SgRNA sequence targeting knockout of o antigen gene cluster ol101 and application thereof

Abstract

The application discloses an sgRNA sequence for targeting and knocking out an O antigen gene cluster OL101 and application thereof. The sgRNA sequence for targeting and knocking out the O antigen gene cluster OL101 comprises oagen-sgRNA-F shown in SEQ ID NO. 1 and oagen-sgRNA-R shown in SEQ ID NO. 2. The plasmid vector system of CRISPR / Cas9 and lambda Red for targeting and knocking out the O antigen gene cluster OL101 is a recombinant expression plasmid vector of the sgRNA sequence for targeting and knocking out the O antigen gene cluster, lambda Red and CRISPR / cas9 carrier shown in claim 1, and the sequence is shown in SEQ ID NO. 3. The application can specifically target and knock out Klebsiella pneumoniae OL101, obtain a strain with the OL101 knocked out, and is favorable for clarifying the specific functions of the O antigen OL101 of Klebsiella pneumoniae. The system for targeting and knocking out the O antigen OL101 of Klebsiella pneumoniae can effectively knock out the O antigen gene cluster of the strain, has a short gene knockout cycle and a simple method.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering, and particularly relates to an sgRNA sequence for targeted knockout of an O antigen gene cluster, a CRISPR / Cas9 and lambda Red plasmid vector system and application thereof. BACKGROUND

[0002] In recent years, bacterial drug resistance in China is becoming increasingly serious, and multiple drug resistance and even pan-drug resistance bacteria have gradually become an important cause of infection and death of patients. The incidence of carbapenem-resistant Klebsiella pneumoniae (CRKP) is high, and the mortality is high, which has caused a serious medical burden to patients. At present, it is known that ST11 type is the most important medical-related CRKP clone in China, and the clone has OL101 type O antigen, which is encoded by OL101 gene cluster. The O antigen of lipopolysaccharide plays an important role in the pathogenic process of bacteria, but the specific function of the OL101 antigen of the CRKP clone still needs to be further understood.

[0003] In 2000, a method for realizing recombination between exogenous linear double-stranded DNA and homologous sequences of chromosomal DNA in Escherichia coli by using a lambda phage homologous recombination system was developed. In actual operation, the genes of three Red proteins (Gam, Exo, Beta) are placed on an expression vector, and once the exogenous dsDNA is electroporated into the cell, there is a probability of homologous recombination at the target sequence in the same genome, replacing the gene to be knocked out.

[0004] The CRISPR-Cas system is an RNA-mediated acquired immune system that can provide sequence-specific protection against foreign DNA, and when exogenous DNA enters the bacterial body and wants to invade its genome, the bacteria will adopt this defense mechanism to cut it off. At present, the CRISPR / Cas system has been developed into a genome editing tool. SUMMARY

[0005] The present application aims at the deficiencies of the prior art, and provides an sgRNA sequence for targeted knockout of O antigen gene cluster OL101 and application thereof.

[0006] The technical scheme of the present application is as follows:

[0007] An sgRNA sequence for targeted knockout of O antigen gene cluster OL101, which comprises oagen-sgRNA-F as shown in SEQ ID NO. 1 and oagen-sgRNA-R as shown in SEQ ID NO. 2.

[0008] A plasmid vector system of CRISPR / Cas9 and lambda Red for targeted knockout of O antigen gene cluster OL101, which is a recombinant expression plasmid vector of sgRNA sequence for targeted knockout of O antigen gene cluster, lambda Red and CRISPR / cas9 carrier, and the sequence is SEQ ID NO. 3.

[0009] A construction method of a plasmid vector system of CRISPR / Cas9 and lambda Red for targeted knockout of O antigen gene cluster, comprising the following steps:

[0010] (1) using BsaI to cut the plasmid vector pCAS-RED to obtain the linear pCAS-RED carrier after enzyme cutting;

[0011] (2) annealing oagen-sgRNA-F and oagen-sgRNA-R of the sgRNA sequence for targeted knockout of O antigen gene cluster to obtain a double-stranded DNA sequence, and connecting the double-stranded DNA sequence with the pCAS-RED plasmid vector after enzyme cutting to obtain a recombinant expression plasmid vector of the sgRNA sequence for targeted knockout of O antigen gene cluster.

[0012] The application of the plasmid vector system of CRISPR / Cas9 and lambda Red is used for targeted knockout of O antigen gene cluster of Klebsiella pneumoniae.

[0013] The beneficial effects of the present application are as follows:

[0014] The sgRNA sequence for targeted knockout of O antigen gene cluster provided by the present application can specifically target O antigen gene cluster OL101, and when it is constructed into a CRISPR / Cas9 carrier system and matched with a lambda Red homologous recombination system, it can specifically target and knockout O antigen gene cluster of Klebsiella pneumoniae, so as to obtain a strain with knockout of O antigen gene cluster, thereby facilitating the elucidation of the specific function of OL101.

[0015] The system of CRISPR / Cas9 for targeted knockout of O antigen gene cluster of Klebsiella pneumoniae can effectively knockout O antigen gene cluster of the strain, and the gene knockout cycle is short and the method is simple. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 It is the plasmid map of the recombinant expression vector pCAS-RED-sgRNA constructed in the embodiment of the present application.

[0017] Figure 2 It is the electrophoresis detection result map of PCR in the embodiment of the present application.

[0018] Figure 3 It is the survival rate of bacteria after serum treatment in the embodiment of the present application. DETAILED DESCRIPTION

[0019] The purposes and effects of the present application will become more apparent from the following detailed description of the preferred embodiments with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are merely illustrative of the present application and are not intended to limit the present application.

[0020] The principle of sgRNA sequence targeting knockout of O antigen gene cluster is as follows:

[0021] The target sequence of the sgRNA on the O antigen gene cluster conforms to the sequence arrangement rule of 5'-N(20)-NGG(PAM), the target sequence of the sgRNA on the O antigen gene cluster is located in the conserved region of the gene, and the target site sequence of the sgRNA on the O antigen gene cluster is shown in the sequence of SEQ ID NO. 1, and the

[0022] The 5'-end of the target site sequence of the sgRNA on the O antigen gene cluster is added with a TAGT sequence to synthesize a forward oligonucleotide, i.e., Forward oligo; the complementary strand of the target site sequence of the sgRNA on the O antigen gene cluster is obtained, and an AAAC sequence is added to the 5'-end of the complementary strand to synthesize a reverse oligonucleotide, i.e., Reverse oligo.

[0023] The synthesized two complementary oligonucleotides of Forward oligo and Reverse oligo are annealed and paired, and then form double-stranded sgRNA oligonucleotides which can be connected to a plasmid vector.

[0024] The annealed double-stranded sgRNA oligonucleotides are connected to the linearized vector pCAS-RED carrying Cas9 gene and Red gene (gam, exo, beta) to obtain an expression vector pCAS-RED-sgRNA plasmid carrying sgRNA oligonucleotides containing the corresponding target sequence (pCAS-RED-sgRNA), Figure 1 ), and the positive clones are identified by sequencing, and the positive clones are shaken and the plasmid is extracted.

[0025] The pCAS-RED-sgRNA plasmid carrying sgRNA, Cas9 and Red and the repair template containing the 500bp homologous arms connected at both ends of the O antigen gene cluster are used to transform the target bacteria, and the single colony bacteria are selected by screening with hygromycin resistance, and the genomic DNA is extracted, and the gene fragment containing the target sequence is amplified by PCR using the genomic DNA as a template, and the knockout bacteria are obtained by confirming that the O antigen gene cluster has been knocked out by whole genome sequencing. The specific preparation method is as follows:

[0026] S1: Prepare 10 MHA solid plates containing 100 micrograms / milliliter of hygromycin

[0027] S1.1: 7.6 grams of Mueller-Hinton Agar (MHA) medium was weighed into 200 ml of distilled water and autoclaved at 121 °C for 20 minutes. After the autoclaving was complete, the medium was placed in a 60 °C water bath and allowed to cool.

[0028] S1.2: 0.02 grams of hygromycin was accurately weighed into 1 ml of water to create a hygromycin solution.

[0029] S1.3: The hygromycin solution prepared in S1.2 was added to the 200 ml of MHA medium prepared in S1.1 and mixed. The mixture was then poured into sterile 90 mm diameter petri dishes, approximately 20 ml per dish.

[0030] S1.4: The MHA medium was allowed to solidify at room temperature for 2 hours. The petri dishes were then stored at 4 °C until use.

[0031] S2: Preparation of competent bacteria

[0032] S2.1: The target bacteria was streaked onto a Columbia blood agar plate and incubated at 37 °C for 18 hours.

[0033] S2.2: 1.9 grams of Mueller-Hinton (MH) medium was weighed into 50 ml of distilled water and autoclaved at 121 °C for 20 minutes. After the autoclaving was complete, the medium was placed in a 4 °C refrigerator until use.

[0034] S2.3: A single colony of bacteria was picked and added to 5 ml of liquid medium and incubated at 220 rpm and 37 °C overnight. The next day, 500 μΐ of the bacteria was added to 50 ml of MH liquid medium and incubated at 220 rpm and 37 °C for 2.5 hours.

[0035] S2.4: The bacteria was collected by centrifugation at 5000 rpm for 5 minutes.

[0036] S2.5: The bacteria was resuspended by washing with 15 ml of pre-cooled 4 °C double distilled water (ddH20).

[0037] S2.6: Step S2.5 was repeated.

[0038] S2.7: The bacteria was collected by centrifugation at the same conditions as S2.4 and resuspended by washing with 1 ml of a 10% glycerol solution.

[0039] S2.8: Step S2.7 was repeated.

[0040] S2.9: The bacteria was aliquoted into 1.5 ml EP tubes, 100 μΐ per tube, and stored at -80 °C until use.

[0041] S3: Constructing pCAS-RED-sgRNA plasmid:

[0042] S3.1: Synthesizing the following two sgRNA sequences

[0043] (1) oagen-sgRNA-F: TAGTTTCGTTGCAACCGTCAACCG; as shown in SEQ ID NO. 1;

[0044] (2) oagen-sgRNA-R: AAACCGGTTGACGGTTGCAACGAA; as shown in SEQ ID NO. 2.

[0045] S3.2: According to the concentration of synthesis, dilute the concentration of the two sequences to 100 micromole / liter using ddH2O.

[0046] S3.3: According to the following conditions, anneal and form a double-stranded sgRNA from the two sgRNA sequences.

[0047] (1) Add a, b, and c to a 0.2ml PCR tube, heat in a thermal cycler at 95°C for 3 minutes, then cool the PCR tube in the thermal cycler at a rate of 0.5°C / 10s to 25°C, and the two sequences will automatically connect to form a double-stranded sgRNA;

[0048] a. 1 μl oagen-sgRNA-F solution

[0049] b. 1 μl oagen-sgRNA-R solution

[0050] c. 8 μl ddH2O.

[0051] (2) Place the annealed double-stranded sgRNA in (1) at 4°C for standby.

[0052] S3.4: Use Bsal endonuclease to digest pCAS-RED plasmid, specifically:

[0053] Prepare the following a-d system, mix uniformly at low speed in the centrifuge, 1000 rpm, 10 s. Then incubate in a 37°C constant temperature water bath for 2 h, after the water bath, use a DNA purification kit to purify the plasmid vector, and save for later use.

[0054] a. 1 μl Bsal

[0055] b. 5 μl 10x Cutsmart Buffer

[0056] c. 5 μl pCAS-RED (200 μg / ml)

[0057] d. 39 μΐ ddH20.

[0058] S3.5: Ligate the digested pCAS-RED plasmid vector in S3.4 and the double- stranded sgRNA in S3.3 with T4 DNA ligase, specifically:

[0059] Prepare the system as follows a-e, mix well at low speed on the centrifuge, 1000 rpm, 10 s. Then incubate at 16°C constant temperature water bath for 2 h, obtain pCAS-RED-sgRNA plasmid, sequence as SEQ ID NO. 3.

[0060] a. 0.5 μΐ T4 DNA ligase

[0061] b. 1 μΐ 10 x ligase Buffer

[0062] c. 2 μΐ linearized pCAS-RED (25 μg / ml)

[0063] d. 1 μΐ double-stranded sgRNA

[0064] e. 5.5 μΐ ddH20.

[0065] S4: pCAS-RED-sgRNA plasmid electroporation into Klebsiella pneumoniae

[0066] S4.1 : Thaw the prepared competent bacteria stored at -80°C on ice.

[0067] S4.2: Add 3 μΐ of ligated pCAS-RED-sgRNA plasmid, mix gently. Note that the cells should not be mixed vigorously.

[0068] S4.3: Use the Bio-Rad electroporation instrument to transfer the pCAS-RED-sgRNA plasmid into the competent bacteria (conditions: voltage 2500 V).

[0069] S4.4: Quickly add 900 μΐ of SOC (Super Optimal Broth) medium containing L-arabinose (pre-incubated at 37°C).

[0070] S4.5: Incubate at 30°C for 1 hour (200 rpm) with shaking.

[0071] S4.6: Take an appropriate amount of 50 μΐ and spread on MHA solid plate medium containing 100 μg / ml of hygromycin.

[0072] S4.7: Incubate at 37°C overnight.

[0073] S5: PCR verification of the knockout of the target gene

[0074] S5.1: Select single colonies cultured on the MHA solid medium containing 100 micrograms / mL of hygromycin.

[0075] S5.2: PCR was used to amplify one gene, wbbB, from the O antigen gene cluster.

[0076] S5.3: After PCR, the PCR results are detected by agarose gel electrophoresis. Add gelred nucleic acid dye. If no band appears in the image, the PCR is negative.

[0077] S5.4: PCR-negative strains are knockout strains. Select a single colony and transfer it to a 30% (v / v) glycerol broth medium. Store at -80°C until use.

[0078] like Figure 2 The image shows the electrophoresis detection PCR results of this embodiment, where M is the marker, 1 is the original wild-type strain, and 2-6 are strains with the O antigen gene cluster knocked out, respectively. The original strain showed a positive PCR amplification band on electrophoresis, while the knockout strains showed a negative band.

[0079] S6: Serum resistance verification

[0080] S6.1: Target bacteria were inoculated by streaking in four zones on Columbia blood agar solid medium.

[0081] S6.2: Pick a single colony from step S6.1 and add it to sterile physiological saline. Adjust the turbidity to 0.5 McFarland turbidity, dilute it 10 times, and then mix 1 ml of bacterial solution with 1 ml of normal human serum at 37°C.

[0082] S6.3: After reacting for 2 hours, the mixed liquid was serially diluted and spread on non-resistant MHA plates. After incubation at 37°C for 16 hours, the bacteria were counted and the survival rate was calculated.

[0083] like Figure 3 The image shows the difference in bacterial resistance to serum before and after knockout. From... Figure 3 The results showed that the survival ability of the strain in serum was reduced after knockout, indicating that the knockout was successful.

[0084] It will be understood by those skilled in the art that the above descriptions are merely preferred examples of the invention and are not intended to limit the invention. Although the invention has been described in detail with reference to the foregoing examples, those skilled in the art can still modify the technical solutions described in the foregoing examples or make equivalent substitutions for some of the technical features. All modifications and equivalent substitutions made within the spirit and principles of the invention should be included within the scope of protection of the invention.

Claims

1. An sgRNA targeting knock-out of O antigen gene cluster OL101, characterized in that, The sgRNA includes oagen-sgRNA-F as shown in SEQ ID NO.1 and oagen-sgRNA-R as shown in SEQ ID NO.

2.

2. A plasmid vector system of CRISPR / Cas9 and lambda Red for targeted knockout of O antigen gene cluster OL101, characterized in that, The plasmid vector system is a recombinant expression plasmid vector of the sgRNA sequence, λRed and CRISPR / cas9 vector targeting the O antigen gene cluster as described in claim 1, and its sequence is: SEQ ID NO.

3.

3. A method for constructing a plasmid vector system of CRISPR / Cas9 and lambda Red targeting knock-out of O antigen gene cluster, characterized in that, Includes the following steps: (1) The plasmid vector pCAS-RED was digested with BsaI to obtain the linear pCAS-RED vector after digestion; (2) Anneal the oagen-sgRNA-F and oagen-sgRNA-R sequences of the sgRNA sequence targeting the knockout of the O antigen gene cluster as described in claim 1 to obtain a double-stranded DNA sequence. The double-stranded DNA sequence is then ligated with the enzyme-digested pCAS-RED plasmid vector to obtain a recombinant expression plasmid vector of the sgRNA sequence targeting the knockout of the O antigen gene cluster.

4. The use of the CRISPR / Cas9 and λRed plasmid vector system as described in claim 2 in the preparation of products for targeted knockout of the Klebsiella pneumoniae O antigen gene cluster.

Images