacteria or algae. The bacteria can be E. coli (such as E. coli BL21).

[0058] In some embodiments of the present application, the eukaryotic cell includes fungi (such as yeast), mammalian cells (such as HEK293 cells) or insect cells.

[0059] In a fifth aspect of the present application, a method for amplifying RNA molecules in vitro is provided, comprising the following steps:

[0060] The T7 RNA polymerase mutant in the first aspect or the enzyme preparation in the third aspect is used for RNA molecule amplification.

[0061] In a sixth aspect of the present application, the use of C1) to C3) in the preparation of nucleic acid amplification products is provided.

[0062] C1), the T7 RNA polymerase mutant in the first aspect;

[0063] C2), the biological material in the second aspect;

[0064] C3), the enzyme preparation in the third aspect.

[0065] In a seventh aspect of the present application, the use of the T7 RNA polymerase mutant in the first aspect or the enzyme preparation in the third aspect in nucleic acid amplification is provided.

[0066] In an eighth aspect of the present application, a kit for nucleic acid amplification is provided, comprising the T7 RNA polymerase mutant in the first aspect or the enzyme preparation in the third aspect.

[0067] Other features and advantages of the present application will be set forth in the following description. BRIEF DESCRIPTION OF DRAWINGS

[0068] The present application will be further described with reference to the following drawings and examples, wherein:

[0069] Figure 1 SDS-PAGE electrophoresis results of wild type T7 RNA polymerase of the present application;

[0070] Figure 2 SDS-PAGE electrophoresis results of T7 RNA polymerase mutants m1-m6 of the present application; wherein A is T7 RNA polymerase mutant m1, B is T7 RNA polymerase mutant m2, C is T7 RNA polymerase mutant m3, D is T7 RNA polymerase mutant m4, E is T7 RNA polymerase mutant m5, and F is T7 RNA polymerase mutant m6;

[0071] Figure 3 Statistical diagram of unfolding temperature of T7 RNA polymerase of the present application;

[0072] Figure 4 Statistical diagram of transcription performance detection results of T7 RNA polymerase of the present application under 37℃ conditions; wherein ** indicates p<0.01, and *** indicates p<0.001;

[0073] Figure 5 Statistical diagram of transcription performance detection results of T7 RNA polymerase of the present application under 52℃ conditions; wherein ns indicates no significant difference, *** indicates p<0.001, and **** indicates p<0.0001. DETAILED DESCRIPTION

[0074] The concept and technical effects of the present application will be described below in combination with examples, so as to fully understand the purpose, features and effects of the present application. Obviously, the described examples are only a part of the examples of the present application, but not all the examples. Based on the examples of the present application, other examples obtained by those skilled in the art without creative labor are within the protection scope of the present application.

[0075] When a numerical range is disclosed herein, the above range is considered to be continuous and includes the minimum value and the maximum value of the range, and each value between the minimum value and the maximum value. Further, when the range refers to an integer, each integer between the minimum value and the maximum value of the range is included. In addition, when multiple ranges are provided to describe a feature or a characteristic, the ranges can be combined. In other words, unless otherwise indicated, all ranges disclosed herein should be understood to include any and all sub-ranges therein.

[0076] In the description of the application, the term "and / or" includes all and any combinations of one or more of the associated listed items.

[0077] In the description of the application, the term "nucleotide" generally refers to a compound in which a nucleoside is linked to an acidic molecule or group by an ester bond. For example, a nucleotide is a phosphate ester of a nucleoside, typically having one, two, or three phosphate groups covalently linked to the 5-position of the sugar group of the nucleoside. In some cases, the definition of nucleotide also includes homologues or analogues of typical nucleotides.

[0078] In the description of the application, the term "amino acid" refers to the basic unit that constitutes a protein, confers a specific molecular structure to the protein, and makes his molecule have biochemical activity. For example, the "amino acid" used in the present application includes the following 20 natural amino acids: alanine (Ala or A), glycine (Gly or G), isoleucine (Ile or I), asparagine (Asn or N), arginine (Arg or R), lysine (Lys or K), lysine (Lys or K), cysteine (Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), glutamine (Gln or Q), histidine (His or H), leucine (Leu or L), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), valine (Val or V), and tyrosine (Tyr or Y). The "*" in the amino acid sequence is the stop codon.

[0079] In the description of the application, each amino acid substitution is represented by a triplet: letter-number-letter; wherein the number indicates the position of the mutated amino acid, the letter before the number corresponds to the amino acid involved in the mutation, and the letter after the number indicates the amino acid used to replace the amino acid before the number.

[0080] Unless otherwise specified in the examples, the procedures were carried out according to the conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, the reagents or instruments used were conventional products that can be obtained by commercial purchase.

[0081] Invention concept:

[0082] In order to obtain T7 RNA polymerase with high thermal stability and high efficient transcription, the wild type T7 RNA polymerase is mutated and screened in the application, and four T7 RNA polymerase mutants with excellent thermal stability and high efficient transcription are screened, which are T7 RNA polymerase mutant m1 (K206P / D388E / S430P / H523E), T7 RNA polymerase mutant m2 (V185K / H205S / M226I / I581K), T7 RNA polymerase mutant m3 (V185R / H205T / M226L / I581K), and T7 RNA polymerase mutant m4 (V185K / D388E / S430P / I581R). The amino acid sequence information of the wild type T7 RNA polymerase is shown in SEQ ID NO: 1.

[0083] The T7 RNA polymerase mutant m1 is obtained by mutating the 388th aspartic acid to glutamic acid (D388E), the 430th serine to proline (S430P), the 206th lysine to proline (K206P), and the 523th histidine to glutamic acid (H523E) based on the amino acid sequence of the wild type T7 RNA polymerase.

[0084] The T7 RNA polymerase mutant m2 is obtained by mutating the 185th valine to lysine (V185K), the 205th histidine to serine (H205S), the 226th methionine to isoleucine (M226I), and the 581th isoleucine to lysine (I581K) based on the amino acid sequence of the wild type T7 RNA polymerase.

[0085] The T7 RNA polymerase mutant m3 is obtained by mutating the 185th valine to arginine (V185R), the 226th methionine to leucine (M226L), the 205th histidine to threonine (H205T), and the 581th isoleucine to lysine (I581K) based on the amino acid sequence of the wild type T7 RNA polymerase.

[0086] The T7 RNA polymerase mutant m4 is obtained by mutating the 185th valine to lysine (V185K), the 430th serine to proline (S430P), the 388th aspartic acid to glutamic acid (D388E), and the 581th isoleucine to arginine (I581R) based on the amino acid sequence of the wild type T7 RNA polymerase. Specific embodiments

[0088] The following will be described in detail in conjunction with specific examples. The specific conditions are not specified in the following examples, and the conventional conditions (e.g., conditions described in literature or books) or the conditions recommended by the manufacturer are used. The reagents or instruments used in the examples are not specified by the manufacturer, and are all conventional products that can be purchased on the market.

[0089] Example 1: Obtaining T7 RNA polymerase mutants

[0090] 1. Construction of expression vectors:

[0091] Based on the amino acid sequence information of the screened T7 RNA polymerase mutants, the nucleotide sequence information encoding the codon-optimized sequence was obtained, and a nucleotide sequence containing a histidine tag (HHHHHH) and a linker peptide (GS) at the 3' end, i.e., ATGCATCATCATCATCATCATGGCAGC (SEQ ID NO: 9), was designed. The corresponding DNA molecule was synthesized by gene synthesis method, wherein:

[0092] The nucleotide sequence information encoding the wild-type T7 RNA polymerase is shown in SEQ ID NO: 2. The nucleotide sequence information encoding the T7 RNA polymerase mutant m1 is shown in SEQ ID NO: 3. The nucleotide sequence information encoding the T7 RNA polymerase mutant m2 is shown in SEQ ID NO: 4. The nucleotide sequence information encoding the T7 RNA polymerase mutant m3 is shown in SEQ ID NO: 5. The nucleotide sequence information encoding the T7 RNA polymerase mutant m4 is shown in SEQ ID NO: 6.

[0093] The T7 RNA polymerase mutant m5 is based on the amino acid sequence of the wild-type T7 RNA polymerase, in which the 226th methionine is mutated to leucine (M226L), the 306th methionine is mutated to lysine (M306K), the 419th asparagine is mutated to threonine (N419T), and the 510th cysteine is mutated to glutamine (C510Q). The nucleotide sequence information encoding it is shown in SEQ ID NO: 7.

[0094] The T7 RNA polymerase mutant m6 is based on the amino acid sequence of the wild-type T7 RNA polymerase, in which the 338th aspartic acid is mutated to tryptophan (D388W), the 205th histidine is mutated to phenylalanine (H205F), and the 206th lysine is mutated to tyrosine (K206Y). The nucleotide sequence information encoding it is shown in SEQ ID NO: 8.

[0095] Then the above DNA molecules are connected with PET-28a vector by overlap PCR to obtain recombinant expression vectors PET-28a / T7-wt, PET-28a / T7-m1, PET-28a / T7-m2, PET-28a / T7-m3, PET-28a / T7-m4, PET-28a / T7-m5 and PET-28a / T7-m6. The recombinant expression vectors are transformed into DH5a competent cells respectively, and positive monoclonal is screened for sequencing verification, and single colony with correct verification result is obtained.

[0096] 2. Expression:

[0097] The recombinant expression vector verified in the above step 1 is transformed into host cells E. coli BL21, and single colony is picked and inoculated into 100 mL LB medium containing 50 μg / mL ampicillin, and placed in a 37°C shaker for overnight culture. After that, the seed liquid of overnight culture is taken, inoculated into 2 L LB medium containing 50 μg / mL ampicillin at a volume ratio of 1:100, and cultured in a 37°C shaker until OD 600 is 0.6-0.8; 10% IPTG is added to a final concentration of 0.4 mmol / L, and the induction is continued at 37°C for 6-8 h; the induced bacteria are collected by centrifugation and weighed, and the wet weight of the bacteria is recorded, and stored at -80°C.

[0098] 3. Purification:

[0099] The expression proteins in the bacteria containing the recombinant expression vectors PET-28a / T7-wt, PET-28a / T7-m1, PET-28a / T7-m2, PET-28a / T7-m3, PET-28a / T7-m4, PET-28a / T7-m5 and PET-28a / T7-m6 are extracted respectively, and the specific steps are as follows:

[0100] (1) High-pressure disruption of induced expression bacteria:

[0101] The induced expression bacteria stored at -80°C are taken respectively, and 5 mL lysis buffer (50 mM Tris-HCl, pH 7.8 at 25°C, 300 mM NaCl, 50 mM Imidazole, 5% Glycerol) is added per gram of bacteria to resuspend the bacteria, and the bacteria are lysed by high-pressure disruption instrument, and the high-pressure disruption conditions are 650 bar and three cycles of disruption. The lysed bacteria are centrifuged at 12000 rpm for 30 min at 4°C to separate the supernatant (sample 1) and the precipitate (sample 2), and the supernatant is taken into a 200 mL sterilized beaker.

[0102] (2) Nickel ion affinity chromatography purification:

[0103] The selected chromatography column is Ni-NTA Purose 6 Fast Flow (purchased from Jiaxing Qian Pure Biotechnology Co., Ltd.), the binding buffer is buffer A (50 mM Tris-HCl, pH 7.8 at 25℃, 100 mM NaCl, 80 mM Imidazole, 5% Glycerol); the elution buffer is buffer B (50 mM Tris-HCl, pH 7.8 at 25℃, 100 mM NaCl, 500 mM Imidazole), 5% Glycerol. The dissolved protein solution in step 1 is loaded into the chromatography column which has been equilibrated with buffer A. After loading, first wash the column with equilibration buffer A, then perform gradient elution with buffer B from 0% to 100%, detect the elution components by SDS-PAGE protein electrophoresis, collect the eluate containing the target protease according to the detection results (sample 3), and dialyze the eluate into buffer A, and collect the dialyzed solution for use (sample 4).

[0104] (3) Secondary nickel ion affinity chromatography purification:

[0105] Repeat step 2, detect the elution components by SDS-PAGE protein electrophoresis, collect the eluate containing the target protease according to the detection results (sample 5), and dialyze the eluate into buffer C (50 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA, pH 7.8 (25℃)), and collect the dialyzed solution for use (sample 6).

[0106] (4) Strong anion exchange chromatography purification:

[0107] The selected chromatography column is Q Purose 6 Fast Flow (purchased from Jiaxing Qian Pure Biotechnology Co., Ltd.), the binding buffer is buffer C; the elution buffer is buffer D (50 mM Tris-HCl pH 7.8 at 25℃, 800 mM NaCl, 1 mM DTT, 0.1 mM EDTA). The dialyzed solution obtained in step 3 is loaded into the chromatography column which has been equilibrated with buffer C. After loading, first wash the column with buffer C, then perform gradient elution with buffer D from 0% to 100%, detect the elution components by SDS-PAGE protein electrophoresis, collect the eluate according to the detection results (sample 7), and dialyze into the storage solution (20 mM KPB (pH 7.9), 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA, 50% glycerol) for use (sample 8).

[0108] SDS-PAGE electrophoresis was performed on the above samples, and the results are as follows Figure 1 and Figure 2The electrophoresis results show that the target proteases (i.e., wild-type T7 RNA polymerase and T7 RNA polymerase mutants T7-m1 to T7-m6) are successfully obtained by using the method of the present application. As can be seen from the electrophoretic bands, the T7 RNA polymerase purified by the method has few impurities and high product purity, and the purity can reach 90%.

[0109] Detection Example 1: Measurement of Unfolding Temperature (Tm Value)

[0110] In the DSF experiment, if the melting temperature changes by 1°C, it is considered to have significant difference, and the heat resistance is significantly improved.

[0111] The unfolding temperature of the wild-type T7 RNA polymerase (hereinafter referred to as "WT") and T7 RNA polymerase mutants T7-m1 to T7-m6 (hereinafter referred to as "T7-m1", "T7-m2", "T7-m3", "T7-m4", "T7-m5" to "T7-m6", respectively) obtained above was detected respectively, and the specific method is as follows:

[0112] The wild-type T7 RNA polymerase and the T7 RNA polymerase mutants were uniformly diluted to 1 mg / mL with a storage solution (containing 20 mM KPB (pH 7.9), 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA and 50% glycerol). Then the reaction system was prepared, specifically, the buffer (2×SYPRO Orange final concentration) and the corresponding diluted T7 RNA polymerase (0.1 mg / mL final concentration) were added in each reaction system to prepare a 20 μL reaction system. Finally, the ABI QuantStudio was used to measure the unfolding temperature, and the average value was taken from three parallel experiments in each group.

[0113] The detection results are as follows: Figure 3The unfolding temperature of wild-type T7 RNA polymerase is 45.58°C, and the unfolding temperatures of T7-m1 to T7-m5 are significantly higher than that of wild-type T7 RNA polymerase (the Tm values are all increased by >1°C), and the heat resistance is stronger than that of wild-type T7 RNA polymerase. Among them, the Tm value of T7-m1 is 47.28°C, the Tm value of T7-m2 is 47.55°C, the Tm value of T7-m3 is 48.14°C, the Tm value of T7-m4 is 49.65°C, and the Tm value of T7-m5 is 47.47°C. In particular, the Tm values of T7-m3 and T7-m4 relative to wild-type WT are all increased by >2°C. The Tm value of T7-m6 is 44.22°C, which is significantly less than that of wild-type, and the heat resistance is poor, and it is not subjected to subsequent transcription performance detection. This also shows that different combinations of amino acid mutations will have different effects on the heat resistance of T7 RNA polymerase.

[0114] Detection Example 2: Transcription performance detection at different temperatures

[0115] The transcription performance of wild-type T7 RNA polymerase and T7-m1 to T7-m5 obtained above at different reaction temperatures (37°C and 52°C) was detected respectively. The specific method is as follows:

[0116] The pUC18 plasmid was used as a template, specific primer sets were designed for conventional PCR amplification, and a DNA template of about 1.5 kbp was purified, wherein the sequences of the specific primer sets are as follows:

[0117] PCR-F: 5'-TAATACGACTCACTATAGGGACTATCGTCTTGAGT-3' (SEQ ID NO: 10);

[0118] PCR-R: 5'-GACGAAAGGGCCTCGTGATA-3' (SEQ ID NO: 11);

[0119] Then the wild-type T7 RNA polymerase and T7 RNA polymerase mutants m1 to m5 obtained above were used as transcription enzymes for in vitro transcription, and the reaction system of transcription is shown in Table 1.

[0120] Table 1: Transcription system

[0121] Components Final concentration 10x reaction buffer 1× RNase inhibitor 1U DTT (dithiothreitol) 5 mM NTPs mix 0.5 mM DNA template 200 ng T7 RNA polymerase 50U Total volume 20 μL

[0122] Wherein, 10x reaction buffer contains 400 mM Tris-HCl (pH 8.0), 80 mM MgCl2 and 20 mM spermidine. After the reaction system was prepared, it was placed at 52℃ / 37℃ for 30 min, then inactivated at 70℃ for 10 min, and finally the transcription product was quantitatively analyzed using Qubit RNA HS Assay Kit (Thermo Fisher).

[0123] The results of fluorescence quantitative analysis of the products of 37℃ transcription for 30 min are shown in Table 2 and Table 3 as follows: Figure 4

[0124] Table 2: Results of fluorescence quantitative analysis under 37℃ conditions

[0125] Sample number Sample Mutant site RNA yield (ng) Standard deviation 1 T7-m1 K206P / D388E / S430P / H523E 615 0.71 2 T7-m2 V185K / H205S / M226I / I581K 590 0.33 3 T7-m3 V185R / H205T / M226I / I581K 712 1.20 4 T7-m4 V185K / D388E / S430P / I581R 881 0.87 5 T7-m5 M226L / M306K / N419T / C510Q 320 0.22 6 T7-wt WT 452 1.98

[0126] The detection results show that under the reaction condition of 37℃, the transcription performance of T7-m1~T7-m4 is significantly improved compared with the wild type T7 RNA polymerase. Among them, the RNA product yield of T7-m4 transcription is 1.95 times that of the wild type T7 RNA polymerase.

[0127] The results of fluorescence quantitative analysis of the products of 52℃ transcription for 30 min are shown in Table 2 and Table 3 as follows: Figure 5

[0128] Table 3: Results of fluorescence quantitative analysis under 52℃ conditions

[0129] Sample number Sample Mutant site RNA yield (ng) Standard deviation 1 T7-m1 K206P / D388E / S430P / H523E 130 1.07 2 T7-m2 V185K / H205S / M226I / I581K 200 1.21 3 T7-m3 V185R / H205T / M226I / I581K 435 0.88 4 T7-m4 V185K / D388E / S430P / I581R 583 0.75 5 T7-m5 M226L / M306K / N419T / C510Q 50 0.57 6 T7-wt WT 55 1.44

[0130] The detection results show that under the reaction condition of 52℃, the transcription performance of T7-m1~T7-m4 is significantly improved compared with the wild type T7 RNA polymerase. Among them, the RNA product yield of T7-m4 transcription is 10.6 times that of the wild type T7 RNA polymerase.

[0131] Although the Tm value of T7-m5 is obviously improved compared with the wild type, but after mutation, its transcription RNA ability has decreased obviously. This also shows that different amino acid mutation combinations will cause different effects on the transcription activity of T7 RNA polymerase.

[0132] ​​In summary, the application provides a heat-resistant high-yield T7 RNA polymerase mutant, a preparation method and application thereof. Compared with the wild-type T7 RNA polymerase, the T7 RNA polymerase mutants T7-m1 to T7-m4 (the corresponding mutation points are K206P / D388E / S430P / H523E, V185K / H205S / M226I / I581K, V185R / H205T / M226L / I581K, V185K / D388E / S430P / I581R, respectively) of the application all have higher transcription capacity and transcription yield under normal transcription conditions at 37 DEG C and high-temperature conditions at 52 DEG C; and the heat-resistant performance of T7-m4 is the strongest, and the RNA yield obtained under the same conditions is the highest.

[0133] The above has described the embodiments of the application in detail, but the application is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the purpose of the application. In addition, the embodiments of the application and the features in the embodiments can be combined with each other without conflict.

Claims

1. A mutant of T7 RNA polymerase characterized in that, The T7 RNA polymerase mutant is a protein as described in A1) or A2) below: A1) a protein with amino acid substitutions at four positions of a wild-type T7 RNA polymerase; wherein the amino acid sequence of the wild-type T7 RNA polymerase is shown in SEQ ID NO: 1; the amino acid substitution positions of the T7 RNA polymerase mutant are selected from the combination of mutations V185K / D388E / S430P / I581R; A2) a fusion protein with a tag attached to the N-terminus or / and C-terminus of the amino acid sequence described in A1).

2. A biological material related to the T7 RNA polymerase mutant according to claim 1, characterized in that, The biological material is any one of B1) to B4): B1), a nucleic acid molecule encoding the T7 RNA polymerase mutant of claim 1; B2), an expression cassette containing the nucleic acid molecule of B1); B3), a recombinant vector containing the nucleic acid molecule of B1) or the expression cassette of B2); B4), a recombinant biological cell containing the nucleic acid molecule of B1), the expression cassette of B2), or the recombinant vector of B3).

3. The biomaterial of claim 2, wherein, The nucleic acid molecule is any one of B14) to B16): B14), a DNA molecule with the nucleotide sequence shown in SEQ ID NO: 6; B15), a DNA molecule with 80%, 85% or 90% or more homology to the nucleotide sequence shown in B14), and encoding the T7 RNA polymerase mutant; B16), a DNA molecule hybridizing to the nucleotide sequence shown in B14) under stringent conditions, and encoding the T7 RNA polymerase mutant.

4. An enzyme preparation, characterized in that, The T7 RNA polymerase mutant of claim 1.

5. A method of producing the T7 RNA polymerase mutant of claim 1, comprising, The T7 RNA polymerase mutant of claim 1. The T7 RNA polymerase mutant of claim 1.

6. A method of amplifying an RNA molecule in vitro, characterized in that, The T7 RNA polymerase mutant of claim 1. The T7 RNA polymerase mutant of claim 1.

7. The use of any one of C1) to C3) in the preparation of a nucleic acid transcription product; C1), the T7 RNA polymerase mutant of claim 1; C2), the biological material of claim 2 or 3; C3), the enzyme preparation of claim 4.

8. The use of the T7 RNA polymerase mutant of claim 1 or the enzyme preparation of claim 5 in nucleic acid transcription.

9. A kit for nucleic acid transcription, characterized in that, The T7 RNA polymerase mutant of claim 1 or the enzyme preparation of claim 4.

Citation Information

Patent Citations

  • Thermostable variants of T7 RNA polymerase

    CN108779446A

  • Enzymatic RNA capping method

    CN112714795A