Polynucleotide construct capable of improving expression effect of target polypeptide and application thereof

Abstract

The invention belongs to the field of gene engineering, and particularly relates to a polynucleotide construct capable of improving the expression effect of a target polypeptide and application of the polynucleotide construct. The polynucleotide construct contains: a first polynucleotide for encoding a selective marker; and, one or more second polynucleotides for encoding a polypeptide of interest; wherein the selective marker is selected from the group consisting of key enzymes associated with the survival of the host cell; the selective marker encoded by the first polynucleotide has a lower expression level and / or lower enzyme activity compared to a selective marker encoded by a wild-type encoding gene. The invention finds that by reducing the expression level and / or enzyme activity of the selective marker in the polynucleotide construct, the host cell containing the target polypeptide with high copy number can be efficiently screened out in a low-cost manner, and the yield and enzyme activity of the target polypeptide can be remarkably increased; the method has important guiding significance in the industrial production process of protein.

Description

[0001] Cross-reference information

[0002] This application claims priority to Chinese patent application No. 2023118464758 filed on December 28, 2023, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The invention belongs to the field of genetic engineering, and specifically relates to a polynucleotide construct capable of improving the expression effect of a target polypeptide and its application. Background Art

[0004] Protein production has a wide range of applications in life sciences, biotechnology, medicine, and materials science. In order to achieve high-yield industrial production of proteins, biotechnology usually uses screening marker genes to integrate target genes into host cells in multiple copies. Since the number of target gene copies and the final product yield are often positively correlated, increasing the number of target gene copies in microbial manufacturing strains is a common method. Screening marker genes can enable transformants to acquire new genetic characteristics that they do not have, and are essential basic elements for genetic transformation vectors.

[0005] At present, common screening markers are mainly divided into two categories: the first category is drug resistance marker genes, the transfer of which enables the recipient bacteria to grow normally under certain drug concentrations and show drug resistance. Drug screening markers are simple and convenient. In the past 20 years, antibiotic screening markers have been widely used in many host strains, and they have been proven to be an effective way to develop high-yield strains in a relatively short period of time. However, the high cost and safety of antibiotics cannot be ignored: horizontal gene transfer enables hosts to acquire drug resistance, which poses potential hazards to humans and their living environment; herbicide screening marker genes used in genetic transformation may also change the genetic diversity of organisms and cause ecological hazards. The second category is nutritional screening, including nitrogen source and carbon source nutritional genes and nutritional deficiency complementary marker genes. The transferred marker genes are complemented with the mutant genes of the recipient bacteria to restore the recipient bacteria to the wild type. The more widely used genes of this type include: amdS, niaD, argB and pyrG genes. Among these genes, the orotidine-5′-phosphate decarboxylase encoded by the pyrG gene is a key enzyme in the synthesis of uracil nucleotides. The inactivation of orotidine-5′-phosphate decarboxylase is manifested as uridine or uracil auxotrophy, and the plant can only grow on a medium supplemented with uridine or uracil. Since Struhl et al. first obtained the gene encoding orotidine-5′-phosphate decarboxylase from Saccharomyces cerevisiae using DNA recombinant technology and used it as a selection marker to construct a Saccharomyces cerevisiae transformation system, orotidine-5′-phosphate decarboxylase has been used as an auxotrophic screening marker for more than 40 years.

[0006] In addition, increasing the copy number of the target gene in the microbial manufacturing strain has become an important strategy to increase protein production. This method requires screening strains with higher copy numbers from the transformed microorganisms. The current common screening methods include: (1) Screening colonies with faster growth or better growth from the culture medium through screening markers to obtain strains with higher copy numbers. Although this method is simple and easy, it cannot accurately determine the copy number of the target gene. At the same time, it may select some strains with growth promotion or increased antibiotic resistance, and it may not be able to accurately screen strains with high copy numbers. (2) Comprehensively evaluate the copy number of the target gene in the microorganism through fluorescence quantitative PCR (qPCR), fluorescence in situ hybridization (FISH), next generation sequencing (NGS), flow cytometry and other technologies to help screen strains with higher copy numbers. These methods have high accuracy, but have high requirements for equipment and technicians, and are relatively complicated to operate. The above technical status has imposed certain limitations on the industrial production of proteins. Summary of the invention

[0007] The first object of the present invention is to provide a polynucleotide construct that can improve the expression effect of a target polypeptide, which contains: a first polynucleotide for encoding a selective marker; and one or more second polynucleotides for encoding a target polypeptide; wherein the selective marker is selected from key enzymes related to the survival of the host cell; compared to the selective marker encoded by the wild-type encoding gene, the selective marker encoded by the first polynucleotide has a lower expression level and / or lower enzyme activity.

[0008] As a preferred embodiment, compared with the wild-type gene encoding the selectable marker, there is at least one of the following changes in the first polynucleotide: i) the promoter is truncated; ii) one or more nucleotides in the coding region are replaced.

[0009] As a more preferred embodiment, the substituted site is related to the substrate binding property and / or active catalytic property of the selective marker.

[0010] As a preferred embodiment, the selectable marker is selected from key enzymes or mutants thereof associated with one or more pathways of nucleotide biosynthesis pathway, amino acid biosynthesis pathway, vitamin synthesis pathway, carbon metabolism pathway, and nitrogen metabolism pathway.

[0011] As a more preferred embodiment, the selectable marker is selected from key enzymes encoded by amdS, niaD, argB, pyrG genes or mutants thereof.

[0012] As a preferred embodiment, the first polynucleotide is used to encode orotidine-5′-phosphate decarboxylase or its mutant. Compared with the wild-type encoding gene of orotidine-5′-phosphate decarboxylase, the first polynucleotide contains at least one of the following changes a) to b): a) the promoter is truncated; b) one or more nucleotides in the coding region are replaced.

[0013] As a more preferred embodiment, the substituted position is related to the substrate binding property and / or active catalytic property of orotidine-5′-phosphate decarboxylase.

[0014] As a more preferred embodiment, the first polynucleotide contains the changes in a) and b).

[0015] As a preferred embodiment, the promoter in the first polynucleotide is truncated to a length of 50 to 200 bp from the 5' end.

[0016] As a preferred embodiment, the nucleotide sequence of the promoter is as shown in any one of SEQ ID NOs: 61 to 64; or, the nucleotide sequence of the promoter has at least 90% identity with the sequence shown in any one of SEQ ID NOs: 61 to 64, and can reduce the expression level and / or enzyme activity of orotidine-5′-phosphate decarboxylase.

[0017] As a preferred embodiment, relative to the amino acid position of SEQ ID NO: 2, the orotidine-5′-phosphate decarboxylase mutant encoded by the first polynucleotide comprises at least one mutation among S38, D40, K62, H64, T102, L155, M158, Q225, Y227, T212, and I242, and compared with the orotidine-5′-phosphate decarboxylase parent, the orotidine-5′-phosphate decarboxylase mutant has a lower expression level and / or lower enzyme activity.

[0018] As a preferred embodiment, the orotidine-5′-phosphate decarboxylase mutant comprises the following mutations: at least one of S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, and I242A.

[0019] As a preferred embodiment, the orotidine-5′-phosphate decarboxylase mutant comprises the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, I242A, L155A_M158A, or Q225A_Y227F.

[0020] As a preferred embodiment, the target polypeptide is an aminopeptidase, an amylase, a saccharifying enzyme, a carboxypeptidase, a catalase, a cellobiohydrolase, a cellulase, a chitinase, a cutinase, a cyclodextrin glycosyltransferase, a deoxyribonuclease, an endoglucanase, an esterase, an α-galactosidase, a β-galactosidase, a glucoamylase, an α-glucosidase, a β-glucosidase, a laccase, a lipase, a mannosidase, a mutanase, a glucose oxidase, a pectinase, a peroxidase, a phytase, a polyphenol oxidase, a protease, a ribonuclease, a transglutaminase, a xylanase, a β-xylosidase, a proline-specific protease, a trehalase, a pullulanase, a phospholipase, a mannanase, a lysozyme, a sweet protein, a lactoferrin, a lactoglobulin or a bovine serum albumin.

[0021] As a preferred embodiment, the target polypeptide is fungal amylase or Brazzein sweet protein.

[0022] The second object of the present invention is to provide a recombinant expression vector containing at least one copy of the polynucleotide construct as described in any of the previous embodiments.

[0023] As a preferred embodiment, the recombinant expression vector is capable of integrating the polynucleotide construct into the genome of the host cell.

[0024] The third object of the present invention is to provide a host cell containing more than one copy of the polynucleotide construct as described in any of the preceding embodiments.

[0025] As a preferred embodiment, the host cell has a functional defect that can be complemented by the selectable marker.

[0026] The fourth object of the present invention is to provide a mutant of orotidine-5′-phosphate decarboxylase, which comprises at least one mutation among S38, D40, K62, H64, T102, L155, M158, Q225, Y227, T212, and I242 relative to the amino acid position of SEQ ID NO: 2, and has a lower expression level and / or lower enzyme activity than the orotidine-5′-phosphate decarboxylase parent.

[0027] As a preferred embodiment, the orotidine-5′-phosphate decarboxylase mutant comprises the following mutations: at least one of S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, and I242A.

[0028] As a preferred embodiment, the orotidine-5′-phosphate decarboxylase mutant comprises the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, I242A, L155A_M158A, or Q225A_Y227F.

[0029] The fifth object of the present invention is to provide an isolated nucleic acid encoding the orotidine-5′-phosphate decarboxylase mutant described in any of the aforementioned embodiments.

[0030] As a preferred embodiment, the isolated nucleic acid further contains a promoter for driving the expression of the orotidine-5′-phosphate decarboxylase mutant, and compared with the natural promoter, the promoter is truncated.

[0031] As a preferred embodiment, the promoter is truncated to a length of 50 to 200 bp from the 5' end.

[0032] As a preferred embodiment, the nucleotide sequence of the promoter is as shown in any one of SEQ ID NOs: 61 to 64; or, the nucleotide sequence of the promoter has at least 90% identity with the sequence shown in any one of SEQ ID NOs: 61 to 64, and can reduce the expression level and / or enzyme activity of orotidine-5′-phosphate decarboxylase.

[0033] The sixth object of the present invention is to provide a use of the polynucleotide construct described in any of the aforementioned schemes, or the recombinant expression vector described in any of the aforementioned schemes, or the host cell described in any of the aforementioned schemes, or the orotidine-5′-phosphate decarboxylase mutant described in any of the aforementioned schemes, or the isolated nucleic acid described in any of the aforementioned schemes in improving the expression level and / or enzyme activity of the target polypeptide.

[0034] The seventh object of the present invention is to provide a method for producing a target polypeptide, comprising: culturing the host cell described in any of the aforementioned schemes; and optionally recovering the target polypeptide.

[0035] As a preferred embodiment, the culture medium used to culture the host cells lacks one or more nutrients, so that host cells containing more copies of the polynucleotide construct can be screened out.

[0036] The present invention finds that by reducing the expression level and / or enzyme activity of the selectable marker in the polynucleotide construct, host cells containing a high copy number of the target polypeptide can be efficiently screened in a low-cost manner, and the yield and enzyme activity of the target polypeptide can be significantly increased, which has important guiding significance for the industrial production process of proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0038] Figure 1 This is a plasmid map of the nucleic acid construct used for target gene expression in the examples of the present invention.

[0039] Figure 2 The figure shows the difference in enzymatic activity of fungal amylase expressed in Aspergillus oryzae by different nucleic acid constructs in the examples of the present invention.

[0040] Figure 3 The figure shows the difference in enzymatic activity of fungal amylase expressed in Aspergillus niger by different nucleic acid constructs in the examples of the present invention.

[0041] Figure 4 The transcription differences of the fungal amylase gene between different strains in the examples of the present invention are shown in FIG.

[0042] Figure 5 The difference in the enzymatic activity of fungal amylase expressed by nucleic acid constructs with different promoter truncations in the examples of the present invention in Aspergillus oryzae and Aspergillus niger. DETAILED DESCRIPTION

[0043] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention. Those skilled in the art may make various modifications and changes to the present invention without departing from the scope or spirit of the present invention. For example, a feature described or illustrated as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0044] Terminology

[0045] Unless otherwise indicated, the meaning of all terms (including technical and scientific terms) used to disclose the present invention is the same as that commonly understood by those of ordinary skill in the art to which the present invention belongs. By way of further guidance, the following definitions are used to better understand the teachings of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0046] The terms "and / or", "or / and", and "and / or" used in this article include any one of two or more related listed items, and also include any and all combinations of related listed items, and the arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0047] As used herein, the terms "comprising", "including" and "comprising" are synonymous and are inclusive or open-ended and do not exclude additional, unrecited members, elements or method steps.

[0048] Numerical ranges expressed as endpoints herein include all numbers and fractions subsumed within the range, as well as the recited endpoints.

[0049] The present invention relates to concentration values, and its meaning includes fluctuations within a certain range. For example, it can fluctuate within the corresponding accuracy range. For example, 2% can allow fluctuations within the range of ±0.1%. For values ​​that are large or do not require too fine control, its meaning is also allowed to include greater fluctuations. For example, 100mM can allow fluctuations within the range of ±1%, ±2%, ±5%, etc. Involving molecular weight, its meaning is allowed to include fluctuations of ±10%.

[0050] In the present invention, descriptions such as "plurality" and "multiple" refer to quantities greater than or equal to 2 unless otherwise specified.

[0051] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0052] In the present invention, “preferred”, “better”, “more preferred” and “suitable” are only used to describe implementation methods or examples with better effects. It should be understood that they do not constitute limitations on the scope of protection of the present invention.

[0053] In the present invention, "optionally", "optional", "optionally", "optionally", "optional", "optional", "optional" means optional, that is, it means to be selected from any one of the two parallel schemes of "yes" or "no". If multiple "optional" or "optional" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" or "optional" is independent.

[0054] In the present invention, the term "polynucleic acid construct" refers to a single-stranded or double-stranded nucleic acid molecule isolated from a naturally occurring gene, or modified in a manner that does not otherwise occur in nature to contain a nucleic acid fragment, or synthesized, which contains one or more control sequences.

[0055] In the present invention, the term "selective marker" refers to a key enzyme related to the survival of host cells, which is used to screen the key enzyme of host cells carrying polynucleotides encoding target polypeptides during transformation or transfection. Only host cells carrying polynucleotides encoding selective markers can grow in the selection medium, while host cells that do not carry polynucleotides encoding selective markers will be selectively killed or growth inhibited. In specific implementation, the "polynucleotide encoding a selective marker" in the present invention can be a drug resistance marker gene, an auxotrophic complementation marker gene or other genes that can make cells have a specific phenotype. Based on safety considerations, in the present invention, it is preferred that the "polynucleotide encoding a selective marker" is an auxotrophic complementation marker gene, more preferably a pyrG gene, which is used to encode orotidine-5'-phosphate decarboxylase.

[0056] In the present invention, the term "coding gene" refers to a gene sequence with a specific function in the genome of an organism. They contain an open reading frame that can be translated into a protein by a cell, thereby participating in various biochemical and physiological processes of the organism. The open reading frame starts with a start codon such as ATG, GTG or TTG and ends with a stop codon such as TAA, TAG or TGA. The core part of the coding gene is the coding region, also known as the Exon region, which contains a series of consecutive codons, each corresponding to an amino acid. Through the combination of these codons, the translation process can convert the messenger RNA (mRNA) transcribed by the coding gene into the corresponding protein. In addition to the coding region, other parts of the coding gene also have important functions. For example, the start region (promoter region) of the coding gene contains a promoter (Promoter), which can be recognized by the transcription factor in the cell and start the transcription process. The termination region (termination region) of the coding gene contains a terminator sequence, which can help terminate transcription and release the synthesized mRNA molecules. In addition, the coding gene may also contain other control sequences, such as enhancers and inhibitors, which can regulate the level and timing of gene expression. Each control sequence can be endogenous (i.e., from the same gene) or exogenous (i.e., from different genes) to the polynucleotide encoding the polypeptide, or endogenous or exogenous to each other. In some embodiments, these control sequences include, but are not limited to, leader sequences, polyadenylation sequences, propeptide sequences, promoters, signal peptide sequences, and transcription terminators. Minimally, the control sequence includes a promoter and transcription and translation termination signals. For the purpose of introducing specific restriction enzyme sites to facilitate the connection of the control sequence to the coding region of the polynucleotide encoding the polypeptide, the control sequence may be provided with a linker. "Wild-type coding gene" refers to a gene sequence with a specific function that occurs naturally in the genome of an organism, without any mutation, substitution, insertion, or deletion.

[0057] In the present invention, the term "expression" includes any step involved in the production of the polypeptide, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification and secretion.

[0058] In the present invention, the term "expression vector" refers to a linear or circular DNA molecule comprising a polynucleotide encoding a polypeptide and operably linked to a control sequence for its expression. Wherein, "operably linked" means that the control sequence is placed at a suitable position relative to the coding sequence of the polynucleotide, so that the control sequence guides the expression of the coding sequence.

[0059] In the present invention, the term "host cell" refers to any cell type that is susceptible to transformation, transfection, transduction, etc. with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" includes any progeny of a parent cell that is different from the parent cell due to mutations that occur during replication.

[0060] In the present invention, the term "isolated" refers to a substance in a non-natural form or environment. Non-limiting examples of isolated substances include: 1) any non-naturally occurring substance; 2) any substance including but not limited to any enzyme, variant, nucleic acid, protein, peptide or cofactor, which is at least partially removed from one or more or all naturally occurring components associated with it; 3) any substance artificially modified relative to a naturally occurring substance; or 4) any substance modified by increasing the content of the substance relative to other components associated with it naturally (e.g., multiple copies of a substance encoding gene; using a stronger promoter than the promoter naturally associated with the gene encoding the substance). The isolated substance may be present in a fermentation broth sample.

[0061] In the present invention, the term "amino acid sequence" is synonymous with the terms "polypeptide", "protein" and "peptide" and is used interchangeably. The conventional one-letter code or three-letter code for amino acid residues is used, wherein the amino acid sequence is presented in the standard amino to carboxyl terminal orientation (i.e., N→C).

[0062] In the present invention, the term "mutation" refers to changing the amino acid at the site to an amino acid different from the natural amino acid. For example, at position 38, it is changed to any amino acid except S, and at position 40, it is changed to any amino acid except D. In the present invention, "mutant" or "mutant protein" refers to a protein that has differences in amino acid sequence relative to the parent protein. This difference can be manifested in the presence of one or more amino acid substitutions, deletions or insertions at one or more positions in the amino acid sequence. In some examples, the wild-type protein is used as a parent protein and as a reference for sequence comparison. Wild-type protein generally refers to a protein that is naturally produced in nature or a particular species and is dominant in content. In some embodiments, the wild-type orotidine-5′-phosphate decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 2.

[0063] In the present invention, "the amino acid position relative to..." means that the amino acid position makes an equal contribution to the function of the compared proteins (enzymes). For example, for a reference amino acid sequence (i.e., the amino acid sequence of SEQ ID NO: 2), when the amino acid sequence of the comparison object is arranged in a manner that allows for optimal comparison while taking into account the partial homology of the primary structure (amino acid sequence) (in this case, gaps can be introduced as needed to optimize the alignment), the amino acid at the position corresponding to the specific amino acid in the reference amino acid sequence can be determined as the "corresponding amino acid". Instead of comparing between primary structures, the comparison between stereostructures can be used, or not only the comparison between primary structures but also the comparison between stereostructures can be used to determine the "corresponding amino acid". By using stereostructure information, a highly reliable comparison result can be obtained. In this case, a method of comparing while comparing the atomic coordinates of the stereostructures of a plurality of enzymes can be used. The stereostructure information of the enzyme to be mutated can be obtained from a protein database commonly used in the art.

[0064] The following nomenclature is used for amino acid substitutions in the present invention: original amino acid, position, substituted amino acid. As an example, the serine (S) at position S38 is substituted with alanine (A) and represented as S38A. Multiple amino acid substitutions are separated by a comma (",), such as S38A, D40A, K62A.

[0065] In the present invention, when "_" is used to connect at least two amino acid substitutions, it means that the mutations of the amino acids before and after the "_" connection occur simultaneously. As an example, when L155A and M158A mutations occur simultaneously, it is expressed as L155A_M158A. Multiple different mutation schemes are separated by ",", such as I242A, L155A_M158A.

[0066] The "at least one" mentioned in the present invention includes 1 or more than 2. In some embodiments, one skilled in the art can select one amino acid site to mutate in "at least one selected from...", or can select multiple (such as 2, 3 or 4, etc.) amino acids to perform combined mutations, so that the mutant has a lower expression level and / or lower enzyme activity.

[0067] In the present invention, the term "sequence identity" refers to the correlation between two amino acid sequences or between two nucleotide sequences. When the CLUSTALW algorithm is used for comparison with preset parameters, the specific sequence has at least a certain percentage of amino acid residues that are identical to the amino acid residues of the specified reference sequence. The preset parameters of the CLUSTALW algorithm are: the deletion count is the residues that are different from the reference sequence, including deletions occurring at any end. For example, a variant lacking five amino acid residues at the C-terminus, a 500 amino acid residue polypeptide has a sequence identity percentage of 99% (495 / 500 identical residues × 100) relative to the parent polypeptide. Such variants are covered by the language "variants having at least 99% sequence identity with the parent".

[0068] In the present invention, Brazzein, also known as Brazilian sweet protein, Bunazhen sweet protein or Brazzein, refers to a sweet protein that can be extracted from the fruit of the West African climbing plant Pentadiplandra brazzeana (Baillon) and described in WO1995031547A1, or a recombinantly produced form thereof. In nature, brazzein appears in three different forms, with or without a Gln residue or pyroglutamic acid attached to its N-terminus. In the context of the present invention, the wild-type sequence of brazzein comprises the amino acid sequence of SEQ ID NO: 65, with no Gln residue or pyroglutamic acid attached to its N-terminus. The source of the brazzein described in the present invention is not limited, including wild-type brazzein or its naturally occurring mutant or recombinant analog brazzein, and the production method is not limited, including recombinant expression, extraction, chemical synthesis, in vivo or in vitro acquisition, etc. In one embodiment, the brazilian tamanu protein of the present invention is preferably a recombinant brazilian tamanu protein, which refers to a brazilian tamanu protein produced by a recombinant host cell, and the amino acid sequence of the brazilian tamanu protein is any one of SEQ ID NOs: 65-72, or has a sequence identity of at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or more than 99% with SEQ ID NO: 65.

[0069] In the present invention, the term "about" refers to ±10%. As used herein, the term "about" means a value that may be higher than the mentioned numerical value by up to 1%, more specifically 5%, more specifically 10%, more specifically 15%, and in some cases up to or lower than 20%, and the deviation range includes integer values ​​and, if applicable, non-integer values ​​to form a continuous range.

[0070] Polynucleotide constructs

[0071] The present invention relates to a polynucleotide construct, which contains: a first polynucleotide for encoding a selective marker; and one or more second polynucleotides for encoding a target polypeptide; wherein the selective marker is selected from a key enzyme associated with the survival of a host cell; compared to the selective marker encoded by a wild-type encoding gene, the selective marker encoded by the first polynucleotide has a lower expression level and / or lower enzyme activity. The present invention unexpectedly found that by reducing the expression level and / or enzyme activity of the selective marker in the polynucleotide construct, host cells containing a high copy number of the target polypeptide can be efficiently screened out in a low-cost manner, and the yield and enzyme activity of the target polypeptide can be significantly increased.

[0072] In some embodiments, the lower expression level refers to an expression level below 75%, preferably below 60%, more preferably below 50%, further preferably below 40%, further preferably below 30%, further preferably below 20%, further preferably below 10%.

[0073] In some embodiments, the lower enzyme activity refers to an enzyme activity below 75%, preferably below 60%, more preferably below 50%, further preferably below 40%, further preferably below 30%, further preferably below 20%, further preferably below 10%.

[0074] In specific implementation, those skilled in the art can reduce the expression level of the selective marker and / or the enzyme activity by various means. For example, the amino acid sequence of the encoded protein can be changed by point mutation, thereby reducing its enzyme activity. By inserting or deleting one or more nucleotides in the gene, the frame shift of the open reading frame of the encoded protein can be caused, resulting in changes in the entire amino acid sequence, thereby reducing the enzyme activity. By changing the promoter region or other control sequences of the gene, the transcription level of the gene can be adjusted, resulting in changes in the expression level of the encoded protein, thereby affecting the enzyme activity. By introducing neutral mutations, i.e. mutations that do not change amino acids or functions, the enzyme activity of the protein can be reduced. This mutation usually occurs in regions outside the catalytic site, which may cause slight changes in the protein structure, thereby affecting its activity.

[0075] In some embodiments, compared to the wild-type gene encoding the selectable marker, at least one of the following changes is present in the first polynucleotide: i) the promoter is truncated; ii) one or more nucleotides in the coding region are substituted.

[0076] In some embodiments, the first polynucleotide contains the changes in i), while the coding region is unchanged. In some embodiments, the first polynucleotide contains the changes in ii), while the promoter is unchanged. In some more preferred embodiments, the first polynucleotide contains the changes in i) and ii).

[0077] In some preferred embodiments, the substituted site is associated with the substrate binding property and / or active catalytic property of the selectable marker.

[0078] In some embodiments, the selectable marker is selected from key enzymes or mutants thereof associated with one or more pathways of nucleotide biosynthesis pathway, amino acid biosynthesis pathway, vitamin synthesis pathway, carbon metabolism pathway, and nitrogen metabolism pathway.

[0079] In some preferred embodiments, the selectable marker is selected from key enzymes encoded by amdS, niaD, argB, pyrG genes or mutants thereof.

[0080] In some embodiments, the first polynucleotide is used to encode orotidine-5′-phosphate decarboxylase or a mutant thereof. Compared with the wild-type encoding gene (pyrG) of orotidine-5′-phosphate decarboxylase, the first polynucleotide contains at least one of the following changes a) to b): a) the promoter is truncated; b) one or more nucleotides in the coding region are replaced.

[0081] In some embodiments, the substituted position is associated with the substrate binding property and / or active catalytic property of orotidine-5'-phosphate decarboxylase.

[0082] In some embodiments, the first polynucleotide contains the changes in a), while the coding region is unchanged. In some embodiments, the first polynucleotide contains the changes in b), while the promoter is unchanged. In some more preferred embodiments, the first polynucleotide contains the changes in a) and b).

[0083] In some embodiments, the promoter in the first polynucleotide is truncated to a length of 50 to 200 bp from the 5' end.

[0084] In some specific embodiments, the promoter in the first polynucleotide is truncated to a length of 50 bp, 75 bp, 100 bp, 125 bp, 150 bp, 175 bp or 200 bp from the 5' end.

[0085] In some specific embodiments, the nucleotide sequence of the promoter is as shown in any one of SEQ ID NOs: 61 to 64; or, the nucleotide sequence of the promoter has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the sequence shown in any one of SEQ ID NOs: 61 to 64, and can reduce the expression level and / or enzyme activity of orotidine-5′-phosphate decarboxylase.

[0086] In some embodiments, relative to the amino acid position of SEQ ID NO: 2, the orotidine-5′-phosphate decarboxylase mutant encoded by the first polynucleotide (corresponding to the mutation in b)) comprises at least one mutation among S38, D40, K62, H64, T102, L155, M158, Q225, Y227, T212, and I242, and compared with the orotidine-5′-phosphate decarboxylase parent, the orotidine-5′-phosphate decarboxylase mutant has a lower expression level and / or lower enzyme activity.

[0087] In some embodiments, the orotidine-5′-phosphate decarboxylase mutant comprises at least one of the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, and I242A.

[0088] In some embodiments, the orotidine-5′-phosphate decarboxylase mutant comprises the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, I242A, L155A_M158A, or Q225A_Y227F.

[0089] The fungal amylase activity integrated into Aspergillus oryzae and Aspergillus niger strains using these mutant sequences as screening markers was significantly improved. For the parent sequence (i.e., the wild-type encoding gene), the use of mutant screening markers resulted in an increase in fungal amylase activity of 121% to 436%. The combined mutants obtained by using screening marker promoter truncation and amino acid mutations further increased the fungal amylase activity by 486% to 663%.

[0090] In some embodiments, the orotidine-5′-phosphate decarboxylase mutant has only the aforementioned mutations based on the sequence shown in SEQ ID NO: 2.

[0091] In some embodiments, based on the sequence shown in SEQ ID NO: 2, the orotidine-5′-phosphate decarboxylase mutant not only has the mutations mentioned above, but also has some other conservative substitutions, so that the orotidine-5′-phosphate decarboxylase mutant has at least 80%, preferably at least 85%, preferably at least 88%, more preferably at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the sequence shown in SEQ ID NO: 2. The "conservative substitution" mentioned herein is also referred to as substitution by "homologous" amino acids, and refers to substitutions in which an amino acid is replaced by an amino acid with a similar side chain, for example, amino acids with basic side chains (such as lysine, arginine and histidine), amino acids with acidic side chains (such as aspartic acid, glutamic acid), non-charged polar side chain amino acids (such as glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chain amino acids (such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chain amino acids (such as threonine, valine, isoleucine) and aromatic side chain amino acids (such as tyrosine, phenylalanine, tryptophan, histidine). Conservative amino acid substitutions generally have little effect on the activity of the resulting protein.

[0092] In some embodiments, the target polypeptide is an enzyme or a non-enzyme protein.

[0093] In some embodiments, the target polypeptide is aminopeptidase, amylase, saccharifying enzyme, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, α-galactosidase, β-galactosidase, glucoamylase, α-glucosidase, β-glucosidase, laccase, lipase, mannosidase, mutanase, glucose oxidase, pectinase, peroxidase, phytase, polyphenol oxidase, protease, ribonuclease, transglutaminase, xylanase, β-xylosidase, proline-specific protease, trehalase, pullulanase, phospholipase, mannanase, lysozyme, sweet protein, lactoferrin, lactoglobulin or bovine serum albumin. In some specific embodiments, the target polypeptide is fungal amylase or Brazzein sweet protein. In addition to the target polypeptides specifically listed above, those skilled in the art can also use the polynucleotide construct of the present invention for the expression of a variety of target polypeptides based on the content of the present invention and actual needs, all of which fall within the scope of protection of the present invention.

[0094] In specific implementation, those skilled in the art can combine the above-mentioned schemes with common sense to obtain preferred embodiments of the polynucleotide construct of the present invention.

[0095] Recombinant expression vector

[0096] The present invention also provides a recombinant expression vector, which contains at least one copy of the polynucleotide construct as described in any of the above embodiments.

[0097] As a preferred embodiment, the recombinant expression vector is capable of integrating the polynucleotide construct into the genome of the host cell.

[0098] In some embodiments, the control sequences in the recombinant expression vector include promoters and transcriptional and translational stop signals. In some embodiments, the recombinant expression vector may also contain other control sequences, such as enhancers and repressors. Each control sequence may be endogenous (i.e., from the same gene) or exogenous (i.e., from different genes) to the polynucleotide encoding the polypeptide, or endogenous or exogenous to each other.

[0099] In some embodiments, various nucleotides and control sequences can be linked together to produce a recombinant expression vector that can contain one or more convenient restriction sites that allow the polynucleotides of the target polypeptide to be inserted or replaced at the site. Alternatively, the polynucleotides can be expressed by inserting the polynucleotides or nucleic acid constructs containing the polynucleotides into a suitable expression vector. In the process of constructing the expression vector, the coding sequence of the target polypeptide can be introduced into the vector, and the coding region sequence of the target polypeptide, the coding region sequence of the selective marker (or mutant) and the control sequence can be operably connected, so that the coding sequence is suitably expressed by the control sequence.

[0100] In some embodiments, the recombinant expression vector can be any vector (e.g., a plasmid or virus) that can be easily subjected to recombinant DNA procedures and can cause the expression of the polynucleotide. The choice of vector generally depends on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid.

[0101] Host cells

[0102] The present invention also provides a host cell containing more than one copy of the polynucleotide construct as described in any of the preceding embodiments.

[0103] As a preferred embodiment, the host cell has a functional defect that can be complemented by the selectable marker.

[0104] The host cell may be any cell useful in the recombinant production of the polypeptides of the present invention, for example, a fungal cell, a bacterial cell, an insect cell or a mammalian cell.

[0105] In some embodiments, the host cell will not develop into a plant or animal organism.

[0106] The "fungi" mentioned in the present invention include Ascomycota, Basidiomycota, Chytridiomycota, Zygomycota, Oomycota and all mitotic fungi. The fungal host cell can be a yeast cell. The "yeast" mentioned in the present invention includes ascomycete yeast, basidiomycete yeast and yeast belonging to Fungi Deuteromycota.

[0107] In some embodiments, the fungal host cell can be a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the Eumycota and Oomycota subdivisions. Filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan and other complex polysaccharides. Vegetative growth is by hyphal elongation, and carbon catabolism is obligately aerobic. In contrast, vegetative growth of yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus, and carbon catabolism can be fermentative.

[0108] In some embodiments, the filamentous fungal host cell can be Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, thora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes or Trichoderma cells.

[0109] In some specific embodiments, the filamentous fungal host cell can be Aspergillus oryzae or Aspergillus niger.

[0110] In some embodiments, the bacterial cell may be Escherichia coli or Lactococcus lactis.

[0111] In some embodiments, the insect cell may be a Spodoptera frugiperda cell line, such as Sf9 or Sf21. This allows for more complex glycosylation modifications to be performed on the target polypeptide.

[0112] In some embodiments, the mammalian cells may be CHO cells (Chinese Hamster Ovary cells) or HEK293 cells (Human Embryonic Kidney 293 cells), which can perform post-translational modifications on the target polypeptide that are closest to human physiology, thereby improving the expression quality of the polypeptide.

[0113] In some embodiments, more than one copy of the polynucleotide of the present invention can be inserted into the host cell to increase polypeptide production. The increase in the number of polynucleotide copies can be obtained by integrating at least one additional copy of the sequence into the host cell genome; or by including an amplifiable selection marker gene with the polynucleotide, so that cells containing amplified copies of the selection marker gene can be selected by culturing cells in the presence of a suitable selection agent, thereby selecting cells containing additional copies of the polynucleotide.

[0114] Orotidine-5′-phosphate decarboxylase mutant

[0115] The present invention also provides an orotidine-5′-phosphate decarboxylase mutant, which comprises at least one mutation of S38, D40, K62, H64, T102, L155, M158, Q225, Y227, T212, and I242 relative to the amino acid position of SEQ ID NO: 2, and the orotidine-5′-phosphate decarboxylase mutant has a lower expression level and / or lower enzyme activity than that of the orotidine-5′-phosphate decarboxylase parent.

[0116] In some embodiments, the orotidine-5′-phosphate decarboxylase mutant comprises at least one of the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, and I242A.

[0117] In some embodiments, the orotidine-5′-phosphate decarboxylase mutant comprises the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, I242A, L155A_M158A, or Q225A_Y227F.

[0118] In some embodiments, the orotidine-5′-phosphate decarboxylase mutant has only the aforementioned mutations based on the sequence shown in SEQ ID NO: 2.

[0119] In some embodiments, based on the sequence shown in SEQ ID NO: 2, the orotidine-5′-phosphate decarboxylase mutant not only has the mutations mentioned above, but also has some other conservative substitutions, so that the orotidine-5′-phosphate decarboxylase mutant has at least 80%, preferably at least 85%, preferably at least 88%, more preferably at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the sequence shown in SEQ ID NO: 2. The "conservative substitution" mentioned herein is also referred to as substitution by "homologous" amino acids, and refers to substitutions in which an amino acid is replaced by an amino acid with a similar side chain, for example, amino acids with basic side chains (such as lysine, arginine and histidine), amino acids with acidic side chains (such as aspartic acid, glutamic acid), non-charged polar side chain amino acids (such as glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chain amino acids (such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chain amino acids (such as threonine, valine, isoleucine) and aromatic side chain amino acids (such as tyrosine, phenylalanine, tryptophan, histidine). Conservative amino acid substitutions generally have little effect on the activity of the resulting protein.

[0120] Isolated nucleic acids

[0121] The present invention also provides an isolated nucleic acid encoding the orotidine-5′-phosphate decarboxylase mutant described in any of the above embodiments.

[0122] In some embodiments, the isolated nucleic acid further contains a promoter for driving the expression of the orotidine-5′-phosphate decarboxylase mutant, and compared with the natural promoter, the promoter is truncated, preferably the promoter is truncated to a length of 50 to 200 bp from the 5′ end.

[0123] In some specific embodiments, the promoter is truncated to a length of 50 bp, 75 bp, 100 bp, 125 bp, 150 bp, 175 bp or 200 bp from the 5' end.

[0124] In some specific embodiments, the nucleotide sequence of the promoter is as shown in any one of SEQ ID NOs: 61 to 64; or, the nucleotide sequence of the promoter has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the sequence shown in any one of SEQ ID NOs: 61 to 64, and can reduce the expression level and / or enzyme activity of orotidine-5′-phosphate decarboxylase.

[0125] Application and Methods

[0126] The present invention also provides the use of the polynucleotide construct described in any of the aforementioned schemes, or the recombinant expression vector described in any of the aforementioned schemes, or the host cell described in any of the aforementioned schemes, or the orotidine-5′-phosphate decarboxylase mutant described in any of the aforementioned schemes, or the isolated nucleic acid described in any of the aforementioned schemes in improving the expression level and / or enzyme activity of the target polypeptide.

[0127] The present invention also provides a method for producing a target polypeptide, comprising: culturing the host cell described in any of the aforementioned schemes; and optionally recovering the target polypeptide.

[0128] In some embodiments, the medium used to culture the host cells lacks one or more nutrients, so that host cells containing more copies of the polynucleotide construct can be selected.

[0129] In some embodiments, host cells are cultivated in a nutrient medium suitable for producing polypeptides using methods known in the art. For example, cells can be cultivated by shaking flasks or by fermenting in a laboratory or industrial fermentor on a small scale or large scale (including continuous fermentation, batch fermentation, batch fed fermentation or solid state fermentation) in a suitable medium and under conditions that allow polypeptide expression and / or separation. Cultivate in a suitable nutrient medium comprising a carbon source and a nitrogen source and an inorganic salt using steps known in the art. Suitable medium can be obtained from commercial suppliers or can be prepared according to disclosed composition. If the polypeptide is secreted into the nutrient medium, the polypeptide can be directly recovered from the medium. If the polypeptide is not secreted out, it can be recovered from the cell lysate.

[0130] In some embodiments, the polypeptide can be detected using methods known in the art that are specific for polypeptides. These detection methods include, but are not limited to, the use of specific antibodies, the formation of enzyme products, or the disappearance of enzyme substrates. For example, enzyme assays can be used to determine the activity of a polypeptide.

[0131] In some embodiments, the polypeptide can be recovered using methods known in the art. For example, the polypeptide can be recovered from the nutrient medium by conventional steps including but not limited to collection, centrifugation, filtration, extraction, spray drying, evaporation or precipitation.

[0132] In some embodiments, substantially pure polypeptides can be obtained by purifying the polypeptides by a variety of methods known in the art, including but not limited to chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoresis (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction.

[0133] Example

[0134] Embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are preferably referred to the guidance provided in the present invention, and can also be based on the experimental manual or normal conditions in this area, and can also be based on other experimental methods known in the art, or according to the conditions recommended by the manufacturer.

[0135] The present invention provides various specific process and material examples, and those of ordinary skill in the art will be aware of the applicability of other processes and / or the use of other materials. Unless otherwise specified, the embodiments of the present invention will use conventional techniques in the fields of chemistry, molecular biology, etc. within the capabilities of those skilled in the art. In addition, unless otherwise specified, in this article, nucleic acids are written from left to right in the direction of 5' to 3', and amino acid sequences are written from left to right in the direction of amino terminal to carboxyl terminal.

[0136] In the following specific examples, the reagents used were obtained from conventional commercial sources unless otherwise specified. The measurement parameters of the raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operating accuracy are allowed.

[0137] Media and Reagents:

[0138] LB solid medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 1% agar powder, pH 7.0.

[0139] LB-A resistance medium is LB medium with ampicillin added to a final concentration of 100 μg / mL. LB-Z resistance medium is LB medium with Zeocin added to a final concentration of 25 ug / mL.

[0140] YPD medium: 1% yeast extract, 2% peptone, 2% glucose.

[0141] YPD-Z resistance medium is YPD medium with Zeocin added to a final concentration of 100ug / mL.

[0142] Induction medium BMGY: 1% yeast extract, 2% peptone, 1.34% YNB, 0.00004% biotin, 1% glycerol (v / v).

[0143] Induction medium BMMY: 0.5% methanol replaces glycerol, and the rest of the ingredients are the same as BMGY.

[0144] CD transformation medium: 2% glucose, 0.3% NaNO3, 0.1% KH2PO4, 0.2% KCl, 0.0245% MgSO4, 0.002% FeSO4·7H2O, 14.5736% sorbitol, 500 μL / L trace element stock solution, 0.5% agar powder, pH 6.5.

[0145] CD subculture medium: 2% glucose, 0.3% NaNO3, 0.1% KH2PO4, 0.2% KCl, 0.0245% MgSO4, 0.002% FeSO4·7H2O, 500 μL / L trace element stock solution, 0.5% agar powder, pH 6.5.

[0146] Trace element mother solution: FeSO4·7H2O, ZnSO4·7H2O, CuSO4·5H2O, Na2B4O7·10H2O, (NH4)6Mo7O 24 4H2O, pH 2.5, 0.22μM filter sterilized.

[0147] TB3 low-sugar medium: 3 g / L yeast extract, 3 g / L Casamina Acids, 30 g / L sucrose and 15 g / L agar, pH 5.5.

[0148] YPG medium: 4 g / L yeast extract, 1 g / L KH2PO4, 0.5 g / L MgSO4·7H2O and 15 g / L glucose (pH 6.0).

[0149] YPM culture medium: 12% maltodextrin, 0.5% soybean meal powder, 2% corn steep liquor powder, 0.1% magnesium sulfate, 0.5% urea, 1% potassium dihydrogen phosphate, 0.08% calcium chloride, 0.075% ferrous sulfate, and the rest is water. The pH is adjusted to 6.0 before digestion.

[0150] MY medium: beef extract powder 8g / L, yeast extract 2g / L, trypsin 5g / L, sodium chloride 2g / L, maltose 30g / L, pH5.8.

[0151] STC buffer consists of 0.8 M sorbitol, 25 mM Tris (pH 8.0) and 25 mM CaCl2, made up to 1 liter with water, pH 8.0.

[0152] The STPC buffer was composed of 40% PEG4000 added to the STC buffer, pH 8.0.

[0153] Enzymes and other biochemical reagents: Endonucleases were purchased from Fermentas, ligases were purchased from Promaga, and DNA polymerases were purchased from Beijing Quanshijin Biotechnology. Plasmid extraction kits and purification kits were purchased from Shanghai Shenggong Company. Antibiotic Zeocin was purchased from Invitrogen, and all other reagents were domestic analytical reagents (all available from ordinary biochemical reagent companies).

[0154] Aspergillus oryzae or Aspergillus niger genome extraction

[0155] Aspergillus oryzae NBRC4177 or Aspergillus niger ATCC1015 were inoculated on TB3 low-glucose medium and cultured at 30°C for 7 days until the spores matured. 7 The mycelium was inoculated into a YPG medium liquid seed culture medium and cultured at 30°C and 200 rpm for 2 days until the mycelium concentration reached 4-5 g / L for genome extraction, according to the instructions of the Omega Fungal Genome Extraction Kit.

[0156] Conventional PCR amplification:

[0157] The reaction system and reaction parameters are shown in Table 1 below.

[0158] Table 1

[0159]

[0160] The fusion PCR amplification reaction system and reaction parameters are shown in Table 2 below.

[0161] Table 2

[0162]

[0163] Aspergillus oryzae or Aspergillus niger transformation method:

[0164] 1) Inoculate spores from the slant of Aspergillus oryzae or Aspergillus niger into YPG liquid culture medium, culture overnight at 30°C and 200 rpm (12-16 h) to form dense and small bacterial balls (d < 2 mm), filter the mycelium in the culture medium with sterile Microcloth, wash the mycelium with sterile water 2-3 times, and finally obtain clean mycelium (about 200 mg).

[0165] 2) Prepare enzyme solution system (20 ml): 0.5% cellulase, 0.5% snail enzyme, 0.8% Yatalase, 0.8M KCl, add deionized water to 20 ml, and sterilize with 0.22 μM filter membrane.

[0166] 3) Add the enzyme solution prepared in step 2) to the mycelium prepared in step 1) and perform enzymolysis at 80 rpm and 30° C. for 3 h.

[0167] 4) Filter the protoplasts through Microcloth to remove mycelial debris. Harvest the protoplasts and wash twice with STC buffer. Finally, resuspend the protoplasts in 200-1000uL STC.

[0168] 5) Add 5ug DNA to 100uL protoplast suspension, then add 200uL STPC buffer, and incubate the mixture at room temperature for 20 minutes. Harvest protoplasts and wash twice with 0.8M sorbitol. Finally, resuspend protoplasts in 200uL 0.8M sorbitol.

[0169] 6) The suspension was mixed with CD transformation medium (temperature about 50 degrees) and poured, and the transformants containing the pyrG gene were selected using a medium without uridine and uracil. After growing at 30°C for 5-7 days, stable transformants appeared to grow vigorously and form spores in the colonies. Transformants were purified twice by conidia.

[0170] Shake flask fermentation

[0171] The spores of the above transformants were used to inoculate a shake flask containing 50 ml of YPM medium. To ensure the stability of the shake flask, all shake flasks were inoculated with a uniform inoculation volume of 2 ml and a spore concentration of 2 × 10 7 / ml, and cultured in the same shaking incubator at 30°C, 200 rpm for 5 days.

[0172] Aspergillus oryzae or Aspergillus niger fermentation method

[0173] Seed culture: Spores from solid TB3 low-sugar medium culture were transferred to shake flasks (glycerol 20 g / L, yeast extract 18 g / L) and incubated at 30°C and 250 rpm for 1 day.

[0174] Fed-batch fermentation:

[0175] The tank medium (sucrose 24g / L, yeast extract 10g / L, (NH4)2SO4 5g / L, MgSO4·7H2O 2g / L, K2SO4 2g / L, citric acid 1g / L, KH2PO4 2g / L, trace element solution 0.5ml / L) was adjusted to 30°C. Aeration was 1 vvm and pH was controlled at 6.0 using 10% ammonia. The tank medium was inoculated from the seed culture. When pH>6.4, feeding (400g / L maltose syrup, 1g / L citric acid) was started at a rate of 3.33g / L / h. The agitator speed was controlled to avoid low dissolved oxygen (<20%).

[0176] SDS-PAGE

[0177] The culture supernatants or purified samples were analyzed by SDS-PAGE using 16.5% Criterion SDS gel. TM Tris Tricine precast gel (Bio-Rad). On the gel, 20 μl of sample (10 μl of each sample mixed with 10 μl of loading buffer) was loaded, and 10 μl of Marker was applied: (pre-stained SDS-PAGE standard, GenScript Bio, #M00624-250). In 1× SDS buffer (Bio-Rad), the gel was electrophoresed at a constant current of 20 mA for 80 min. The protein band was stained with Bio-Safe Coomassie dye (Bio-Rad).

[0178] Orotidine-5′-phosphate decarboxylase activity assay

[0179] 500μmol / L orotic acid, 200μmol / L PRPP, 3mol / L MgCl2, 50mmol / L Tris-HCl pH8.0, 1ml orotic acid phosphoribosyl transferase and 1ml orotidine-5′-phosphate decarboxylase were mixed with 8ml substrate and reacted at 37°C, 220rpm for 0-30min, then 1ml was quickly sampled and 3.5% perchloric acid was added to terminate the reaction. The reduction of orotic acid and the generation of uracil nucleotides were detected by HPLC. 10ml substrate reaction system without enzyme solution was used as blank control.

[0180] Enzyme activity detection method (HPLC):

[0181] 1) LiChrospher C18 [5 μm, 250 × 4 mm] chromatographic column (Agilent, USA);

[0182] 2) Mobile phase: triethylamine phosphate solution at pH 6.6;

[0183] 3) Column temperature: room temperature;

[0184] 4) Detection wavelength: 260nm;

[0185] 5) Flow rate: 1 ml / min;

[0186] 6) Injection volume: 20 μL

[0187] One unit of orotidine-5′-phosphate decarboxylase activity is defined as the amount of enzyme required to generate 1 μmol of uracil nucleotide per minute.

[0188] strain

[0189] Aspergillus oryzae NBRC4177: available from Institute for fermentation, Osaka; 17-25 Juso Hammachi 2-Chome Yodogawa-Ku, Osaka, Japan.

[0190] Aspergillus niger ATCC1015: can be purchased from ATCC Culture Collection Center.

[0191] Example 1 Construction of a mutant library of Aspergillus nidulans orotidine-5′-phosphate decarboxylase

[0192] The orotidine-5′-phosphate decarboxylase screening marker nucleic acid sequence (Sequence ID: BN001301.1) from Aspergillus nidulans FGSC A4 can be obtained from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). The present invention uses a full gene synthesis method to synthesize the sequence, and the gene synthesis is completed by Nanjing GenScript Biotechnology Co., Ltd. The orotidine-5′-phosphate decarboxylase screening marker nucleic acid sequence is shown in SEQ ID NO: 1, which contains a promoter, a gene coding region sequence and a terminator element, the sequence base 1-300bp is the promoter sequence, the sequence base 301-1184bp is the gene coding region sequence (wherein the sequence base 458-516bp is the intron sequence), and the sequence base 1185-1540bp is the terminator sequence. The amino acid sequence corresponding to the orotidine-5′-phosphate decarboxylase gene coding region sequence is shown in SEQ ID NO: 2. Screen and modify the amino acids in its active region or with key characteristics to reduce the activity of the enzyme protein. The main sites screened include S38, D40, K62, H64, T102, L155, M158, Q225, Y227, T212 and I242. These amino acid sites are substrate binding or close to the active catalytic domain. The final selected mutation sites are S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A and I242A, or combined mutations of L155A and M158A, Q225A and Y227F. Using the synthetic orotidine-5′-phosphate decarboxylase screening marker nucleic acid sequence as a template, primers were designed to construct a mutant library. The primer sequences are shown in Table 3. Using the overlap extension PCR method, the upstream fragment of orotidine-5′-phosphate decarboxylase screening marker was amplified by primer pair S38A-F1 / S38A-R1, the downstream fragment of orotidine-5′-phosphate decarboxylase screening marker was amplified by primer pair S38A-F2 / S38A-R2, and the upstream and downstream mixed fragments were used as templates to amplify the mutant sequence of orotidine-5′-phosphate decarboxylase screening marker, which was named S38A. Similarly, the upstream fragment of orotidine-5′-phosphate decarboxylase screening marker was amplified by primer pair S38A-F1 / D40A-R1, the downstream fragment of orotidine-5′-phosphate decarboxylase screening marker was amplified by primer pair D40A-F2 / S38A-R2, and the mutant sequence of screening marker was amplified by primer pair S38A-F1 / S38A-R2, and the upstream and downstream mixed fragments were used as templates to amplify the mutant sequence of screening marker, which was named D40A.By analogy, the screening marker mutant sequences K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A and I242A were obtained respectively. Using the mutant sequence M158A as a template, the primer pair S38A-F1 / L155A_M158A-R1 was used to amplify the upstream fragment of the orotidine-5′-phosphate decarboxylase screening marker, and the primer pair L155A_M158A-F2 / S38A-R2 was used to amplify the downstream fragment of the orotidine-5′-phosphate decarboxylase screening marker. The primer pair S38A-F1 / S38A-R2 was used to amplify the upstream and downstream mixed fragments as templates to obtain the screening marker combination mutant sequence, which was named L155A_M158A. Using the mutant sequence Q225A as a template, the primer pair S38A-F1 / Q225A_Y227F-R1 was used to amplify the upstream fragment of the orotidine-5′-phosphate decarboxylase screening marker, and the primer pair Q225A_Y227F-F2 / S38A-R2 was used to amplify the downstream fragment of the orotidine-5′-phosphate decarboxylase screening marker. The primer pair S38A-F1 / S38A-R2 was used to amplify the upstream and downstream mixed fragments as templates to obtain the screening marker combination mutant sequence, named Q225A_Y227F, thereby obtaining the entire Aspergillus nidulans orotidine-5′-phosphate decarboxylase mutant library.

[0193] Table 3 Primer sequences used in the construction of mutant library

[0194]

[0195]

[0196]

[0197] Example 2 Activity test of orotidine-5′-phosphate decarboxylase mutant

[0198] Using the Aspergillus nidulans orotidine-5′-phosphate decarboxylase parent or mutant sequence in Example 1 as a template, primers P1 and P2 were used for specific PCR amplification to separate the parent or mutant gene coding sequence, and the PCR amplification results were detected by agarose electrophoresis, and the target product of PCR amplification was purified and recovered. The target fragment was double-digested with EcoRI and XbaI and connected to the pPICZαA vector. The ligation product was transferred into Escherichia coli Top10 competent cells by chemical conversion heat shock method, coated with LB-Z resistance plates, and inverted cultured at 37°C. After transformants appeared on the plate, single clones were picked and inoculated into LB-Z resistance test tubes and cultured at 37°C. The recombinant transformants were verified by bacterial liquid PCR, and the plasmids of the correct transformants were extracted and sequenced to determine the corresponding parent or mutant gene coding sequences.

[0199] Primer P1: 5'-CCG GAATTC TCTTCGAAGTCCCACCTCC-3' (SEQ ID NO: 31, wherein the 4th to 9th bp are EcoRI restriction sites)

[0200] Primer P2: 5'-CTAG TCTAGA AAGTCCAACTCTTTTCTCGTAAGCT-3' (SEQ ID NO: 32, wherein the 5th to 10th bp are XbaI restriction sites)

[0201] The plasmid encoding the gene sequence correctly sequenced above was linearized using restriction endonuclease PmeI, the linear plasmid fragment was recovered and purified, and transformed into Pichia pastoris X33 competent cells by electrotransformation, and screened by YPD-Z resistance medium to obtain yeast recombinant transformants.

[0202] Preparation of Pichia pastoris X-33 competent cells: 1) Inoculate a single colony of Pichia pastoris X-33 to 5 ml YPD medium, and culture at 30°C, 250rpm / min for 24h; 2) Take 1ml of the culture solution and inoculate it into a 500ml shake flask containing 100ml YPD medium and culture it for 12-16h, until OD600 = 0.8-1.2, transfer the bacterial solution into a 50ml pre-cooled centrifuge tube, centrifuge at 4°C, 5000g for 5min, and discard the supernatant; 3) Resuspend the bacteria with 25ml pre-cooled sterile water, centrifuge at 4°C, 5000g for 5min, discard the supernatant, and repeat this step 2-3 times; 4) Resuspend the bacteria with 5ml pre-cooled 1mol / L sorbitol in each tube, centrifuge at 4°C, 5000g for 5min, discard the supernatant, and repeat this step 2-3 times; 5) Finally, resuspend with 200μL sorbitol and divide into 1.5ml centrifuge tubes, 80μL per tube.

[0203] Transformation screening: 1) Take a competent cell and add 10 μL of linearized and concentrated DNA, mix gently, and transfer to a pre-cooled 0.2 cm electrode cup and place on ice for 5 minutes; 2) Perform electric shock at the electric shock parameters of 1.5Kv, 25μF, 200Ω. After the electric shock is completed, quickly add 1 ml of pre-cooled 1 mol / L sorbitol, and then transfer the mixed solution to a 1.5 ml centrifuge tube and resuscitate at 30°C for 1 hour; 3) Take 200 μL and spread it on YPD-Z solid culture medium containing 100 μg / ml Zeocin, culture the plate at 30°C for 3 days, observe positive transformants, use PCR to identify positive single colonies, and send PCR-positive colonies for sequencing verification.

[0204] Recombinant transformants were picked and transferred to 50ml BMGY medium, and after 30℃, 220rpm shaking culture for 18h, centrifuged to obtain bacteria, and appropriate amount of bacteria were transferred to 50ml BMMY medium to make the bacteria concentration reach OD600=1, 30℃, 250rpm continued shaking culture, and 1% methanol of culture volume was added every 24h. After induced expression for 4d, the culture solution was centrifuged to obtain supernatant, and the parent and mutant of orotidine-5'-phosphate decarboxylase were purified by nickel affinity chromatography purification method, and the enzyme activity of the purified samples was determined, and the specific activity was calculated. The relative specific activity of the mutant was calculated by dividing the mutant specific activity by the parent specific activity. As shown in Table 4, compared with the parent of orotidine-5'-phosphate decarboxylase, the enzyme activity of the mutant showed a significant decrease.

[0205] Table 4 Comparison of specific activities of orotidine-5′-phosphate decarboxylase parent and mutant

[0206]

[0207]

[0208] Example 3 Preparation of nucleic acid constructs for target gene expression

[0209] 3.1 Isolation of the Aspergillus oryzae α-amylase promoter (PamyB) sequence

[0210] According to the sequence of amyB promoter published on GeneBank (GenBank: AP007157.1), the genomic DNA of Aspergillus oryzae NBRC4177 was used as a template, and the upstream primer PaF and the downstream primer PaR were used to perform specific PCR amplification to isolate the amyB promoter sequence (SEQ ID NO: 33), which was named PamyB. The PCR product was subjected to agarose gel electrophoresis to recover the target fragment, and the gel was cut and purified according to the instructions of the Axygen kit. Among them:

[0211] The sequence of the upstream primer PaF is:

[0212] GCCTGCATGCAAGCTTGGCGCGCCGAATTCATGGTGTTTTGATCA TT (5'-3') (SEQ ID NO: 34).

[0213] The sequence of downstream primer PaR is:

[0214] CTCTAGATCTCGAGACGCGTACTAGTCTTAAGAAATGCCTTCTGTGGGGTTTA (5'-3') (SEQ ID NO: 35).

[0215] 3.2 Isolation of Aspergillus niger saccharifying enzyme terminator (Ter)

[0216] According to the Aspergillus niger saccharifying enzyme terminator sequence published on GeneBank (GenBank: AM270061.1), the Aspergillus niger ATCC1015 genomic DNA was used as a template, and the upstream primer TrF and the downstream primer TrR were used to perform specific PCR amplification to separate the saccharifying enzyme terminator sequence (SEQ ID NO: 36), which was named Ter. The PCR product was subjected to agarose gel electrophoresis to recover the target fragment.

[0217] in:

[0218] The sequence of the upstream primer TrF is:

[0219] CTTAAGACTAGTACGCGTCTCGAGATCTAGAGGGTGACTGACACC TGGCGGTAG (5'-3') (SEQ ID NO: 37).

[0220] The sequence of the downstream primer TrR is:

[0221] TGCGCAAGCAAGTAATGCATTGAATGACAGTGATATCAG(5'-3') (SEQ ID NO: 38).

[0222] 3.3 Preparation of nucleic acid constructs for target gene expression by fusion of sequence elements

[0223] The above-mentioned amylase promoter PamyB and saccharifying enzyme terminator Ter sequence were used as mixed templates, and the upstream primer PaF and the downstream primer TrR were used to perform specific PCR amplification to separate the PamyB_Ter fusion sequence. The Aspergillus nidulans orotidine-5′-phosphate decarboxylase parent or mutant sequence in Example 1 was used as a template, and the upstream primer TpF and the downstream primer TpR were used to perform specific PCR amplification to separate the orotidine-5′-phosphate decarboxylase parent or mutant sequence. The PamyB_Ter fusion sequence and the isolated orotidine-5′-phosphate decarboxylase parent or mutant sequence were used as mixed templates, and specific PCR amplification was performed using the upstream primer PaF and the downstream primer TpR to obtain the final nucleic acid construct for target gene expression. The nucleic acid constructs were named PamyB-pyrG WT, PamyB-pyrG S38A, PamyB-pyrG D40A, PamyB-pyrG K62A, PamyB-pyrG H64A, PamyB-pyrG T102A, PamyB-pyrG L155A, PamyB-pyrG M158A, PamyB-pyrG Q225A, PamyB-pyrG Y227F, PamyB-pyrG T212A, PamyB-pyrG I242A, PamyB-pyrG L155A_M158A, PamyB-pyrG Q225A_Y227F, the corresponding nucleotide sequences are SEQ ID NO: 39 to SEQ ID NO: 52. The PCR products were subjected to agarose gel electrophoresis to recover the target fragments.

[0224] The sequence of the upstream primer TpF is:

[0225] GTCATTCAATGCATTACTTGCTTGCGCAAGCGGGT(5'-3') (SEQ ID NO: 53).

[0226] The sequence of the upstream primer TpR is:

[0227] TCACATGTAAGCTtAGCCCACTTTCTCAACTGGA(5'-3') (SEQ ID NO: 54).

[0228] The above nucleic acid construct sequence fragment was digested with SphI and PciI and then connected to the puc57 vector. The ligation product was transformed into E. coli Top10 competent cells by chemical transformation heat shock method, coated with LB-A resistance plate, and inverted cultured at 37°C. After transformants appeared on the plate, single clones were picked and inoculated into LB-A resistance test tubes and cultured at 37°C. The recombinant transformants were verified by bacterial liquid PCR, and the plasmids of the verified correct transformants were extracted for sequencing, and finally the preparation of the nucleic acid construct for target gene expression was completed. The schematic diagram of the plasmid map is shown in Figure 1 .

[0229] Example 4 Expression of fungal amylase in Aspergillus oryzae and Aspergillus niger using the above nucleic acid construct

[0230] 4.1 Isolation of uracil auxotrophic strains of Aspergillus oryzae and Aspergillus niger

[0231] The spore concentration in 5 mL is 2 × 10 7 Fresh spores of Aspergillus oryzae NBRC4177 or Aspergillus niger ATCC1015 were placed in a 5 cm diameter dish for ultraviolet mutagenesis under the mutagenesis conditions (mutation power 15 W, wavelength 254 nm, mutagenesis height 8 cm, mutagenesis time 3 min, magnetic stirrer speed 200 r / min). The mutagenized spores were spread on a CD subculture medium containing 0.15% 5-FOA (5-fluoroorotic acid) and 0.24% uridine. After culturing at 30° C. for 5 days, a single colony resistant to 5-FOA was selected and transferred to a CD subculture medium containing 0.15% 5-FOA (5-fluoroorotic acid) and 0.24% uridine. The single colonies of Aspergillus oryzae grown on the plate are spotted on CD subculture medium and CD subculture medium containing 0.24% uridine respectively; the strains that cannot grow on CD subculture medium but grow on CD subculture medium containing 0.24% uridine are collected as uracil auxotrophic strains of Aspergillus oryzae or Aspergillus niger, the obtained auxotrophic strains are sequenced and analyzed, and the strains with inactivated orotidine-5′-phosphate decarboxylase are selected for subsequent transformation screening.

[0232] 4.2 Expression of fungal amylase in Aspergillus oryzae and Aspergillus niger using nucleic acid constructs

[0233] According to the sequence of the amyB gene published on GeneBank (GenBank: AP007157.1), the genomic DNA of Aspergillus oryzae NBRC4177 was used as a template, and the upstream primer amyF and the downstream primer amyR were used to perform specific PCR amplification to separate the amyB gene sequence. The target fragment was digested with SpeI and XhoI and then connected to the nucleic acid construct in Example 3. The ligation product was transferred into Escherichia coli Top10 competent cells by chemical conversion heat shock method, coated with LB-A resistance plates, and inverted cultured at 37°C. After the transformants appeared on the plate, a single clone was picked and inoculated into an LB-A resistance test tube and cultured at 37°C. The recombinant transformants were verified by bacterial liquid PCR, and the plasmid of the correct transformant was extracted and sequenced to obtain a vector expressing the fungal amylase gene amyB.

[0234] Primer amyF: 5'-GG ACTAGT ATGATGGTCGCGTGGTGGT-3' (SEQ ID NO: 55, wherein the 3rd to 8th bp are SpeI restriction sites)

[0235] Primer amyR: 5'-CCG CTCGAG TCACGAGCTACTACAGATCTTGCT-3' (SEQ ID NO: 56, wherein the 4th to 9th bp are XhoI restriction sites)

[0236] The above plasmid with correct sequencing was linearized with restriction endonuclease HindIII, and the nucleic acid construct fragment containing the target gene was recovered and purified by gel recovery, thereby removing other fragments on the puc57 vector backbone (such as ampicillin resistance gene fragment). The recovered fragment was transformed into Aspergillus oryzae NBRC4177 or Aspergillus niger ATCC1015 strains in which orotidine-5′-phosphate decarboxylase was inactivated, and CD transformation medium without uridine and uracil was used to select transformants containing the pyrG gene. After growing at 30°C for 5 days, the difference in the number of transformants brought by different screening markers such as orotidine-5′-phosphate decarboxylase parents or mutants was counted. The 20 transformants obtained by the same construct were re-purified by conidia twice, and the spores of the transformant strain were inoculated into a shake flask containing 50ml YPM medium and cultured at 30°C and 200rpm for 5 days. After the shaking of the flask, the culture solution was centrifuged to obtain the supernatant, and the supernatant was tested for fungal amylase activity (reference GB1886.174-2016). The average value of total enzyme activity of 20 transformants was taken as the standard to compare the enzyme activity differences brought by different screening markers such as the parent or mutant of Aspergillus nidulans orotidine-5′-phosphate decarboxylase. The results are shown in Figure 2 and Figure 3 .according to Figure 2 and Figure 3The results show that the activity of fungal amylase integrated into Aspergillus oryzae and Aspergillus niger strains using orotidine-5′-phosphate decarboxylase mutant as a screening marker is significantly improved. For the parent sequence, the use of mutant screening markers leads to an increase in fungal amylase activity of 121% to 436%.

[0237] 4.2 Analysis of gene expression differences of the above fungal amylase strains using qPCR

[0238] The strains derived from Aspergillus oryzae and Aspergillus niger were selected and cultured in MY medium at 30°C for 2 days under the same conditions for RNA extraction. RNA extraction was performed using a polysaccharide and polyphenol plant total RNA extraction kit (TSP412, Qingke Biotechnology). The extracted RNA was subjected to a reverse transcription kit ⅢRT SuperMix for qPCR (Qingke Biotechnology) was used for reverse transcription amplification. The cDNA finally obtained was used as a qPCR template using ArtiCan CEO SYBR qPCR Mix (Qingke Biotechnology) was used for amplification. β-actin was used as the internal reference gene, and the transcriptional differences of fungal amylase genes between different strains were compared by the ΔΔCt method. The results are shown in Figure 4 The primer sequences are as follows:

[0239] Primer amyF-qPCR: 5'-CTGATCTCGATACCACCAAG-3' (SEQ ID NO: 57)

[0240] Primer amyR-qPCR: 5'-GTCGTTGGTGTAAGAAGCGA-3' (SEQ ID NO: 58)

[0241] Primer actin-F: 5'-TCTGGTGGTACTACCATGTACC-3' (SEQ ID NO: 59)

[0242] Primer actin-R: 5'-CTCGTCGTACTCCTGCTTGG-3' (SEQ ID NO: 60)

[0243] Figure 4The results showed that the fungal amylase mRNA integrated by different nucleic acid constructs had equivalent transcription levels. Compared with PamyB-amyB-pyrG WT, the transcription level of the fungal amylase gene was significantly enhanced by using the orotidine-5′-phosphate decarboxylase mutant as a screening marker, and the enhancement of the transcription level was mainly due to the increase in the copy number of the gene expressing the fungal amylase. Due to the mutation of the amino acid sequence of orotidine-5′-phosphate decarboxylase, the activity of the mutant was significantly reduced compared with that of the parent. When the orotidine-5′-phosphate decarboxylase mutant was used as a screening marker, more copies were required to ensure that the strain with inactivated orotidine-5′-phosphate decarboxylase could grow normally on a plate without uridine or uracil, which also increased the copy number of the fungal amylase gene integrated into Aspergillus oryzae.

[0244] Example 5 Screening marker promoter truncation of orotidine-5′-phosphate decarboxylase mutants further improves protein expression level

[0245] Taking the plasmid PamyB-pyrG H64A constructed in Example 3 as the target, the promoter expressing the pyrG H64A coding gene was truncated to 200 bp, 150 bp, 100 bp and 50 bp, respectively, and the nucleotide sequences corresponding to the truncated promoters were SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63 and SEQ ID NO: 64, respectively, thereby forming new combined mutants PamyB-pyrG H64A200, PamyB-pyrG H64A150, PamyB-pyrG H64A100 and PamyB-pyrGH64A50, and the mutant construction process was similar to Example 3. The amyB gene sequence was isolated by specific PCR amplification using upstream primer amyF and downstream primer amyR, and the target fragment was double-digested with SpeI and XhoI and then connected to the above-mentioned vector to obtain a vector expressing the fungal amylase gene amyB. The above plasmid with correct sequencing was linearized with restriction endonuclease HindIII, and the nucleic acid construct fragment containing the target gene was recovered and purified by gel recovery. The recovered fragment was transformed into Aspergillus oryzae NBRC4177 or Aspergillus niger ATCC1015 strains in which orotidine-5′-phosphate decarboxylase was inactivated. The 20 transformants obtained by the same construct were re-purified by conidia twice, and the spores of the transformant strain were inoculated into a shake flask containing 50 ml of YPM medium. After the shaking of the flask, the culture solution was centrifuged to obtain the supernatant, and the supernatant was used to detect the fungal amylase activity (refer to GB1886.174-2016). The average value of the total enzyme activity of 20 transformants was taken as the standard to compare the enzyme activity differences brought about by different screening markers such as Aspergillus nidulans orotidine-5′-phosphate decarboxylase parents or combined mutants. The results are shown in FIG. Figure 5The combined mutant obtained by screening the marker promoter truncation and amino acid mutation of orotidine-5′-phosphate decarboxylase mutant further improved the fungal amylase activity, with the increase ranging from 486% to 663%.

[0246] Example 6 Expression of Brazzein in Aspergillus oryzae using the above nucleic acid construct

[0247] According to the Brazzein protein sequence published on GeneBank (GenBank: 2KGQ_A), its amino acid sequence is shown in SEQ ID NO: 65. The sequence was entrusted to Nanjing GenScript Biotechnology Co., Ltd. for codon optimization and gene synthesis. The target fragment of gene synthesis was digested with SpeI and XhoI and then connected to the nucleic acid construct in Example 3. The ligation product was transferred into Escherichia coli Top10 competent cells by chemical conversion heat shock method, coated with LB-A resistance plate, and inverted cultured at 37°C. After the transformants appeared on the plate, a single clone was picked and inoculated into an LB-A resistance test tube and cultured at 37°C. The recombinant transformant was verified by bacterial liquid PCR, and the plasmid of the correct transformant was extracted and sequenced to obtain a vector expressing Brazzein sweet protein.

[0248] The above plasmid with correct sequencing was linearized with restriction endonuclease HindIII, and the nucleic acid construct fragment containing the target gene was recovered and purified by gel recovery, thereby removing other fragments on the puc57 vector backbone (such as the ampicillin resistance gene fragment). The recovered fragment was transformed into the strain of Aspergillus oryzae NBRC4177 in which orotidine-5′-phosphate decarboxylase was inactivated, and the transformant containing the pyrG gene was selected using CD transformation medium without uridine and uracil. The 20 transformants obtained by the same construct were re-purified by conidia twice, and the spores of the transformant strain were inoculated into a shaking bottle containing 50ml YPM medium and cultured at 30°C and 200rpm for 5 days. After the shaking of the bottle, the culture solution was centrifuged to obtain the supernatant, and the supernatant was tested for Brazzein protein concentration by HPLC method (sodium ion analysis column (8.0mm×75mm, 8μm)). The average protein concentration of 20 transformants was taken as a standard to compare the differences in protein concentrations brought about by different screening markers such as the parent or mutant of Aspergillus nidulans orotidine-5′-phosphate decarboxylase, and the Brazzein protein concentration expressed by the nucleic acid construct derived from the parent was normalized to 1.00, and the results are shown in Table 5. According to the results in Table 5, it can be seen that the expression of Brazzein sweet protein integrated in Aspergillus oryzae using orotidine-5′-phosphate decarboxylase mutant as a screening marker is significantly increased. For the parent sequence, the use of mutant screening markers results in an increase in the expression of Brazzein sweet protein by 1.26 to 3.47 times.

[0249] Table 5 Differences in protein concentration of Brazzein expressed by different nucleic acid constructs in Aspergillus oryzae

[0250] Different nucleic acid constructs Relative protein concentration PamyB-Brazzein-pyrGWT 1.00 PamyB-Brazzein-pyrGS38A 1.64±0.08 PamyB-Brazzein-pyrGD40A 2.23±0.10 PamyB-Brazzein-pyrGK62A 1.58±0.07 PamyB-Brazzein-pyrGH64A 3.47±0.16 PamyB-Brazzein-pyrGT102A 1.21±0.06 PamyB-Brazzein-pyrGL155A 1.75±0.09 PamyB-Brazzein-pyrGM158A 2.47±0.14 PamyB-Brazzein-pyrGQ225A 1.95±0.09 PamyB-Brazzein-pyrGY227F 1.26±0.06 PamyB-Brazzein-pyrGT212A 1.87±0.08 PamyB-Brazzein-pyrGI242A 1.38±0.06 PamyB-Brazzein-pyrGL155A_M158A 3.28±0.19 PamyB-Brazzein-pyrGQ225A_Y227F 2.16±0.13

[0251] The above-mentioned embodiments only express several implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A polynucleotide construct comprising: a first polynucleotide encoding a selectable marker; and, one or more second polynucleotides encoding a polypeptide of interest; in, The selectable marker is selected from key enzymes associated with the survival of the host cell; Compared to the selectable marker encoded by the wild-type encoding gene, the selectable marker encoded by the first polynucleotide has a lower expression level and / or lower enzyme activity.

2. The polynucleotide construct according to claim 1, wherein Compared to the wild-type gene encoding the selectable marker, at least one of the following changes is present in the first polynucleotide: i) The promoter is truncated; ii) One or more nucleotides in the coding region are substituted; preferably, the substituted site is associated with the substrate binding property and / or active catalytic property of the selectable marker.

3. The polynucleotide construct according to claim 1 or 2, wherein: The selective marker is selected from key enzymes or mutants thereof related to one or more pathways of nucleotide biosynthesis pathway, amino acid biosynthesis pathway, vitamin synthesis pathway, carbon metabolism pathway, and nitrogen metabolism pathway; Preferably, the selectable marker is selected from key enzymes encoded by amdS, niaD, argB, pyrG genes or mutants thereof.

4. The polynucleotide construct according to claim 1, wherein The first polynucleotide is used to encode orotidine-5′-phosphate decarboxylase or a mutant thereof. Compared with the wild-type encoding gene of orotidine-5′-phosphate decarboxylase, the first polynucleotide contains at least one change of the following a) to b): a) The promoter is truncated; b) one or more nucleotides in the coding region are substituted; preferably, the substituted site is related to the substrate binding property and / or active catalytic property of orotidine-5′-phosphate decarboxylase; Preferably, the first polynucleotide contains the changes in a) and b).

5. The polynucleotide construct according to claim 4, wherein The promoter in the first polynucleotide is truncated to a length of 50 to 200 bp from the 5' end; preferably, the nucleotide sequence of the promoter is as shown in any one of SEQ ID NOs: 61 to 64; or, the nucleotide sequence of the promoter has at least 90% identity with the sequence shown in any one of SEQ ID NOs: 61 to 64, and can reduce the expression level and / or enzyme activity of orotidine-5'-phosphate decarboxylase.

6. The polynucleotide construct according to claim 4 or 5, wherein: Relative to the amino acid position of SEQ ID NO: 2, the orotidine-5′-phosphate decarboxylase mutant encoded by the first polynucleotide comprises at least one mutation among S38, D40, K62, H64, T102, L155, M158, Q225, Y227, T212, and I242, and compared with the orotidine-5′-phosphate decarboxylase parent, the orotidine-5′-phosphate decarboxylase mutant has a lower expression level and / or lower enzyme activity.

7. The polynucleotide construct according to claim 6, wherein The orotidine-5′-phosphate decarboxylase mutant comprises at least one of the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, and I242A.

8. The polynucleotide construct according to claim 6, wherein The orotidine-5′-phosphate decarboxylase mutant comprises the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, I242A, L155A_M158A, or Q225A_Y227F.

9. The polynucleotide construct according to claim 1, wherein The target polypeptide is an aminopeptidase, an amylase, a saccharifying enzyme, a carboxypeptidase, a catalase, a cellobiohydrolase, a cellulase, a chitinase, a cutinase, a cyclodextrin glycosyltransferase, a deoxyribonuclease, an endoglucanase, an esterase, an α-galactosidase, a β-galactosidase, a glucoamylase, an α-glucosidase, a β-glucosidase, a laccase, a lipase, a mannosidase, a mutanase, a glucose oxidase, a pectinase, a peroxidase, a phytase, a polyphenol oxidase, a protease, a ribonuclease, a transglutaminase, a xylanase, a β-xylosidase, a proline-specific protease, a trehalase, a pullulanase, a phospholipase, a mannanase, a lysozyme, a sweet protein, a lactoferrin, a lactoglobulin or a bovine serum albumin; preferably, the target polypeptide is a fungal amylase or a Brazzein sweet protein.

10. A recombinant expression vector comprising at least one copy of the polynucleotide construct according to any one of claims 1 to 9. The recombinant expression vector according to claim 10 , which is capable of integrating the polynucleotide construct into the genome of a host cell.

12. A host cell containing more than one copy of the polynucleotide construct of any one of claims 1 to 9. The host cell according to claim 12 , which has a functional defect that can be complemented by the selectable marker.

14. A mutant of orotidine-5′-phosphate decarboxylase, which comprises at least one mutation of S38, D40, K62, H64, T102, L155, M158, Q225, Y227, T212, and I242 relative to the amino acid position of SEQ ID NO: 2, and has a lower expression level and / or lower enzyme activity than that of an orotidine-5′-phosphate decarboxylase parent.

15. The orotidine-5′-phosphate decarboxylase mutant according to claim 14, wherein The orotidine-5′-phosphate decarboxylase mutant comprises the following mutations: at least one of S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, and I242A; Preferably, the orotidine-5′-phosphate decarboxylase mutant comprises the following mutations: S38A, D40A, K62A, H64A, T102A, L155A, M158A, Q225A, Y227F, T212A, I242A, L155A_M158A, or Q225A_Y227F.

16. An isolated nucleic acid encoding the orotidine-5'-phosphate decarboxylase mutant of claim 14 or 15.

17. The isolated nucleic acid according to claim 16, further comprising a promoter for driving the expression of the orotidine-5′-phosphate decarboxylase mutant, and compared with the natural promoter, the promoter is truncated, preferably the promoter is truncated to a length of 50 to 200 bp from the 5′ end; more preferably, the nucleotide sequence of the promoter is as shown in any one of SEQ ID NOs: 61 to 64; or, the nucleotide sequence of the promoter has at least 90% identity with the sequence shown in any one of SEQ ID NOs: 61 to 64, and can reduce the expression level and / or enzyme activity of orotidine-5′-phosphate decarboxylase.

18. Use of the polynucleotide construct according to any one of claims 1 to 9, or the recombinant expression vector according to claim 10 or 11, or the host cell according to claim 12 or 13, or the orotidine-5′-phosphate decarboxylase mutant according to claim 14 or 15, or the isolated nucleic acid according to claim 16 or 17 in improving the expression level and / or enzyme activity of a target polypeptide.

19. A method for producing a target polypeptide, comprising: Cultivating the host cell according to claim 12 or 13; and optionally recovering the polypeptide of interest.

Images