Relevant gene for resisting tobacco target leaf spot as well as construction and application thereof

Abstract

The invention relates to the technical field of plant pathologic gene engineering, and discloses a related gene for resisting tobacco target leaf spot as well as construction and application of the related gene, and the related gene is obtained by researching antagonistic genes related to tobacco antagonistic tobacco target leaf spot pathogenic bacteria, locating organelles where the antagonistic genes are located and determining the expression quantity of the anti-disease genes. By constructing a subcellular localization vector of the anti-disease gene, an important material is provided for preventing and treating pathogenic bacteria of tobacco target leaf spot.

Description

Technical Field

[0001] The invention relates to the technical field of plant pathological gene engineering, and in particular to a gene related to resistance to tobacco target spot disease and the construction and application thereof. Background Art

[0002] Tobacco target spot is a fungal disease caused by the fungus Pseudomonas aeruginosa. Tobacco target spot can occur from the seedling stage of tobacco plants to the maturity stage of tobacco leaves, infecting leaves and damaging stems at the same time. The infected leaves are initially circular water-soaked spots. If the temperature / humidity is high and the leaves are moist for a long time, the spots will expand rapidly to form irregular plates with a diameter of 2-20 cm, with concentric rings, forming chlorotic halo spots, and the necrotic part of the spots is fragile and perforated, resembling the holes left on the target after a bullet is shot, so it is called target spot. When the humidity is high, mycelium and the hymenium and basidiospores of the sexual generation often appear on the edge of the spots on the lower surface of the leaves.

[0003] At present, the prevention and control measures for tobacco target spot disease are only chemical pesticides, but the use of chemical agents for prevention and control will have pesticide residues, which seriously pollute the environment and cause harm to humans and animals. In addition, long-term use of the same chemical pesticides will cause the plants to develop a certain resistance, and the prevention and control effect will be greatly reduced. Although biological control does not pollute the environment and will not harm the health of humans and animals, it has problems such as slow effectiveness and great environmental impact on the prevention and control effect. With the development of genetic engineering technology, the research on antagonistic / stress-resistant genes has received more and more attention. Studying the expression level of antagonistic / stress-resistant genes can not only systematically study the disease resistance process of tobacco, but also better guide the screening and cultivation of excellent plants that antagonize tobacco target spot pathogens. Summary of the invention

[0004] The purpose of the present invention is to provide a gene related to resistance to tobacco target spot disease and its construction and application, by studying antagonistic genes related to tobacco target spot disease, locating the organelles where the antagonistic genes are located, determining the expression level of the antagonistic genes, and constructing a subcellular localization vector of the antagonistic genes, to provide important materials for preventing and controlling tobacco target spot disease pathogens.

[0005] The scheme of the present invention is:

[0006] A gene related to resistance to tobacco target spot disease, the nucleotide sequence of the gene related to resistance to tobacco target spot disease is shown as SEQ ID NO.1.

[0007] The present invention also discloses a method for measuring the expression level of genes related to resistance to tobacco target spot disease, comprising the following steps:

[0008] S1. After tobacco target spot pathogens infect tobacco, total RNA of tobacco is extracted and reverse transcribed into cDNA;

[0009] S2. Design primers based on the specific region of the antagonist gene to obtain fluorescent quantitative PCR primers:

[0010] S3, using the cDNA in step S1 as a template and the fluorescent quantitative PCR primers in step S2 to perform real-time fluorescent quantitative PCR analysis;

[0011] S4. After the reaction is completed, the fluorescence signal of the melting curve is collected, and the Ct value is derived according to the melting curve.

[0012] As a preferred technical solution, the fluorescent quantitative PCR primers in S2 are fluorescent quantitative PCR primers with the following sequences:

[0013] SEQ ID NO.2: Upstream primer: GCAGGAGCTGGTAGAATGGG;

[0014] SEQ ID NO.3: Downstream primer: ATGGCATCGGCATTTGCATC.

[0015] As a preferred technical solution, the PCR amplification system in the PCR analysis in step S3 is:

[0016] 2 μL template cDNA, 0.5 μL upstream primer, 0.5 μL downstream primer, 10 μL 2×ChamQ Universal SYBR q PCR Master Mix, 7 μL sterile water; the real-time fluorescence quantitative PCR amplification reaction program was: 95°C pre-denaturation for 30 s, 95°C denaturation for 5 s, 60°C annealing for 15 s, 72°C extension for 15 s, and 40 cycles.

[0017] The present invention also discloses a method for constructing a subcellular localization vector of a gene related to resistance to tobacco target spot disease, comprising the following steps:

[0018] 1) Primer design: design target sequence amplification primers and identification primers based on the highest expression level of genes related to tobacco target spot resistance, import the vector sequence into snapgene software for sequence analysis, select appropriate restriction sites and design homology arms of amplification primers;

[0019] 2) PCR amplification of the target fragment, adding polymerase, the amplification primer, template and deionized water into a PCR tube to obtain a PCR system, placing the PCR system into a PCR instrument, setting a program, and obtaining the amplified target fragment;

[0020] 3) Plasmid extraction, extracting vector plasmid;

[0021] 4) Vector digestion and ligation: After configuring a 50L double digestion system according to the selected digestion sites, incubate in a water bath at 37°C for 3 hours, and cut the gel to recover the digestion product; according to the concentration of the target fragment and the vector, mix the two in a certain proportion, then add homologous recombination enzyme and buffer to configure a homologous recombination reaction system, react at 37°C for 30 minutes, and then immediately cool on ice to obtain the ligation product;

[0022] 5) Transformation: Add the ligation product to DH5a E. coli competent cells, tap to mix, place on ice for 5 min, then heat shock at 42°C for 30 s, place back on ice for 5 min, add antibiotic-free LB medium and incubate on a shaker at 37°C for 30 min, spread on antibiotic solid plates, and incubate at 37°C overnight;

[0023] 6) Identification: Pick multiple monoclonal colonies from the transformed antibiotic solid plate, perform PCR positive detection, and identify the PCR products by agarose gel electrophoresis;

[0024] 7) Sequencing: The identified positive colony liquid was cultured in the corresponding resistance liquid LB medium at 37°C in a shaking incubator overnight, and a portion of the bacterial liquid was sent for sequencing to determine the positive colonies that were sequenced correctly.

[0025] As a preferred technical solution, the program in 2) is set as 95°C pre-denaturation for 3 minutes, 98°C denaturation for 30 seconds, 60°C annealing for 15 seconds, 72°C extension for 15 seconds, and 72°C complete extension for 5 minutes, and 34 cycles are performed.

[0026] As a preferred technical solution, the antibiotic solid plate in 6) is a kanamycin antibiotic solid plate.

[0027] The invention also discloses the application of a gene related to resistance to tobacco target spot disease in subcellular localization and cultivation of tobacco varieties antagonistic to tobacco target spot disease bacteria.

[0028] Advantages of the present invention:

[0029] The method for constructing genes related to tobacco antagonism to tobacco target spot pathogens and their subcellular localization vectors provided in the present application uses real-time fluorescence quantitative PCR to screen out antagonistic genes related to expression that are significantly upregulated in transcriptome sequencing of tobacco infected with target spot pathogens, and constructs subcellular localization vectors of related antagonistic genes, which is convenient for observing the location of related antagonistic genes on the chloroplasts of tobacco cells through a laser confocal microscope, providing a theoretical basis for understanding the action mechanism of related antagonistic genes and providing guidance for breeding tobacco varieties antagonistic to tobacco target spot pathogens. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the prior art descriptions. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work. Among them:

[0031] Figure 1 This is a qPCR analysis diagram of the tobacco target spot disease-related disease resistance gene NtRCA3 provided in Example 1 of the present invention;

[0032] Figure 2 The subcellular localization vector map of the tobacco target spot disease-related resistance gene NtRCA3 provided in Example 1 of the present invention;

[0033] Figure 3 This is a subcellular localization observation diagram of the tobacco target spot disease-related disease resistance gene NtRCA3 provided in Example 1 of the present invention. DETAILED DESCRIPTION

[0034] In order to make the technical means, creative features, objectives and effects achieved by the present invention easy to understand, the present invention is further described below in conjunction with specific embodiments.

[0035] The present invention uses a real-time fluorescence quantitative PCR method to screen out the gene NtRCA3 that is significantly upregulated in transcriptome sequencing of tobacco infected by target leaf spot pathogen, constructs a subcellular localization vector of the NtRCA3 gene, and observes that the gene is located on the chloroplast of tobacco cells through a laser confocal microscope, providing a theoretical basis for understanding the mechanism of action of the gene and providing guidance for cultivating tobacco varieties antagonistic to tobacco target leaf spot pathogen.

[0036] Embodiment 1:

[0037] Unless otherwise specified, the methods used in this example are conventional methods known to those skilled in the art, and the reagents and other materials used are commercially available products unless otherwise specified.

[0038] 1. Methods

[0039] 1.1 Screening of antagonistic genes

[0040] Tobacco with the same growth conditions were selected to be inoculated with tobacco target spot pathogen cakes, and samples were taken at 0h, 6h, 12h, 24h, 48h, 72h, 96h, and 120h and sent for transcriptome sequencing. After analysis, it was found that the expression level of NtRCA3 gene was significantly upregulated 24h after tobacco target spot pathogen infection, and its nucleotide sequence is as shown in SEQ ID NO.1.

[0041] 1.1.1 Primer design

[0042] Primer 5.0 software was used to design QPCR primers for the NtRCA3 gene. The primer sequences are shown in Table 1 below.

[0043]

[0044] 1.1.2 Extraction and reverse transcription of total RNA from tobacco leaves

[0045] Tobacco leaves with the same growth conditions were selected and inoculated with tobacco target spot pathogen cakes, and tobacco leaves were collected after treatment for 0 h, 6 h, 12 h, 24 h, 48 h, 72 h, 96 h, and 120 h, respectively. The total RNA of tobacco leaves was extracted using the SPARKeasy plant RNA rapid extraction kit produced by Shandong Skyjet Biotechnology Co., Ltd., and the extracted RNA was reverse transcribed into cDNA using the reverse transcription kit TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix produced by Beijing Quanshijin Biotechnology Co., Ltd., and used as template cDNA for standby use.

[0046] 1.1.3 Real-time fluorescence quantitative PCR analysis

[0047] The ChamQ Universal SYBR qRCR MasterMix real-time fluorescence quantitative PCR kit of Nanjing Novogene Biotechnology Co., Ltd. was used for quantitative analysis. The PCR amplification system was 2 μL template cDNA, 0.5 μL upstream primer, 0.5 μL downstream primer, 10 μL 2×ChamQ Universal SYBR qRCR Master Mix, and 7 μL sterile water; the real-time fluorescence quantitative PCR amplification reaction program was: 95°C pre-denaturation for 30 s, 95°C denaturation for 5 s, 60°C annealing for 15 s, 72°C extension for 15 s, and 40 cycles. After the reaction, the fluorescence signal of the melting curve was collected, and the Ct value was derived according to the melting curve. The relative expression of each gene in different time periods was calculated according to the internal reference gene. -ΔCt .

[0048] 1.2 Construction of NtRCA3 subcellular localization vector

[0049] 1.2.1 Primer design

[0050] The NtRCA3 gene with the highest relative expression level in real-time fluorescence quantitative PCR analysis was selected to design target sequence amplification primers and identification primers, the vector sequence was introduced into snapgene for sequence analysis, appropriate restriction sites were selected and homologous arms of amplification primers were designed.

[0051] 1.2.2 PCR amplification of target fragment

[0052] Add 25 μL 2xPrimeSTAR Max Premix, 2 μL each of upstream primer: gcttcgttttgaatcGTCGACatggctacctcagtgtcaaccattg, downstream primer: ccttgctcaccatCAGGATCCttagaagtttccagtgttgatggcatcgg, 1 μL template and 20 μL ddH20 to a 50 μL PCR system. After the system is prepared, put it into the PCR instrument and set the program:

[0053] Pre-denaturation at 95°C for 3 min, denaturation at 98°C for 30 s, annealing at 60°C for 15 s, extension at 72°C for 15 s, and complete extension at 72°C for 5 min, for 34 cycles.

[0054] 1.2.3 Plasmid extraction

[0055] Extract the vector plasmid using the Beijing Quanshijin Biotechnology Co., Ltd. small plasmid extraction kit according to the instructions for plasmid extraction.

[0056] 1.2.4 Vector digestion and ligation

[0057] According to the above steps, select the restriction sites, configure into 50μL double restriction system, incubate in 37℃ water bath for 3h, cut the gel to recover the restriction product. According to the homologous recombination enzyme instructions, according to the concentration of the target fragment and the vector, mix the two in a certain proportion, then add the homologous recombination enzyme and buffer, configure into homologous recombination reaction system, react at 37℃ for 30min, and immediately cool on ice.

[0058] 1.2.5 Conversion

[0059] Take out 100 μL of DH5a competent E. coli cells from the -80°C refrigerator, melt them on ice, add 10 μL of the ligation product, tap to mix, place on ice for 5 min, then heat shock at 42°C for 30 s, place back on ice for 5 min, add 900 μL of antibiotic-free LB medium, incubate on a shaker at 37°C for 30 min, spread on a Kan (kanamycin) antibiotic solid plate, and incubate at 37°C overnight.

[0060] 2.2.6 Identification of positive clones by colony PCR

[0061] Multiple monoclonal colonies were picked for PCR positive detection. The upstream primer sequence was gagttgatccatcattggaagc, and the downstream primer sequence was gtggtgcagatgaacttcag. The PCR products were identified by agarose gel electrophoresis.

[0062] 1.2.7 Sequencing

[0063] The identified positive colony solution was incubated in a shaking incubator at 37°C overnight using the corresponding resistance liquid LB medium, and part of the bacterial solution was sent for sequencing, and the positive colonies with correct sequencing were used for Agrobacterium transformation.

[0064] 1.3 Subcellular localization of NtRCA3 gene

[0065] 1.3.1 Agrobacterium transformation

[0066] Take out 100 μL of Agrobacterium competent cells from the -80℃ refrigerator and melt them on ice, add 10 μL of plasmid, tap to mix, place on ice for 5 minutes, place in liquid nitrogen for 5 minutes, heat shock water bath at 37℃ for 5 minutes, place on ice for 2 minutes, add 900mL of antibiotic-free liquid LB medium, and shake at 28℃ for 2 hours. Centrifuge at 5000rpm for 1 minute, discard the excess supernatant in the clean bench, keep about 100 μL of medium, and mix with a pipette. Spread on Kan (kanamycin) antibiotic solid plate and culture in 28℃ incubator for 2 days.

[0067] 1.3.2 Preparation of tobacco injection buffer

[0068] Prepare MgCl (100mM) stock solution, sterilize at 121℃ for 20min, and store in a 4℃ refrigerator. Weigh 0.0196g acetosyringone (AS) powder and dissolve it in 100μL dimethyl sulfoxide (DMSO), prepare it for use, and store it in multiple tubes at -20℃. AS can activate the Vir gene of Agrobacterium and promote the integration of foreign genes. When using the injection buffer, dilute the MgCl (100mM) stock solution to 10mM.

[0069] 1.3.3 Agrobacterium infection of plants

[0070] Pick monoclonal colonies on solid culture medium and perform colony PCR identification. Add the identified positive colony solution to 2mL Kan (kanamycin) resistant liquid LB medium, shake at 28℃ for 24h until the solution turns orange-yellow, transfer to 10mL Kan (kanamycin) resistant liquid LB medium, shake at 28℃ for 24h until yellow, centrifuge at 5000rpm for 10min, discard the supernatant, and resuspend the bacteria with tobacco injection buffer. Use LB liquid culture medium with corresponding antibiotics as blank control, dilute OD600 to 0.6-0.8, and incubate the resuspended bacteria at 28℃ in the dark for 2-3h. Remove the needle from a 1mL sterile syringe, absorb the resuspended bacteria and inject them into 6-8 weeks of Nicotiana benthamiana, and inject them into the back of Nicotiana benthamiana leaves by infiltration. After 48h in the dark, observe the subcellular localization of the gene under a laser confocal microscope.

[0071] 2. Effect measurement

[0072] By constructing localization vectors of related genes, the subcellular localization of genes related to tobacco resistance to tobacco target spot pathogens is studied, providing important materials for the prevention and control of tobacco target spot pathogens.

[0073] from Figure 1-3 It can be seen that the subcellular localization vector pCAMBIA1300-NtRCA3 was constructed by real-time fluorescence quantitative PCR to verify the gene NtRCA3 whose expression level was significantly upregulated in the transcriptome sequencing of tobacco infected by tobacco target spot pathogen. After the subcellular localization vector was constructed, it was transferred into Agrobacterium GV3101. By injecting Nicotiana benthamiana for heterologous expression, it was observed under a laser confocal microscope that the gene was located in the chloroplast. This provides a theoretical basis for understanding the mechanism of action of related genes and provides guidance for breeding tobacco varieties resistant to tobacco target spot disease.

[0074] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A gene related to resistance to tobacco target spot disease, characterized in that: The nucleotide sequence of the gene related to resistance to tobacco target spot is shown in SEQ ID NO.

1.

2. A method for measuring the expression level of genes related to resistance to tobacco target spot disease as claimed in claim 1, characterized in that: The following steps are involved: S1. After tobacco target spot pathogens infect tobacco, total RNA of tobacco is extracted and reverse transcribed into cDNA; S2. Design primers based on the specific region of the antagonist gene to obtain fluorescent quantitative PCR primers: S3, using the cDNA in step S1 as a template and the fluorescent quantitative PCR primers in step S2 to perform real-time fluorescent quantitative PCR analysis; S4. After the reaction is completed, the fluorescence signal of the melting curve is collected, and the Ct value is derived according to the melting curve.

3. The method for measuring the expression level of genes related to resistance to tobacco target spot disease according to claim 2, characterized in that: The fluorescent quantitative PCR primers in S2 are fluorescent quantitative PCR primers with the following sequences: SEQ ID NO.2: Upstream primer: GCAGGAGCTGGTAGAATGGG; SEQ ID NO.3: Downstream primer: ATGGCATCGGCATTTGCATC.

4. The method for measuring the expression level of genes related to resistance to tobacco target spot disease according to claim 2, characterized in that: The PCR amplification system in the PCR analysis in step S3: 2 μL template cDNA, 0.5 μL upstream primer, 0.5 μL downstream primer, 10 μL 2×ChamQ Universal SYBR qRCRMaster Mix, 7 μL sterile water; the real-time fluorescence quantitative PCR amplification reaction program was: 95°C pre-denaturation for 30 s, 95°C denaturation for 5 s, 60°C annealing for 15 s, 72°C extension for 15 s, and 40 cycles.

5. A method for constructing a subcellular localization vector of a gene related to resistance to tobacco target spot disease as claimed in claim 1, characterized in that: The following steps are involved: 1) Primer design: design target sequence amplification primers and identification primers based on the highest expression level of genes related to tobacco target spot resistance, import the vector sequence into snapgene software for sequence analysis, select appropriate restriction sites and design homology arms of amplification primers; 2) PCR amplification of the target fragment, adding polymerase, the amplification primer, template and deionized water into a PCR tube to obtain a PCR system, placing the PCR system into a PCR instrument, setting a program, and obtaining the amplified target fragment; 3) Plasmid extraction, extracting vector plasmid; 4) Vector digestion and ligation: After configuring a 50L double digestion system according to the selected digestion sites, incubate in a water bath at 37°C for 3 hours, and cut the gel to recover the digestion product; according to the concentration of the target fragment and the vector, mix the two in a certain proportion, then add homologous recombination enzyme and buffer to configure a homologous recombination reaction system, react at 37°C for 30 minutes, and then immediately cool on ice to obtain the ligation product; 5) Transformation: Add the ligation product to DH5a E. coli competent cells, tap to mix, place on ice for 5 min, then heat shock at 42°C for 30 s, place back on ice for 5 min, add antibiotic-free LB medium and incubate on a shaker at 37°C for 30 min, spread on antibiotic solid plates, and incubate at 37°C overnight; 6) Identification: Pick multiple monoclonal colonies from the transformed antibiotic solid plate, perform PCR positive detection, and identify the PCR products by agarose gel electrophoresis; 7) Sequencing: The identified positive colony liquid was cultured in the corresponding resistance liquid LB medium at 37°C in a shaking incubator overnight, and a portion of the bacterial liquid was sent for sequencing to determine the positive colonies that were sequenced correctly.

6. The method for constructing a subcellular localization vector of a gene related to resistance to tobacco target spot disease according to claim 5, characterized in that: The program in 2) is set as 95°C pre-denaturation for 3 min, 98°C denaturation for 30 s, 60°C annealing for 15 s, 72°C extension for 15 s, and 72°C complete extension for 5 min, and 34 cycles are performed.

7. The method for constructing a subcellular localization vector of a gene related to resistance to tobacco target spot disease according to claim 5, characterized in that: The antibiotic solid plate in 6) is a kanamycin antibiotic solid plate.

8. Use of the gene related to resistance to tobacco target spot disease according to any one of claims 1 to 7 in subcellular localization and cultivation of tobacco varieties antagonistic to tobacco target spot disease.

Images