Rice oslrg1 gene and application thereof in rice resistance to blast

By cloning the rice OsLRG1 gene and utilizing CRISPR/Cas9 technology, the problems of narrow resistance spectrum and insufficient stability of existing rice blast resistance genes have been solved, achieving broad-spectrum resistance and hypersensitive response to rice blast, which has significant breeding application potential.

CN119752941BActive Publication Date: 2026-03-27FUJIAN AGRI & FORESTRY UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-09
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Existing rice blast resistance genes have problems such as narrow resistance spectrum and insufficient stability, making it difficult to meet the challenges brought about by the rapid mutation and evolution of rice blast, leading to increased breeding complexity.

Method used

The rice OsLRG1 gene was cloned and applied. A recombinant vector was constructed using CRISPR/Cas9 technology to knock out the gene. Its resistance to rice blast was observed and analyzed, and a hypersensitivity response was induced in tobacco.

Benefits of technology

The OsLRG1 gene significantly enhances rice resistance to rice blast, broadens the resistance spectrum, and exhibits a hypersensitive response in tobacco, demonstrating significant value for breeding applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119752941B_ABST
    Figure CN119752941B_ABST
Patent Text Reader

Abstract

The application discloses a rice OsLRG1 gene and application thereof in rice blast resistance. OsLRG1 The nucleotide sequence of the gene is shown as SEQ ID NO:1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO:2. The CDS sequence of the gene is 2574 bp long, and the protein encoded by the gene has 858 amino acids. The protein encoded by the gene has CC, NB-ARC and LRR domains, and belongs to one of the most typical disease-resistant proteins NBS-LRR class protein family members in plants. OsLRG1 The gene , It is found that the gene can reduce the resistance of rice to Magnaporthe oryzae, and it is proved that the gene has a positive regulation in the rice blast resistance reaction. The application can make up for the deficiency of the existing rice blast resistance genes, and the application of the gene in rice can improve the rice blast resistance caused by Magnaporthe oryzae.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to rice. OsLRG1 Genes and their application in rice blast resistance. Background Technology

[0002] Rice ( Oryzasativa Rice (L.) is one of the world's most important food crops, providing a primary food source for more than half of the world's population. However, with the intensification of global climate change and the large-scale outbreak of natural diseases, rice production faces unprecedented challenges. This is especially true for rice blast fungi (L.). Magnaportheoryzae Rice blast, caused by *Strombus haematous*, is known as the "cancer" of rice cultivation, posing a serious threat to rice yield and quality. It can infect rice at multiple stages of its growth, including leaves, stems, and spikelets, and in severe cases can lead to yield losses of up to 80% or even total crop failure. Although the damage caused by rice blast has been mitigated through agronomic management, chemical control, and the promotion of resistant varieties, its rapid mutation and evolutionary capabilities limit the lifespan of existing resistant varieties, making it difficult to meet production demands. Breeding resistant varieties is considered the most economical, environmentally friendly, and efficient strategy for rice blast control. However, the key to resistant breeding lies in the discovery and utilization of resistance genes. To date, more than 100 loci related to rice blast resistance have been located in the rice genome, but only about 30 resistance genes have been cloned, and most of them suffer from narrow resistance spectrums and insufficient stability. The high variability of *Strombus haematous* further complicates breeding efforts. Therefore, discovering and applying new genes with broad-spectrum and durable resistance to rice blast has become the core task of rice resistance breeding research. Summary of the Invention

[0003] The purpose of this invention is to provide rice OsLRG1 The study aims to investigate the genes and their application in rice blast resistance, thereby addressing the deficiencies in existing rice blast resistance genes and applying them to rice breeding to improve rice disease resistance, especially resistance to rice blast. This will provide important genetic resources for the green control of rice blast through resistance breeding.

[0004] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0005] This invention proposes a rice blast resistance gene. OsLRG1 Its nucleotide sequence is shown in SEQ ID NO.1.

[0006] Furthermore, the rice blast resistance gene... OsLRG1 The amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0007] This invention also provides a novel rice blast resistance gene containing the above-mentioned gene.OsLRG1 Recombinant vectors and recombinant engineered bacteria.

[0008] This invention also provides the above-mentioned rice blast resistance gene. OsLRG1 Application in the prevention and control of rice blast disease.

[0009] This invention also provides the above-mentioned rice blast resistance gene. OsLRG1 Application in inducing tobacco hypersensitivity reactions.

[0010] This invention also provides a novel gene for rice resistance to rice blast. OsLRG1 The functional identification method includes the following steps:

[0011] S1: Introducing a new gene for rice resistance to rice blast. OsLRG1 The expression vector was cloned into the pYLCRISPR / Cas9Pubi-H vector.

[0012] S2: The expression vector was transformed into rice using Agrobacterium-mediated transformation to obtain... OsLRG1 Gene knockout mutant plants;

[0013] S3: Will OsLRG1 After the seeds of gene knockout mutant plants were cultured to the three-leaf stage, they were inoculated with a spore suspension of rice blast fungus. After 7 days of culture, the leaf lesion area was observed, recorded, and analyzed.

[0014] Furthermore, S1 specifically includes the following steps:

[0015] Reference sequencing OsLRG1 The sequence was obtained, and the knockout target was predicted using CRISPR-P online analysis software;

[0016] After designing target primers, the target fragment was amplified. After confirming the target band, the amplified fragment was recovered. The recovered fragment was ligated into the pYLCRISPR / Cas9Pubi-H expression vector via Goldden Gate cloning and transformed into E. coli DH5α.

[0017] Furthermore, the target primers include:

[0018] OsLRG1-TF, the sequence of which is shown in SEQ ID NO.5; and OsLRG1-TR, the sequence of which is shown in SEQ ID NO.6.

[0019] Furthermore, S2 also includes... OsLRG1 Molecular identification of DNA from gene knockout mutant plants;

[0020] Molecular identification methods specifically include the following steps:

[0021] The hygromycin primers hygF and hygR are designed, and a section of the hygromycin gene of the mutant plant with the gene knockout is amplified, and a 1035bp size fragment is amplified as a positive plant;

[0022] Seeds of the positive plant are collected, and after sowing, young leaves are taken to extract DNA for mutation detection of the target site;

[0023] The primers OsLRG1-L-F and OsLRG1-L-R containing the target site fragment PCR are designed, and a 631bp size fragment is amplified for sequencing analysis, and the sequencing result is that the plant with a frameshift mutation is a homozygous knockout plant, and the offspring is a homozygous Cas9 knockout mutant plant.

[0024] The sequence of the hygF is shown as SEQ ID NO. 7, and the sequence of the hygR is shown as SEQ ID NO. 8; the sequence of the OsLRG1-L-F is shown as SEQ ID NO. 9, and the sequence of the OsLRG1-L-R is shown as SEQ ID NO. 10.

[0025] Further, the spore suspension of Magnaporthe grisea is inoculated in S3, and after 7 days of culture, the leaf lesion area is observed, recorded and analyzed, and the specific steps are as follows:

[0026] The spore suspension of Magnaporthe grisea at 1.0x10 5 ~2.0x10 5 / mL is sprayed and inoculated by using a high-pressure atomizer, and after 7 days of culture in an inoculation room, the leaf lesion is observed (taking the second young leaf as the standard), photographed and recorded, and the lesion area is analyzed by using ImageJ software.

[0027] The beneficial effects of the present application are as follows:

[0028] The new rice Magnaporthe grisea resistance gene of the present application OsLRG1 is first cloned from rice, and the CDS is 2574bp long, encoding a protein of 858 amino acids. It is predicted by the CDD online program that the protein has CC, NB-ARC and LRR domains, and belongs to the typical NBS-LRR type protein. By comparing the tolerance of rice Cas9 knockout mutants and wild type rice to Magnaporthe grisea, it is found that OsLRG1 the gene can improve the Magnaporthe grisea resistance of rice. At the same time, it is found that OsLRG1 the gene can also induce hypersensitive reaction cell death in tobacco leaves, and its application in the field of genetic engineering has important economic value and application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 The electrophoresis map of the PCR product of the present application embodiment 1 OsLRG1 on agarose gel.

[0030] Figure 2 As in Embodiment 1 of the present invention OsLRG1 Predicted map of conserved domains of gene-encoded proteins.

[0031] Figure 3 This is an agarose gel electrophoresis image showing target fragment amplification (A) and positive colony detection (B) during the construction of the pYLCRISPR / Cas9Pubi-H-OsLRG1 vector in Example 2 of the present invention.

[0032] Figure 4 This is a flowchart of Agrobacterium-mediated rice genetic transformation in Example 3 of the present invention.

[0033] Figure 5 The image shows a mutation detection diagram of the DNA target site in the young leaves of T0-positive transgenic plants in Example 3.

[0034] Figure 6 This is Example 4 of the present invention. OsLRG1 Comparison of leaf area (A) and leaf lesion area (B) of mutant plants and wild-type rice 7 days after inoculation with rice blast fungus.

[0035] Figure 7 This is Example 5 of the present invention. OsLRG1 A diagram showing the results of transient expression of the gene and its mutant genes (M-1 and M-3) in tobacco inducing tobacco hypersensitivity. Detailed Implementation

[0036] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.

[0037] Example 1

[0038] This embodiment provides a novel gene for rice resistance to rice blast. OsLRG1 The cloning method includes the following steps:

[0039] (1) Preparation of materials

[0040] Rice varietal materials and Escherichia coli DH5α (Takara 9057). Among them, rice varietal ZH11 was used for RNA extraction and was provided by Wuhan Boyuan Biotechnology Co., Ltd.

[0041] (2) New genes for rice resistance to rice blast OsLRG1 Cloning and transformation

[0042] According to NCBI OsLRG1 The annotation information is as follows: its full length is 2574 bp. A pair of specific primers was designed using Primer 5.0, and their nucleotide sequences are as follows:

[0043] OsLRG1-F: ATGGCAGAGGCAGTACTCCT (SEQ ID NO. 3);

[0044] OsLRG1-R: CTATATACGGACCTCTGCAACAT (SEQ ID NO. 4).

[0045] Total RNA was extracted from rice seedlings at the three-leaf stage using the Trizol reagent method, and reverse-transcribed into cDNA as a PCR reaction template. Vazyme Phanta Max Super-Fidelity DNA Polymerase (Vazyme, China) was used for amplification reaction. The PCR products were detected by 1% agarose gel electrophoresis and purified (as shown in OsLRG1 The PCR reaction system of the gene is shown in Table 1, and the total volume is 50 μL. The PCR reaction program is as follows:

[0046] 95 °C pre-denaturation for 3 min→ (95 °C denaturation for 30 s→ 58 °C annealing for 15 s→ 72 °C extension for 30 s) x 30 cycles→ 65 °C complete extension for 5 min→ 4 °C storage.

[0047] The PCR products were detected by 1% agarose gel electrophoresis and purified (as shown in Figure 1 then treated with DNA A-Tailing Kit (Takara 6109) and subjected to TA cloning, with pMD18-T as the vector. Three positive clone bacterial liquids were selected for sequencing. The full length of the rice blast resistance gene OsLRG1 obtained by cloning was 2574 bp. Analysis and prediction of protein domain by CDD online program found that the OsLRG1 protein had CC, NB-ARC and LRR domains, and belonged to the typical NBS-LRR class protein (as shown in Figure 2 ).

[0048] Table 1 PCR reaction system of amplified OsLRG1 gene

[0049]

[0050] Example 2

[0051] The present embodiment provides a method for constructing pYLCRISPR / Cas9Pubi-H-OsLRG1 vector, which comprises the following steps:

[0052] (1) Material preparation: OsLRG1 knockout mutant material and its wild rice variety, Cas9 knockout vector: pYLCRISPR / Cas9Pubi-H, Agrobacterium EHA105, the above vectors are purchased from Wuhan Boyuan Biotechnology Co., Ltd., and Agrobacterium EHA105 can be purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0053] (2) Refer to the sequence of sequencing OsLRG1 , the knockout target is predicted by CRISPR-P (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) online analysis software, and the target primer is designed, and the sequence is as follows:

[0054] OsLRG1-T-F: cagtGGTCTCaTGCATCGATGTCAGGGCCTGCCACTGGGTTTTAGAGCTAGAAATAGC (SEQ ID NO. 5);

[0055] OsLRG1-T-R: cagtGGTCTCaAAACGATACTAGTGTTCGAAGACGTGGTGCACCAGCCGGGAATCGAA (SEQ ID NO. 6);

[0056] (3) Perform target linker amplification reaction, and the PCR reaction conditions are: 98°C pre-denaturation 3 min→ (98°C denaturation 15 s→ 55°C annealing 15 s→ 72°C extension 30 s) × 25 cycles→ 72°C thorough extension 5 min→ 4°C preservation. The reaction system is shown in Table 2:

[0057] Table 2 Double target fragment amplification reaction system

[0058]

[0059] (4) The PCR product is detected by agarose gel electrophoresis (as shown in Figure 3 A), and after confirming the target band, the amplified fragment is recovered (gel recovery product), and the recovered fragment is connected to pYLCRISPR / Cas9Pubi-H expression vector by Goldden Gate cloning to obtain pYLCRISPR / Cas9Pubi-H-OsLRG1. Reaction conditions: 37°C incubation for 30-60 min, 65°C termination for 20 min. The reaction system is shown in Table 3:

[0060] Table 3 Reaction system of Goldden Gate cloning

[0061]

[0062] (5) Then, the ligation product is transformed into E. coli DH5α, and positive clones are picked and subjected to colony PCR, and the PCR product is detected by 1% agarose gel electrophoresis (as shown in Figure 3B), select clear and bright double strip bacterial liquid to send sequencing. After successful alignment, extract plasmid with Ta Ka Ra MiniBEST Plasmid Purification Kit Ver.4.0 (9760), and transform Agrobacterium EHA105, and select positive clones to be stored in a-80°C refrigerator for standby.

[0063] Example 3

[0064] This example provides an Agrobacterium-mediated rice genetic transformation method (a rice genetic transformation flow chart is shown as Figure 4 The method comprises the following steps:

[0065] Take 1000 mature rice seeds, peel the hull, soak in 2.5% sodium hypochlorite for 30 min, wash with sterile water for 5 times, inoculate the disinfected seeds in callus induction medium, and culture at 28°C under light for 7d; culture the activated Agrobacterium EHA105 containing the target vector (pYLCRISPR / Cas9Pubi-H-OsLRG1) in YEB (50mg / L kanamycin, 50mg / L rifampicin) medium to OD600=0.5, centrifuge at 4000rpm for 10 min to collect the bacterial body precipitate, resuspend the bacterial body in AAM (100μM acetyl-syringone) medium, prepare the engineering bacterial liquid with OD600=0.2, and place on ice for 1h; immerse the rice callus in the engineering bacterial liquid for 10 min, absorb the surface bacterial liquid with sterile filter paper, inoculate in co-culture medium, and culture at 25°C in the dark for 3d; immerse the infected callus in 500mg / L carbenicillin solution for 15 min, repeat twice, absorb the surface moisture of the callus with filter paper, inoculate in selection medium, and culture at 28°C under light; subculture the newly grown resistant callus block in bud induction medium, and culture at 30°C under light (1-2 weeks) until adventitious buds grow; subculture the adventitious buds in rooting medium, and culture at 30°C under light (1-2 weeks) until most of the adventitious roots grow; take out the rooted seedlings, wash the medium, immerse the roots of the seedlings in sterile water for 3-7d, and transplant in the field or greenhouse. The medium formula required for genetic transformation is as follows:

[0066] Callus induction medium: 24.1g N6 medium+300mg / L hydrolyzed casein+2.878g / L proline+100mg / L inositol+2mg / L 2,4-D+30g sucrose+8g plant gel, pH=5.8;

[0067] Co-cultivation medium: 24.1 g of N6 medium + 2 mg / L 2,4-D + 300 mg / L hydrolyzed casein + 100 mg / L of myo-inositol + 10 g / L glucose + 30 g sucrose + 100 μM of Acetosyringone (AS) + 10 g plant gel, pH = 5.2;

[0068] Screening medium: 24.1 g of N6 medium + 2 mg / L 2,4-D + 300 mg / L hydrolyzed casein + 2.878 g / L proline + 100 mg / L of myo-inositol + 30 g sucrose + 300 mg / L of TIM + 50 mg / L of hygromycin + 50 mg / L of Kan + 8 g plant gel, pH = 5.8.

[0069] Pre-differentiation medium: 24.1 g of N6 medium + 30 g of sucrose + 30 g of sorbitol + 2 g / L of hydrolyzed casein 0.02 mg / L of NAA + 2 mg / L of Kinetin + 50 mg / mL of hygromycin + 50 mg / L of Kan + 8 g of plant gel, pH 5.8;

[0070] Rooting medium: MS medium + 30 g of glucose, pH = 7.2.

[0071] DNA of the transformed plants was extracted for molecular identification, hygromycin primers hygF (CCGGAAGTGCTTGACATTGG, SEQ ID NO. 7) and hygR (GCCGAATTAATTCGGGG, SEQ ID NO. 8) were designed to amplify a segment of the hygromycin gene of the transgenic plants, and a 1035 bp fragment was amplified as a positive plant. The seeds of the T0 positive transgenic plants were collected, and after sowing, young leaves were taken to extract DNA for mutation detection of the target site. The primers for target site PCR were:

[0072] OsLRG1-L-F: GCCTTGATCTCCAGCCACTG (SEQ ID NO. 9);

[0073] OsLRG1-L-R: TGGAGCTCAAGAACAGTAAGGT (SEQ ID NO. 10), and a 631 bp fragment was sequenced for analysis.

[0074] Referring to Figure 5 It can be seen from the figure that the plants with frame shift mutation are homozygous knockout plants, i.e., the seeds of rice numbered M-1 and M-3 are homozygous Cas9 knockout mutants of the LRG1 gene. OsLRG1

[0075] Example 4 ​

[0076] This embodiment provides a method for identifying rice blast resistance in rice Cas9 knockout mutants, including the following steps:

[0077] (1) Seeds of mutants (M-1 and M-3, two genotypes) obtained in Example 3 and wild-type rice seeds (WT) were soaked in water and germinated in a 30℃ incubator for 2-3 days. Then, the germinated rice seeds were sown in small flower pots (10cm in diameter) filled with soil, with 8-10 seeds per pot. Each treatment was set up with 3 replicates. The rice seedlings were cultured in a greenhouse with a light intensity of 10000Lx, a photoperiod of 14h light / 10h darkness, and a temperature of 28℃ until the rice grew to three leaves and one heart or four leaves and one heart.

[0078] (2) The activated rice blast fungus was cultured in the dark on rice bran medium (20 g / L rice bran, 40 g / L agarose, pH=6.5) for 8-10 days until the mycelium covered the culture dish. A layer of mycelium was scraped off from the surface of the medium, and the fungus was cultured under 60% light for 3-5 days to induce spore production. Then, the scraped rice bran plate was washed with 3-5 mL of sterile water containing 0.02% Tween-20. The washing and scraping solution was filtered through a single layer of lens paper, and the filtrate was counted using a cell counting chamber to achieve a final spore suspension concentration of 1.0 × 10⁻⁶. 5 ~2.0×10 5 The diluted spore suspension was evenly sprayed onto rice leaves using a high-pressure atomizer, with 15 mL of spore suspension sprayed onto each leaf. The inoculated seedlings were then placed in an inoculation room at 26°C and humidity above 90% for 24 hours in the dark. Afterward, the photoperiod was changed to 12 hours of light / 12 hours of darkness, and the seedlings were cultured for another 7 days.

[0079] Figure 6 This is Example 4 of the present invention. OsLRG1 A comparison of leaves and leaf lesion area 7 days after inoculation with *Oryza sativa* in gene mutant plants and wild-type rice. From... Figure 6 As shown in Figure A, the OsLRG1 mutants (M-1, M-3) exhibited severe leaf disease, with typical spindle-shaped lesions on the surface, characterized by a white central spot, brown edges, and a pale yellow halo. Some lesions were quite large. Wild-type rice leaves did not show lesions. ImageJ software was used to analyze the lesion area on the leaves of OsLRG1 mutant plants and wild-type rice 7 days after inoculation with *Magnapordia oryzae*. Figure 6 As shown in Figure B, the wild type has no obvious lesions, and the lesion area is the smallest, with a disease grade of 1 (resistant). Both mutants have lesion areas between 20% and 40%, and both have a disease grade of 4, indicating... OsLRG1 Gene mutation caused wild-type rice to change from resistant to susceptible, confirming that... OsLRG1 Genes can enhance rice's resistance to blast disease.

[0080] Example 5

[0081] The present embodiment provides a method for observing cell death of tobacco leaves induced by transient expression of resistance genes in tobacco, comprising the following steps:

[0082] (1) According to the method in Example 1, the sequences of OsLRG1, M-1 and M-3 were respectively connected to the pCAMBIA3301-GFP vector to obtain recombinant plasmids, and the competent cells of Agrobacterium GV3101 were transformed. The linker primers were designed as follows: OsLRG1

[0083] OsLRG1-GFP-F: cgagctcggtacccgggatccATGGCAGAGGCAGTACTCCT (SEQ ID NO. 11); OsLRG1-GFP-R: gctcaccattctagaggatccCTATATACGGACCTCTGCAACAT (SEQ ID NO. 12);

[0084] M1-GFP-F: cgagctcggtacccgggatccATGGCAGAGGCAGTACTCCT (SEQ ID NO. 13);

[0085] M1-GFP-R: gctcaccattctagaggatccTCACGGGAGATCGGGTAGTCC (SEQ ID NO. 14);

[0086] M3-GFP-F: cgagctcggtacccgggatccATGGCAGAGGCAGTACTCCT (SEQ ID NO. 15);

[0087] M3-GFP-R: gctcaccattctagaggatccTCAAGAACAGTAAGGTAACTTGATT (SEQ ID NO. 16).

[0088] (2) Single colonies were selected and inoculated in YEP liquid medium (50 mg / L kanamycin, 50 mg / L rifampicin) to activate GV3101 at 28°C, 200 rpm overnight. The activated GV3101 was inoculated in the corresponding liquid YEP medium at a ratio of 1:50, and cultured at 28°C, 200 rpm for about 12 h. Then, the bacterial cells were collected by centrifugation at 28°C, 5000 rpm for 10 min. The bacterial cells were washed twice with injection buffer (10 mM MES (pH=5.6)+10 mM MgCl2), and resuspended in injection buffer to OD600=1.0. The bacterial cells were placed horizontally at 28°C for 3-4 h.

[0089] ​(3) Select several healthy tobacco leaves (about 4 weeks of growth), use a 1 mL medical syringe with a needle removed to slowly inject the bacterial solution between the upper and lower epidermis of the tobacco on the abaxial surface, try to make each injection area a 1-2 cm circle, 25°C dark culture for 2-3 days, observe whether the hypersensitive reaction symptoms appear on the leaves, and take pictures.

[0090] Figure 7 The results of transient expression of the genes of the application embodiment 5 OsLRG1 and mutants (M-1 and M-3) in tobacco to induce hypersensitive response of tobacco are shown in the figure, with empty vector GFP as control. At 48h, it is observed that OsLRG1 strong cell death of tobacco leaves is triggered, while no obvious cell death is observed in tobacco leaves infiltrated by Agrobacterium strains containing mutants (M-1 and M-3), indicating that OsLRG1 the gene can induce hypersensitive reaction cell death of tobacco leaves.

[0091] The above examples are only used to illustrate the technical solutions of the application, but not to limit it; although the application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that the technical solutions recorded in the foregoing examples can still be modified, or some technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the application.

Claims

1. Rice blast resistance genes OsLRG1 Its application in inducing tobacco hypersensitivity reactions is characterized by: The gene OsLRG1 The nucleotide sequence is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that: The gene OsLRG1 The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. Rice blast resistance genes OsLRG1 Its application in the control of rice blast disease is characterized by: The gene OsLRG1 The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.

2. Knockout OsLRG1 Genes reduce rice's resistance to rice blast fungus.