A probe PCR detection method capable of specifically detecting the human Mur gene

Abstract

The present invention relates to the technical field of human blood type gene detection, and in particular to a probe PCR detection method capable of specifically detecting human Mur gene. The present invention can rapidly and specifically detect human Mur blood type gene, and establishes a fluorescent quantitative PCR detection method of human Mur blood type gene by using designed primers. The method enhances the specificity of the reaction and greatly shortens the detection time. The detection result can be directly interpreted on computer software, breaking through the limitation of traditional serological detection methods. Compared with the PCR-SSP detection method, the method is more economical and practical, and is simple to operate. The present invention is conducive to large-scale automated screening, is suitable for hospitals, blood stations and other units, can provide an effective reference for the detection of Mur antigen in clinical practice, and ensures the safety of blood transfusion. In this way, the technical problem that the Mur blood type detection technology in the prior art is high in cost and inconvenient for large-scale detection is solved.

Description

Technical Field

[0001] The present invention relates to the technical field of human blood type gene detection, and in particular to a probe PCR detection method capable of specifically detecting human Mur gene. Background Art

[0002] The MNS blood group system is the second blood group system discovered after ABO, and the number of polymorphisms of its antigens is second only to the Rh blood group system. The MNS blood group antigen molecules are located on glycoprotein A (GPA) and glycoprotein B (GPB). The glycoproteins of this blood group system mainly originate from unequal crossover or gene conversion events between the homologous regions of GYPA and GYPB. There is a special MI sub-blood group system (Milternberger subsystem) in the MNS blood group system. The Miltenberger blood group antigen is a series of red blood cell phenotypes of low-frequency antigen combinations identified by human serum immune antibodies. Several different GYP (BAB) hybrids produce phenotypes such as GP.Mur, GP.Hop, GP.Bun, GP.HF and GP.Kip glycoproteins, expressing a series of low-incidence antigens in the MNS blood group system, among which Mia (MNS7), Mur (MNS10) and MUT (MNS35) antigens have relatively high immunogenicity. Mur blood group antigens are widely distributed. Mur blood type has a higher chance of unqualified blood transfusion and irregular antibody production. The related antibodies can cause severe hemolytic transfusion reactions and neonatal hemolytic disease, making its significance in clinical blood transfusion second only to the ABO system.

[0003] GYPA and GYPB are coded by closely homologous genes (GYPA / GYPB). GYPA and GYPB genes have a high homology of up to 95%. The emergence of multiple blood type antigens in the MNS system is the result of GYP gene mutation. The generation of Mur antigen is due to the replacement of part of the pseudo exon 3 of the glycophorin B gene (GYPB) by part of the glycophorin A gene (GYPA), thus forming a composite exon structure of GYP (BAB), so that the non-functional splicing site on GYPB can be replaced to express the new composite exon. There are also studies showing that the pseudo exon 3 of GYPB encodes the N-terminal 34-41 position, and the amino acid specific sequence 43YPAHTANE41 expresses Mur antigen. In addition, Mur, Hop, and Bun all contain GYPB pseudo exon products activated by the GYPA insertion fragment, so they all express Mur antigen, which provides a molecular basis and theory for the detection of Mur gene.

[0004] At present, Mur blood type detection mainly relies on traditional antigen detection methods. However, due to the difficulty in obtaining the spectrum cells and serum of Mur blood type, there is no mature commercial anti-Mur antibody supply on the market. Only a few laboratories have human serum antibodies, which are only suitable for scientific research purposes and are expensive, making it difficult to promote on a large scale. In addition, although there are some Mur genotyping kits on the market, most of them are based on PCR-SSP methods, which are cumbersome to operate, have a long detection process, are not conducive to result interpretation, have poor reliability, and are relatively expensive, making them unaffordable for large-scale testing.

[0005] In summary, the existing Mur blood type detection technology is costly and not convenient for large-scale testing. Summary of the invention

[0006] The purpose of the present invention is to provide a probe PCR detection method capable of specifically detecting the human Mur gene, aiming to solve the technical problems in the prior art that the Mur blood type detection technology is high in cost and inconvenient for large-scale detection.

[0007] To achieve the above object, the present invention adopts a probe PCR detection method capable of specifically detecting the human Mur gene, comprising the following steps:

[0008] Mur upstream primer, Mur downstream primer, Mur probe, internal reference upstream primer, internal reference downstream primer, and internal reference probe are mixed in proportion to obtain a primer-probe mixture;

[0009] Extracting nucleic acid from samples;

[0010] The sample nucleic acid, 2X PCR reaction solution and primer-probe mixture were mixed in proportion and then subjected to fluorescent quantitative PCR amplification reaction, and the results were interpreted on computer software.

[0011] The Mur upstream primer sequence is: CAACTTCTCTTATATGCAGATAAGCA;

[0012] The Mur downstream primer sequence is: ATCCTTCTGGAGGGTAAACAGC;

[0013] The Mur probe sequence is: FAM-TATCCAGCTCATACTGC-MGB;

[0014] The internal reference upstream primer sequence is: CCTCTTTCTTTGCAGCAATGCAC;

[0015] The internal reference downstream primer sequence is: GTTGTCATGGATGACCTT;

[0016] The internal reference probe sequence is: VIC-CACCACCAACTGCTTAGCA-MGB.

[0017] The specific method of mixing Mur upstream primer, Mur downstream primer, Mur probe, internal reference upstream primer, internal reference downstream primer and internal reference probe in proportion to obtain a primer-probe mixture is:

[0018] Take 0.4 μL of Mur upstream primer, 0.4 μL of Mur downstream primer, 0.2 μL of Mur probe, 0.2 μL of internal reference upstream primer, 0.2 μL of internal reference downstream primer, and 0.1 μL of internal reference probe and mix them to obtain a primer-probe mixture.

[0019] Among them, the specific method of extracting sample nucleic acid is:

[0020] Take 200uL of fresh anticoagulated blood from a person, extract blood genomic DNA according to the instructions of the QIAGEN blood genome extraction kit or the Tianlong Technology automatic nucleic acid extraction instrument, and use NanoDrop to determine the concentration and purity of the blood genome;

[0021] Among them, the sample DNA concentration should not be less than 10μg / μL, and OD 260 / 280>1.8.

[0022] The sample nucleic acid, 2X PCR reaction solution and primer probe mixture are mixed in proportion to perform fluorescent quantitative PCR amplification reaction, and the results are interpreted on computer software. The specific method is as follows:

[0023] Take out the PCR amplification reaction solution from the kit, thaw at room temperature, mix thoroughly, and centrifuge. Then take (n+2)×10μL of the reaction solution and (n+2)×8μL of the primer-probe mixture, mix thoroughly, and centrifuge. Then dispense into PCR reaction tubes at 18μL / tube.

[0024] Add 2 μL of negative control, positive control, and sample nucleic acid to the PCR reaction tube containing 18 μL of amplification system in order to make the total volume of each reaction tube 20 μL. Close the PCR tube cap, centrifuge at 8,000 rpm, and transfer to the amplification detection area.

[0025] Place the PCR reaction tube into a fluorescent PCR amplification instrument for amplification detection, and select the two fluorescence channels, FAM and VIC. FAM fluorescence indicates the Mur blood type gene, and VIC fluorescence indicates the internal standard GAPDH.

[0026] Where n = number of samples.

[0027] The present invention discloses a probe PCR detection method capable of specifically detecting human Mur gene. The present invention can detect human Mur blood type gene quickly and specifically. A fluorescent quantitative PCR detection method of human Mur blood type gene is established by using designed primers. The method enhances the specificity of the reaction and greatly shortens the detection time. The detection result can be directly interpreted on computer software. The method breaks through the limitation of traditional serological detection methods and is more economical and practical than the PCR-SSP detection method, and is simple to operate. The present invention is conducive to large-scale automated screening, is suitable for hospitals, blood stations and other units, can provide effective reference for the detection of Mur antigen in clinical practice, and ensures the safety of blood transfusion. In this way, the technical problem that the Mur blood type detection technology in the prior art is high in cost and inconvenient for large-scale detection is solved. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0029] Figure 1 This is the fluorescence quantitative PCR test result of the negative control.

[0030] Figure 2 This is the fluorescence quantitative PCR test result of the positive control.

[0031] Figure 3 This is the fluorescence quantitative PCR test result of the negative sample. DETAILED DESCRIPTION

[0032] Embodiments of the present invention are described in detail below. Examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the present invention, but should not be construed as limiting the present invention.

[0033] See also Figure 1 to Figure 3 ,in Figure 1 This is the fluorescence quantitative PCR test result of the negative control. Figure 2 This is the fluorescence quantitative PCR test result of the positive control. Figure 3 This is the fluorescence quantitative PCR test result of the negative sample.

[0034] The invention provides a probe PCR detection method capable of specifically detecting human Mur gene. The adopted reagents include 1.25mL of 2X PCR reaction mixture, 1mL of primer-probe mixture (PPM), 50μL of positive quality control product and 1mL of nuclease-free water; the primer-probe mixture includes Mur upstream primer, Mur downstream primer, Mur probe, internal reference upstream primer, internal reference downstream primer and internal reference probe.

[0035] The Mur upstream primer sequence is: CAACTTCTCTTATATGCAGATAAGCA;

[0036] The Mur downstream primer sequence is: ATCCTTCTGGAGGGTAAACAGC;

[0037] The Mur probe sequence is: FAM-TATCCAGCTCATACTGC-MGB;

[0038] The internal reference upstream primer sequence is: CCTCTTTCTTTGCAGCAATGCAC;

[0039] The internal reference downstream primer sequence is: GTTGTCATGGATGACCTT;

[0040] The internal reference probe sequence is: VIC-CACCACCAACTGCTTAGCA-MGB.

[0041] The following steps are involved:

[0042] S101, taking Mur upstream primer, Mur downstream primer, Mur probe, internal reference upstream primer, internal reference downstream primer, and internal reference probe in proportion and mixing them to obtain a primer-probe mixture;

[0043] For this specific embodiment, 0.4 μL of Mur upstream primer, 0.4 μL of Mur downstream primer, 0.2 μL of Mur probe, 0.2 μL of internal reference upstream primer, 0.2 μL of internal reference downstream primer, and 0.1 μL of internal reference probe were mixed to obtain a primer-probe mixture.

[0044] S102, extracting sample nucleic acid;

[0045] According to this specific embodiment, 200uL of fresh anticoagulated blood was taken from a human being, and the blood genomic DNA of the sample was extracted according to the instructions of the QIAGEN blood genome extraction kit or the Tianlong Technology automatic nucleic acid extraction instrument, and the concentration and purity of the blood genome were determined using NanoDrop;

[0046] Among them, the sample DNA concentration should not be less than 10μg / μL, and OD 260 / 280>1.8.

[0047] S103, mixing the sample nucleic acid, 2X PCR reaction solution and primer-probe mixture solution in proportion, performing fluorescent quantitative PCR amplification reaction, and interpreting the results on a computer software.

[0048] For this specific implementation, the specific steps are as follows:

[0049] Preparation: Take out the PCR amplification reaction solution from the kit, thaw it at room temperature, mix it thoroughly, centrifuge it briefly, and take the reaction solution and primer / probe mixture (PPM) according to the number of reactions n (n = number of samples), and prepare the reaction solution according to the following ratio: calculate the amount of each reagent, add the appropriate volume to the centrifuge tube, mix it thoroughly, centrifuge it briefly, and then dispense it into PCR reaction tubes at 18 μL / tube. The ratio is shown in Table 1;

[0050] Components PCR amplification reaction solution (μL) Primer, probe mixture (PPM) (μL) Serving size (n servings) (n+2)×10μL (n+2)×8μL

[0051] Table 1 Reaction system

[0052] Add samples: Add 2 μL of negative control, positive control, and sample nucleic acid (nucleic acid concentration not less than 10 ng / μL) to the PCR reaction tube containing 18 μL of amplification system in order, so that the total volume of each reaction is 20 μL. Close the PCR tube cap, centrifuge at 8,000 rpm, and transfer to the amplification detection area.

[0053] The PCR reaction tube was placed in a fluorescent PCR amplification instrument for amplification detection, and the two fluorescent channels of FAM and VIC were selected at the same time, wherein the FAM fluorescence indicated the Mur blood type gene, and the VIC fluorescence indicated the internal standard GAPDH. Different from the conventional fluorescent quantitative PCR procedure, the PCR amplification phase of the present invention has two steps, the PCR amplification reaction of step 2 does not collect fluorescent signals, and the fluorescence collection phase of the PCR amplification reaction of step 3 is (60°C 45s).

[0054] The cycle parameter settings are shown in Table 2:

[0055]

[0056] Table 2 Reaction procedure

[0057] The negative and positive quality controls were nuclease-free water and genomic DNA extracted from Mur-positive blood samples confirmed by sequencing.

[0058] The results are analyzed as follows:

[0059] Quality control: Analyze the test results according to the CT value of the fluorescence quantitative PCR amplification instrument: Take the FAM signal CT value as the criterion for whether the PCR reaction is successful, the positive control FAM channel Ct value ≤18, the amplification curve has an obvious exponential growth period, and the negative control should have no obvious amplification signal; Take the VIC signal CT value as the sample quality control standard, the positive control VIC channel Ct value range is ≤14, and the negative control has no obvious amplification. The above two conditions must be met at the same time, otherwise, this test is invalid. Figure 1 , Figure 3 .

[0060] Positive judgment value: The VIC channel (internal standard) of the sample to be tested should have an amplification curve with an obvious exponential growth period, and the Ct value should be ≤14, otherwise the experimental results are invalid and DNA needs to be re-extracted; if the FAM channel of the sample to be tested is 0<Ct value≤18, it is Mur positive; otherwise it is Mur negative. Figure 2 .

[0061] A probe PCR detection method that can specifically detect the human Mur gene in the present embodiment is used. The present invention can quickly and specifically detect the human Mur blood type gene. The fluorescent quantitative PCR detection method of the human Mur blood type gene is established using the designed primers. The method enhances the specificity of the reaction and greatly shortens the detection time. The test results can be directly interpreted on the computer software. It breaks through the limitations of traditional serological detection methods and is more economical and practical than the PCR-SSP detection method, and is simple to operate. The present invention is conducive to large-scale automated screening, suitable for hospitals, blood stations and other units, and can provide an effective reference for the detection of Mur antigens in clinical practice, ensuring the safety of blood transfusion. In this way, the technical problem that the Mur blood type detection technology in the prior art is high in cost and inconvenient for large-scale detection is solved.

[0062] Sequence Listing

[0063] <110> Suzhou Yuanyue Biotechnology Co., Ltd.

[0064] <120> A probe PCR detection method capable of specifically detecting the human Mur gene

[0065] <170> SIPOSequenceListing 1.0

[0066] <210> 1

[0067] <160> 6

[0068] <211> twenty four

[0069] <212> DNA

[0070] <213> Artificial Sequence

[0071] <400> CAACTTCTCTTATATGCAGATAAG 24 <210> 2

[0072] <160> 6

[0073] <211> twenty two

[0074] <212> DNA

[0075] <213> Artificial Sequence

[0076] <400> ATCCTTCTGGAGGGTAAACAGC 22 <210> 3

[0077] <160> 6

[0078] <211> 17

[0079] <212> DNA

[0080] <213> Artificial Sequence

[0081] <400> TATCCAGCTCATACTGC 17

[0082] <210> 4

[0083] <160> 6

[0084] <211> twenty three

[0085] <212> DNA

[0086] <213> Artificial Sequence

[0087] <400> CCTCTTTCTTTGCAGCAATGCAC 23 <210> 5

[0088] <160> 6

[0089] <211> twenty two

[0090] <212> DNA

[0091] <213> Artificial Sequence

[0092] <400> ATCCTTCTGGAGGGTAAACAGC 22 <210> 6

[0093] <160> 6

[0094] <211> 19

[0095] <212> DNA

[0096] <213> Artificial Sequence

[0097] <400> CACCACCAACTGCTTAGCA 19

[0098] What is disclosed above is only a preferred embodiment of the present invention, and it certainly cannot be used to limit the scope of rights of the present invention. Ordinary technicians in this field can understand that all or part of the processes of the above embodiment and equivalent changes made according to the claims of the present invention still fall within the scope of the invention.

Claims

1. A probe PCR detection method capable of specifically detecting the human Mur gene, characterized in that: The following steps are involved: Mur upstream primer, Mur downstream primer, Mur probe, internal reference upstream primer, internal reference downstream primer, and internal reference probe are mixed in proportion to obtain a primer-probe mixture; Extracting nucleic acid from samples; The sample nucleic acid, 2X PCR reaction solution and primer-probe mixture were mixed in proportion and then subjected to fluorescent quantitative PCR amplification reaction, and the results were interpreted on computer software.

2. The probe PCR detection method capable of specifically detecting the human Mur gene according to claim 1, characterized in that: The specific method of mixing Mur upstream primer, Mur downstream primer, Mur probe, internal reference upstream primer, internal reference downstream primer and internal reference probe in proportion to obtain a primer-probe mixture is: Take 0.4 μL of Mur upstream primer, 0.4 μL of Mur downstream primer, 0.2 μL of Mur probe, 0.2 μL of internal reference upstream primer, 0.2 μL of internal reference downstream primer, and 0.1 μL of internal reference probe and mix them to obtain a primer-probe mixture.

3. The probe PCR detection method capable of specifically detecting the human Mur gene as claimed in claim 2, characterized in that: The specific method of extracting sample nucleic acid is: Take 200uL of fresh anticoagulated blood from a person, extract blood genomic DNA according to the instructions of the QIAGEN blood genome extraction kit or the Tianlong Technology automatic nucleic acid extraction instrument, and use NanoDrop to determine the concentration and purity of the blood genome; Among them, the sample DNA concentration should not be less than 10μg / μL, and OD 260 / 280>1.

8.

4. The probe PCR detection method capable of specifically detecting the human Mur gene as claimed in claim 3, characterized in that: The sample nucleic acid, 2X PCR reaction solution and primer probe mixture are mixed in proportion and then subjected to fluorescent quantitative PCR amplification reaction. The results are interpreted on the computer software. The specific method is as follows: Take out the PCR amplification reaction solution from the kit, thaw at room temperature, mix thoroughly, and centrifuge. Then take (n+2)×10μL of the reaction solution and (n+2)×8μL of the primer-probe mixture, mix thoroughly, and centrifuge. Then dispense into PCR reaction tubes at 18μL / tube. Add 2 μL of negative control, positive control, and sample nucleic acid to the PCR reaction tube containing 18 μL of amplification system in order to make the total volume of each reaction tube 20 μL. Close the PCR tube cap, centrifuge at 8,000 rpm, and transfer to the amplification detection area. Place the PCR reaction tube into a fluorescent PCR amplification instrument for amplification detection, and select the two fluorescence channels, FAM and VIC. FAM fluorescence indicates the Mur blood type gene, and VIC fluorescence indicates the internal standard GAPDH. Where n = number of samples.

Images