PARP inhibitor tolerant CAR-T cell, construction method and application

Abstract

The invention relates to the technical field of tumor immunotherapy, in particular to a PARP inhibitor tolerant CAR-T cell as well as a construction method and application thereof. The sequence of the sgRNA comprises a sequence of sg-D45, a sequence of sg-S588 or a sequence of sg-G745; according to the construction method, S588F, G745, D45N and M43I mutations are introduced to PARP1 protein in a CAR-T cell through a cytosine base editor by adopting the sgRNA, so that the tolerance of the CAR-T cell to a PARP inhibitor is remarkably improved, the CAR-T cell can be cooperatively used with the PARP inhibitor, and the anti-tumor effect is maximized.

Description

Technical Field

[0001] The present invention relates to the technical field of tumor immunotherapy, and in particular to a PARP inhibitor-tolerant CAR-T cell, a construction method and an application thereof. Background Art

[0002] PARP inhibitors (poly ADP ribose polymerase inhibitor, PARPi) are one of the widely used targeted drugs in cancer treatment. They are clinically used in breast cancer, ovarian cancer, prostate cancer, and some subtypes of colorectal cancer. They are also the only maintenance therapy drugs for ovarian cancer that effectively prolong the overall survival of patients. Clinical studies have shown that PARPi maintenance therapy can significantly delay the recurrence of ovarian cancer and reduce patient deaths. Taking Olaparib as an example, its first-line maintenance therapy can extend the median progression-free survival of patients by nearly 4 times. As a result, PARPi maintenance therapy has quickly become the first-line recommended drug for the treatment of ovarian cancer in domestic and foreign guidelines. Olaparib, Niraparib, Rucaparib and Pamiparib and other PARPi have also been approved by the China Food and Drug Administration or the US Food and Drug Administration for the treatment of ovarian cancer. However, PARPi monotherapy can only delay disease progression, but cannot prevent tumor recurrence. More than 40% of patients will still experience ovarian cancer recurrence within 5 years of receiving PARPi maintenance therapy.

[0003] The combination of PARPi and chimeric antigen receptor T cells (CAR-T) may provide a new solution to achieve the above vision. CAR-T therapy is one of the most cutting-edge and promising immunotherapies. It mainly transforms the patient's T cells into tumor-specific ones so that they can specifically identify and kill tumor cells. Because CAR-T cells have the ability to survive for a long time in the body and proliferate autonomously, this therapy has a natural advantage in long-term monitoring of tumors and prolonging patient survival. In ovarian cancer, the combination of PARPi and CAR-T can theoretically produce a "1+1>2" effect, mainly for the following reasons:

[0004] (1) Combination with PARPi is expected to solve the recognized problem that CAR-T cells have difficulty infiltrating into solid tumors. PARPi can recruit T lymphocytes to the local tumor by blocking the repair of tumor cell DNA damage. In 2020, researchers also found in a renal clear cell carcinoma model that short-term olaparib treatment can also increase the infiltration of CAR-T cells in the local tumor.

[0005] (2) PARPi can improve the immunosuppressive microenvironment and help T cells maintain their killing ability for a long time by regulating the number and function of Treg (regulatory T cells) and MDSC (myeloid-derived suppressor cells) in the ovarian cancer microenvironment. In the mouse model of triple-negative breast cancer, studies have also confirmed that PARPi can reduce the recruitment of MDSCs by reducing the release level of SDF1α in CAFs (cancer-associated fibroblasts), thereby reducing the functional inhibition of CAR-T cells.

[0006] In addition to the possibility of synergy in mechanism, PARPi has been widely used in the clinical treatment of ovarian cancer, and CAR-T has multiple clinical studies underway. The target populations and application scenarios of the two are also similar, and the feasibility of combined application in clinical practice is high. Therefore, the combined treatment strategy of PARPi and CAR-T is not only expected to control tumors more effectively, but also close to clinical practice, with great transformation potential, and deserves further research and optimization.

[0007] However, PARPi is highly toxic to CAR-T cells, and the maximum blood concentration (Cmax) of Olaparib can inhibit CAR-T cells by more than 80% after 72 hours of treatment. This toxicity makes it difficult for this combination strategy to fully release the potential of CAR-T and PARPi combined therapy. Summary of the invention

[0008] The technical problem to be solved by the present invention is to provide a PARP inhibitor-tolerant CAR-T cell, a construction method and an application thereof.

[0009] The technical solution of the present invention to solve the above technical problems is as follows:

[0010] The present invention provides an sgRNA for targeted editing of the PARP1 gene of a CAR-T cell, wherein the sequence of the sgRNA includes sg-D45, sg-S588 or sg-G745;

[0011] The nucleotide sequence of sg-D45 is shown in SEQ ID NO.1, the nucleotide sequence of sg-S588 is shown in SEQ ID NO.2, and the nucleotide sequence of sg-G745 is shown in SEQ ID NO.3.

[0012] The present invention also provides a PARP inhibitor-tolerant CAR-T cell, which is constructed using the above-mentioned sg-D45, sg-S588 or sg-G745.

[0013] Furthermore, in the PARP inhibitor-tolerant CAR-T cells, the amino acid sequence at position 588 of the PARP1 protein mutates from S to F, or the amino acid at position 745 of the PARP1 protein mutates from G to K, or the amino acid at position 45 of the PARP1 protein mutates from D to N, or the amino acid at position 43 of the PARP1 protein mutates from M to I.

[0014] The present invention also provides a method for constructing PARP inhibitor-tolerant CAR-T cells as described above, using the sgRNA as described above to edit the gene encoding PARP1 protein in the CAR-T cells through a cytosine base editor.

[0015] Further, the following steps are included:

[0016] The activated T cells are electroporated, and the sgRNA and CBE3 protein are transferred into the activated T cells by electroporation; CAR lentivirus is added to the T cell culture system for transfection and culture to obtain the PARP inhibitor-tolerant CAR-T cells.

[0017] Furthermore, the CBE3 protein is a fusion protein of nCas9 protein and cytosine deaminase.

[0018] Furthermore, the electroporation reagent is Lonza P3 Primary Cell 4D-Nucleofector TM X Kit.

[0019] Furthermore, the T cells were electroporated 24 hours after activation, and the transfection was performed 6 hours after electroporation.

[0020] The present invention also provides a use of the PARP inhibitor-tolerant CAR-T cells as described above, and the PARP inhibitor-tolerant CAR-T cells can be used to prepare an anti-tumor synergistic preparation.

[0021] The present invention also provides an anti-tumor synergistic preparation, comprising the PARP inhibitor-tolerant CAR-T cells as described above.

[0022] The beneficial effects of the present invention are:

[0023] The present invention introduces S588F, G745, D45N and M43I mutations into the PARP1 protein in CAR-T cells through a cytosine base editor (CBE), which significantly increases the tolerance of CAR-T cells to PARP inhibitors, so that they show good anti-tumor efficacy when combined with PARP inhibitors for treatment.

[0024] The construction method of the present invention can obtain PARP inhibitor-tolerant CAR-T cells with high gene editing efficiency and strong infectivity. After treatment with PARP inhibitors, DNA damage is significantly reduced and proliferation inhibition is also greatly reduced. At the same time, the PARP inhibitor-tolerant CAR-T cells have significant PARP inhibitor tolerance effects both in vitro and in vivo.

[0025] The PARP inhibitor-tolerant CAR-T cells of the present invention perform targeted modification on existing CAR-T cells to enable them to tolerate PARPi toxicity, thereby enabling them to be used in conjunction with PARP inhibitors to maximize the anti-tumor effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a schematic diagram of the construction process of the PARP inhibitor-tolerant CAR-T cell of Example 1 of the present invention;

[0027] Figure 2 This is a schematic diagram of the CAR molecule expression level of the PARP inhibitor-tolerant CAR-T cell of the present invention, Example 1;

[0028] Figure 3 This is a schematic diagram of the gene editing characteristics of the PARP inhibitor-tolerant CAR-T cell of the present invention, Example 1, Figure 3 A in the figure is a schematic diagram of the mutation site and base structure. Figure 3 B in the middle is the base conversion rate of each mutation;

[0029] Figure 4 This is a PARP inhibitor-tolerant CAR-T cell of the present invention. In Example 2, a comparison chart of cell activity of each experimental group at different Olaparib concentrations is shown. Figure 4 A is the first test group. Figure 4 Middle B is the second test group;

[0030] Figure 5 This is a PARP inhibitor-tolerant CAR-T cell of the present invention, a comparison chart of cell activity of each experimental group at a concentration of 25 μM Olaparib in Example 2;

[0031] Figure 6 This is a PARP inhibitor-tolerant CAR-T cell of the present invention, and a comparison chart of the fluorescence intensity of tumor cells in each experimental group at different Olaparib concentrations in Example 2;

[0032] Figure 7 This is a PARP inhibitor-tolerant CAR-T cell of the present invention. In Example 2, a comparison chart of the specific killing rate of tumor cells in each experimental group at different Olaparib concentrations is shown. Figure 7 A in the middle is SKOV3, Figure 7 B in the middle is OVCAR3, Figure 7 Middle C is OVCAR8;

[0033] Figure 8 The PARP inhibitor-tolerant CAR-T cells of the present invention, in Example 3, the changes in tumor volume in mice of each experimental group in the SKOV3 model, Figure 8 A in the middle is T cells, Figure 8 B in the middle is an unedited CAR-T cell. Figure 8 The C in the middle stands for CAR-T S588 , Figure 8 D in the figure is CAR-T D45 ;

[0034] Fig. 9 The PARP inhibitor-tolerant CAR-T cells of the present invention, in Example 3, in the ovarian cancer patient-derived transplanted tumor model, the changes in tumor volume in mice in each experimental group, Fig. 9 A in the middle is T cells, Fig. 9 B in the middle is an unedited CAR-T cell. Fig. 9 The C in the middle stands for CAR-T S588 ;

[0035] Fig.10 The PARP inhibitor-tolerant CAR-T cells of the present invention, in Example 3, in the ovarian cancer patient-derived transplanted tumor model, the changes in tumor volume in mice in each experimental group and the analysis of CAR-T cell tumor infiltration; Fig.10 A in the middle represents T cells, unedited CAR-T cells, and CAR-T S588 Schematic diagram of tumor size after combined treatment with Olaparib. Fig.10 B is a comparison chart of tumor weights in each group. Fig.10 Middle C shows the local tumor infiltration CAR-T and CAR-T detected by flow cytometry S588 Cell number, Fig.10 D in the middle is tumor infiltrating CAR-T and CAR-T S588 Cellular KI67 and γH2AX expression levels, Fig.10 Middle E shows the expression levels of KI67 and γH2AX in CAR-T cells in mouse spleen. Fig.10 F in the middle is tumor-infiltrating CAR-T and CAR-T S588 Schematic diagram of multicolor histochemical staining of KI67 and γH2AX expression levels in cells. Fig.10 G in Fig.10 Statistical chart of F in the figure. DETAILED DESCRIPTION

[0036] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0037] The present invention provides sgRNA for targeted editing of the PARP1 gene in CAR-T cells, and also provides methods for constructing PARP inhibitor-tolerant CAR-T cells and their construction.

[0038] The present invention introduces S588F, G745, D45N and M43I mutations into the PARP1 protein in CAR-T cells through a cytosine base editor (CBE), which significantly increases the tolerance of CAR-T cells to PARP inhibitors, so that they show good anti-tumor efficacy when combined with PARP inhibitors for treatment.

[0039] Specifically, the present invention mutates the human PARP1 gene by synchronously transferring sgRNA carrying the human PARP1 gene and CBE protein into CAR-T cells.

[0040] The principle of cytosine base editor (CBE) is to fuse nCas9 protein that can only cut single strands to produce gaps and cytosine deaminase into CBE3 protein, and rely on sgRNA to anchor the base editing enzyme to the target site. After CBE3 binds to the DNA target site, sgRNA and target site DNA form an "R loop" through complementary base sequence pairing, generating local single-stranded DNA (ssDNA), and deaminase deaminates cytosine (C) within a certain range on ssDNA in the "R loop" to uracil (U), and then converts U to thymine (T) through DNA repair or replication, ultimately achieving direct replacement of C to T or G to A.

[0041] The construction method of the present invention can not only successfully introduce S588F, G745, D45N and M43I mutation sites into the PARP1 gene, but also the constructed PARP inhibitor-tolerant CAR-T cells have high gene editing efficiency and strong infectivity. After treatment with PARP inhibitors, DNA damage is significantly reduced, and proliferation inhibition is also greatly reduced. At the same time, the PARP inhibitor-tolerant CAR-T cells have significant PARP inhibitor tolerance effects both in vitro and in vivo.

[0042] The PARP inhibitor-tolerant CAR-T cells of the present invention perform targeted modification on existing CAR-T cells to enable them to tolerate PARPi toxicity, thereby enabling them to be used in conjunction with PARP inhibitors to maximize the anti-tumor effect.

[0043] Specifically, the sgRNA for targeted editing of the PARP1 gene in CAR-T cells of the present invention includes sg-D45, sg-S588 or sg-G745; the nucleotide sequence of sg-D45 is shown in SEQ ID NO.1, the nucleotide sequence of sg-S588 is shown in SEQ ID NO.2, and the nucleotide sequence of sg-G745 is shown in SEQ ID NO.3.

[0044] In the PARP inhibitor-tolerant CAR-T cells of the present invention, the amino acid sequence at position 588 of the PARP1 protein mutates from S to F, or the amino acid at position 745 of the PARP1 protein mutates from G to K, or the amino acid at position 45 of the PARP1 protein mutates from D to N, or the amino acid at position 43 of the PARP1 protein mutates from M to I.

[0045] Preferably, in the PARP inhibitor-tolerant CAR-T cells of the present invention, the nucleotide sequence encoding the PARP1 protein includes a nucleotide sequence encoding the CART-T D45 Nucleotide sequence encoding CART-T S588 Nucleotide sequences encoding CART-T G745 nucleotide sequence.

[0046] For encoding CART-T D45 The nucleotide sequence is shown in SEQ ID NO.4, which is used to encode CART-T S588 The nucleotide sequence is shown in SEQ ID NO.5, which is used to encode CART-T G745 The nucleotide sequence is shown in SEQ ID NO.6.

[0047] SEQ ID NO.4: ATCAAACATGGGCGACTAGAAGG

[0048] SEQ ID NO.5: GTCCTGGGGCCGTGTGGGTACGG

[0049] SEQ ID NO.6: GGGACTAGGGGGTGCTGAAACCC

[0050] The present invention is described below by means of specific examples.

[0051] Example 1 Construction of PARP inhibitor-tolerant CAR-T cells

[0052] The construction process of PARP inhibitor-tolerant CAR-T cells in this example is as follows Figure 1 As shown, the specific construction process is as follows:

[0053] Take the required amount of T cells, activate them with anti-CD3 / CD28 antibodies, and start electroporation 24 hours after T cell activation. Use Lonza 4D-Nucleofector electroporator, select EH115 program, transfer GenScript EasyEdit sgRNA and CBE protein into T cells, and select Lonza P3 Primary Cell 4D-Nucleofector electroporator as electroporation reagent. TM X Kit, CBE protein was commercially available.

[0054] sgRNA sequences include:

[0055] SEQ ID NO.1(sg-D45):CAAACATGGGCGACTAGAAGG;

[0056] SEQ ID NO.2 (sg-S588): CCTGGGGCCGTGTGGGTACGG;

[0057] SEQ ID NO. 3 (sg-G745): GGGACTAGGGGGTGCTGAAACCC.

[0058] CAR lentivirus was added to the culture system for transfection 6 hours after electroporation. Cells were collected 3 days after electroporation, DNA was extracted, and the corresponding sites were specifically amplified and then subjected to first-generation sequencing.

[0059] The first-generation sequencing results were analyzed using EditR, a program that can estimate the editing efficiency based on the first-generation sequencing peak graph and detect CAR expression at the same time.

[0060] CAR molecule expression levels Figure 2 As shown, according to Figure 2 It can be seen that the S588F, G745, D45N and M43I mutations introduced on the PARP1 protein in CAR-T cells all have high expression levels, indicating that PARP1 gene editing does not affect the CAR expression level.

[0061] Gene editing features such as Figure 3 As shown, according to Figure 3 It can be seen that the constructed CAR-T cells have good gene editing efficiency.

[0062] Then, AOPI dye was used to estimate the number of surviving CAR-T cells after PARPi treatment for 3 / 6 / 9 days by the proportion of live cells and total cell number, and the proliferation curve was drawn. The inhibition rate of PARPi was calculated compared with the control group, and the IC was estimated by Prism9. 50 This experiment was conducted with two test groups. The experimental results of the first test group are as follows: Figure 4 Therefore, the experimental results of the second test group are as follows Figure 4 As shown in B.

[0063] Example 2 Changes in cell activity, DNA damage, and apoptosis levels of PARP inhibitor-tolerant CAR-T cells after treatment with PARP inhibitors

[0064] Take the required amount of T cells and start electroporation 24 hours after activation. Use Lonza4D-Nucleofector electroporator, select EH115 program, transfer GenScript EasyEdit sgRNA and CBE (25ug) protein into 1*10^6 T cells, and select Lonza P3 Primary Cell 4D-Nucleofector as electroporation reagent. TM X Kit. 6 hours after electroporation, CAR lentivirus was added to the culture system for transfection. After transfection, T cell complete culture medium (OpTmizer CTS T CellExpansion Basal Medium+200IU / mL human IL-2+50ng / mL human IL-15+40ng / mL humanIL-7+1%L-Glutamine+10%FBS) was used for culture and expansion. Cells were collected 72 hours after transfection. One part was used for flow cytometry to detect the proportion of CAR+ cells, and the other part was used for first-generation sequencing to detect the gene editing efficiency. CAR-T cells edited with sg-D45, sg-S588, and sg-G745 were named CAR-T, respectively. D45 , CAR-T S588 and CAR-T G745 .

[0065] PARP inhibitor-tolerant CAR-T cells were co-cultured with SKOV3, OVCAR3, and OVCAR8. Using an opaque 96-well plate, 20,000 tumor cells were added to one well, and the corresponding number of PARP inhibitor-tolerant CAR-T cells were added according to the E:T ratio of 2:1, 1:1, 1:2, 1:4, 1:8, and 1:16. The control group used unedited CAR-T cells. PARPi was added to the culture system to the specified concentration. The Cmax of Olaparib was selected as 25 μM. After 24 hours of co-culture in the above system, the fluorescence emission intensity of the tumor cells was recorded using a multifunctional microplate reader. By comparing with the control group, the amount of tumor cells remaining in the culture system was estimated, reflecting the in vitro tumor cell killing ability of PARP inhibitor-tolerant CAR-T cells combined with PARP inhibitors.

[0066] The experimental results are as follows Figure 5 to Figure 7 As shown, according to Figures 5 to 7It can be seen that PARP inhibitor-resistant CAR-T cells can significantly tolerate PARP inhibitors.

[0067] Example 3 Antitumor effect of PARP inhibitor-tolerant CAR-T cells combined with PARP inhibitors in an in vitro model

[0068] The mouse model used in this example is NCG mouse. The transplanted tumor model derived from ovarian cancer cell line was constructed with SKOV3 cells, and the transplanted tumor model derived from ovarian cancer patient tumor tissue was constructed. 5*10^6 SKOV3 tumor cells were injected into the subcutaneous part of the mouse. When the tumor grew to 100-200mm in size, 3 The mice were treated with PARP inhibitor-tolerant CAR-T combined with PARP inhibitors. Blood was collected from the mice every week, tumor size and mouse weight were measured every three days, and tumor tissue was collected 28 days after administration. Tumor tissue of 3*3mm in size was transplanted to the subcutaneous part of the mouse side wall. When the tumor grew to 100-200mm 3 The mice were treated with PARP inhibitor-tolerant CAR-T cells combined with PARP inhibitors. The blood of the mice was collected every week, the tumor size and mouse weight were measured every three days, and the tumor tissue was collected 28 days after administration.

[0069] In the SKOV3 model, the changes in tumor volume in mice of each experimental group were as follows: Figure 8 As shown in Figure 2, in the ovarian cancer patient-derived transplant tumor model, the tumor volume changes of each experimental group were as follows: Fig. 9 As shown. It can be seen that in the above two models, PARP inhibitor-resistant CAR-T cells combined with PARP inhibitors have a significant inhibitory effect on tumors in vivo.

[0070] In addition, in order to further evaluate CAR-T S588 The following tests were also performed to determine the tumor suppressor effect:

[0071] (1) The anti-tumor activity of PARP inhibitor-tolerant CAR-T combined with PARPi was evaluated by comparing the tumor growth curves of different groups and the tumor weight at the end of the experiment. The experimental results are as follows Fig.10 Middle A and Fig.10 As shown in B.

[0072] (2) The infiltration level of CAR-T cells in tumor cells was detected by multicolor flow cytometry. The specific operation was to take the same weight of tumor tissue after the tumor was harvested, digest it and label it with antibodies. The staining panel was live / dead-aqua / CD45-APCCY7 / CD3-PRECP-CY5.5 / CD4-BV785 / CD8-BV650 / CAR-FITC. The number of CAR+ cells was used to reflect the infiltration level of CAR-T cells in the local tumor. The experimental results are shown in Figure 2. Fig.10 As shown in C to E.

[0073] (3) Detect the infiltration level of CAR-T in tumor cells by multi-color histochemistry. The specific operation is to perform tissue embedding and multiple immunohistochemical staining after collecting the tumor. The staining should include three indicators: CD3 / CD8 / γH2AX. The experimental results are as follows: Fig.10 Medium F and Fig.10 As shown in G.

[0074] According to the above experimental results, it can be seen that the PARP inhibitor-tolerant CAR-T cells of the present invention have significantly reduced DNA damage and reduced proliferation inhibition after PARP inhibitor treatment compared to ordinary CAR-T cells. PARP inhibitor-tolerant CAR-T cells show good synergistic therapeutic effects when combined with PARP inhibitors to treat ovarian cancer.

[0075] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A sgRNA for targeted editing of the PARP1 gene in CAR-T cells, characterized in that: The sequence of the sgRNA includes sg-D45, sg-S588 or sg-G745; The nucleotide sequence of sg-D45 is shown in SEQ ID NO.1, the nucleotide sequence of sg-S588 is shown in SEQ ID NO.2, and the nucleotide sequence of sg-G745 is shown in SEQ ID NO.

3.

2. A PARP inhibitor-tolerant CAR-T cell, characterized in that: The method is constructed using sg-D45, sg-S588 or sg-G745 as described in claim 1.

3. A PARP inhibitor-tolerant CAR-T cell according to claim 2, characterized in that: In the PARP inhibitor-tolerant CAR-T cells, the amino acid sequence at position 588 of the PARP1 protein mutates from S to F, or the amino acid at position 745 of the PARP1 protein mutates from G to K, or the amino acid at position 45 of the PARP1 protein mutates from D to N, or the amino acid at position 43 of the PARP1 protein mutates from M to I.

4. A method for constructing PARP inhibitor-tolerant CAR-T cells as claimed in claim 2 or 3, characterized in that: Using the sgRNA as described in claim 1, the gene encoding PARP1 protein in CAR-T cells is edited by a cytosine base editor.

5. The method for constructing a PARP inhibitor-tolerant CAR-T cell according to claim 4, characterized in that: The following steps are involved: The activated T cells are electroporated, and the sgRNA and CBE3 protein are transferred into the activated T cells by electroporation; CAR lentivirus is added to the T cell culture system for transfection and culture to obtain the PARP inhibitor-tolerant CAR-T cells.

6. The method for constructing a PARP inhibitor-tolerant CAR-T cell according to claim 5, characterized in that: The CBE3 protein is a fusion protein of nCas9 protein and cytosine deaminase.

7. The method for constructing PARP inhibitor-tolerant CAR-T cells according to claim 5, characterized in that: The electroporation reagent is Lonza P3 Primary Cell 4D-Nucleofector TM XKit.

8. The method for constructing PARP inhibitor-tolerant CAR-T cells according to claim 5, characterized in that: The T cells were electroporated 24 hours after activation, and the transfection was performed 6 hours after electroporation.

9. A use of the PARP inhibitor-tolerant CAR-T cells as claimed in claim 2 or 3, characterized in that: The PARP inhibitor-tolerant CAR-T cells can be used to prepare anti-tumor synergistic preparations.

10. An anti-tumor synergistic preparation, characterized in that: Comprising the PARP inhibitor-tolerant CAR-T cells as described in claim 2 or 3.

Images