Molecular marker for identifying genetic sex or / and sex determination system of grass carp and application thereof

Abstract

The application belongs to the field of fish gender determination system identification, and discloses a molecular marker, a primer pair, a kit and application for identifying the genetic sex or / and gender determination system of grass carp. Based on the whole genome resequencing analysis of the grass carp, the sex chromosomes of the published chromosome level genome of the grass carp are determined, and the molecular marker capable of identifying the genetic sex and gender determination system of the grass carp is developed. The molecular marker can accurately and conveniently determine the genetic sex and gender determination system of the grass carp, and can identify the genetic sex without being limited by the development time of the grass carp, thereby saving time and being used for early grass carp breeding. The molecular marker and the primer pair have important significance for the research on the gender control breeding of the grass carp.

Description

Technical Field

[0001] This invention relates to the identification of genetic sex in fish in the field of aquatic organism technology, specifically to a molecular marker, primer pair, and kit for a grass carp genetic sex and / or sex determination system, and the application of genetic sex identification based on this molecular marker. Background Technology

[0002] grass carp( Ctenopharyngodon idella Grass carp (Caucasus carp) is an important economic freshwater fish species, widely distributed in Asia, and plays a particularly important role in aquaculture in China. As one of China's four major freshwater fish species, grass carp accounts for a large proportion of the country's freshwater aquaculture production. Due to its high growth rate, good adaptability, and wide range of food sources, grass carp has become one of the most promising species in global aquaculture. However, in grass carp farming, sex control and sex determination mechanisms have become important factors affecting production efficiency. In grass carp farming, an uneven sex ratio can significantly impact yield, reproductive efficiency, and economic benefits. Studies have shown that male grass carp typically have faster growth rates and higher feed conversion efficiency, making sex control to increase the proportion of male fish a key technological requirement in aquaculture.

[0003] With the continuous development of molecular biology techniques, molecular marker technology has become an important tool for studying the mechanisms of sex determination in aquatic animals. Molecular markers can not only be used for early sex identification but also help reveal gene loci associated with sex determination. By applying molecular marker technology, the genetic sex of grass carp can be rapidly identified in the embryonic or early larval stages, thus providing effective support for selective breeding and sex control. Currently, commonly used molecular marker technologies include microsatellite markers (SSR), single nucleotide polymorphisms (SNP), and restriction fragment length polymorphisms (RFLP). These markers can be used not only for genome research but also to help precisely locate genes related to sex determination.

[0004] Marker-based sex determination research can not only improve breeding efficiency but also provide a foundation for in-depth analysis of the sex determination mechanism in grass carp. However, the application of existing molecular marker technologies in grass carp still faces challenges. Therefore, to meet the needs of sex control in grass carp farming, it is urgent to develop stable, efficient, and highly specific genetic sex molecular markers. These molecular markers can not only be used for sex determination in grass carp but also provide a solid foundation for the development of breeding and sex control technologies. Furthermore, marker-based sex control technology has broad application prospects, which can not only increase grass carp farming yields but also effectively reduce farming costs, promoting the sustainable development of the grass carp industry. Summary of the Invention

[0005] The technical problem solved by the present application is to overcome the deficiencies and defects mentioned in the above background art, and to provide a molecular marker, primer pair, kit and application for identifying the genetic sex or / and sex determination system of common grass carp quickly, simply and accurately.

[0006] To solve the above technical problems, the technical solution provided by the present application is:

[0007] In a first aspect, to achieve the above object, the present application provides a molecular marker for identifying the genetic sex or / and sex determination system of grass carp, wherein the molecular marker is a 30 bp insertion sequence present in the genome of male grass carp individuals, and the nucleotide sequence is TTTTTATTTATTTATTTTTTGTGTGTGTG, as shown in SEQ ID NO: 1.

[0008] In a second aspect, the present application provides a primer pair for amplifying the above-mentioned molecular marker, wherein the primer pair comprises an upstream forward primer CY-F and a downstream reverse primer CY-R, and the nucleotide sequences are as follows:

[0009] CY-F: 3'-ATAGTTGTGCTTGGAGTCA-5' (SEQ ID NO. 2),

[0010] CY-R: 3'-CATCGGTCCTGTCTTGTT-5' (SEQ ID NO. 3).

[0011] In a third aspect, the present application provides a kit for identifying the genetic sex or / and sex determination system of grass carp, comprising the primer pair.

[0012] Preferably, the kit further comprises one or more of Tag DNA Polymerase, extension promoting factor, dNTP, buffer system and ddH2O.

[0013] In a fourth aspect, the present application provides the application of the molecular marker, the primer pair or the kit in identifying the genetic sex or / and sex determination system of grass carp.

[0014] In a fifth aspect, the present application provides a method for identifying the genetic sex or / and sex determination system of grass carp, comprising the following steps:

[0015] (1) extracting the DNA sample of the grass carp to be tested;

[0016] (2) using the DNA sample extracted in step (1) as a template, performing PCR amplification with the primer pair according to claim 2, and performing agarose gel electrophoresis on the PCR amplification product;

[0017] (3) if the agarose gel electrophoresis result shows a single specific band, it indicates that the grass carp individual to be detected is genetically a female with sex chromosome genotype XX; if the agarose gel electrophoresis result shows two bands of different sizes, it indicates that the grass carp individual to be detected is genetically a male with sex chromosome genotype XY; thus the sex determination system of the grass carp is determined to be XX / XY type.

[0018] Preferably, the reaction system of the PCR amplification is as follows: 1 μL of DAN template, 5 μL of Rapid Taq Master Mix, 0.4 μL of each of forward and reverse primers, and finally 3.2 μL of ddH2O to make up to a total volume of 10 μL; the Rapid Taq Master Mix contains Tag DNA Polymerase, extension promoting factor, dNTP and buffer system.

[0019] Preferably, the PCR amplification conditions are as follows: 95 ℃ pre-denaturation for 3 min, 95 ℃ denaturation for 15 s, 46.5 ℃ annealing for 15 s, 72 ℃ extension for 15 s, 35 cycles, then 72 ℃ final extension for 5 min, and finally 4 ℃ preservation.

[0020] Preferably, the agarose gel electrophoresis is 3.0-3.5% agarose gel electrophoresis.

[0021] Compared with the prior art, the present application has the following beneficial effects:

[0022] (1) The molecular marker and primer pair provided by the present application can be used to distinguish the genetic sex and sex determination system of grass carp, and the identification of the genetic sex and sex determination system can be carried out without being limited by the development time of the grass carp, thereby saving time for early selection of the grass carp.

[0023] (2) The molecular marker and identification method provided by the present application are accurate, reliable, easy to operate and low in cost, and have important significance for the research on sex control breeding of grass carp. BRIEF DESCRIPTION OF DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0025] Figure 1 Map of the sex determination region on chromosome 3 of grass carp.

[0026] Figure 2 Figure 1 is a diagram showing the design of a molecular marker for identifying the genetic sex of grass carp.

[0027] Figure 3 Figure 2 is a diagram of a PCR agarose gel electrophoresis for applying the molecular marker of Example 1 to identify the genetic sex and sex determination system of grass carp. DETAILED DESCRIPTION

[0028] In order to facilitate the understanding of the present application, the following will be described in conjunction with the drawings and preferred embodiments of the present application, but the scope of protection of the present application is not limited to the following specific embodiments.

[0029] Unless otherwise defined, all the professional terms used herein have the same meaning as generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing the specific embodiments and are not intended to limit the scope of protection of the present application.

[0030] Unless otherwise specified, the various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or can be prepared by existing methods.

[0031] Example 1:

[0032] A molecular marker for identifying the genetic sex and sex determination system of grass carp, which is obtained by the following method:

[0033] 1. DNA extraction from samples

[0034] First, the gender of grass carp is determined by observing the gonadal tissue through dissection, and after determination, muscle tissue is collected and preserved and fixed using anhydrous ethanol. The determined gender of the grass carp sample is accurately numbered for subsequent whole genome resequencing analysis.

[0035] The DNA extraction kit is used to extract the genomic DNA of the grass carp sample, and after extraction, the purity, concentration and quality of the DNA are detected. First, the purity of the extracted DNA is detected using NanoDrop 2000&8000 and microspectrophotometer; then the DNA concentration is detected using Qubit fluorophotometer; finally, the integrity of the DNA is detected using agarose gel electrophoresis. The DNA that passes the detection is used to construct a high-throughput sequencing library; then individual genome resequencing is performed; after sequencing, the total clean reads of the raw data of ten males and ten females are 1016.33 M and 1059.56 M, respectively.

[0036] 2. Determination of sex chromosomes of grass carp

[0037] The raw data obtained by sequencing is analyzed by using the software fastp for quality control, and high-quality clean reads are obtained; next, the clean reads are aligned with the reference genome of grass carp (NCBI has published the whole genome sequence of grass carp, its NCBI accession number is: GCF_019924925.1) using the software BWA software, and the software parameters used here are the default parameters; using samtools to further generate bam files from the aligned sam files; further using picard software to remove the PCR repeated sequences in the sequencing process of the bam files generated after alignment; using gatk4 software, detecting the single sample and merging after detecting the SNP site. Using vcftools to calculate the Fst (i.e. the average inbreeding coefficient between related local populations) index of SNP between groups, using the --freq function in vcftools, respectively calculating the SNP frequency between groups, calculating the SNP frequency difference between groups, borrowing the ED value calculation in BSA (bulk segregant analysis) analysis, calculating the Euclidean distance between groups, and calculating the total number of SNPs with abs (ΔSNP frequency) greater than 0.5 between groups. Then combine the three results to further determine the sex chromosome and sex determination candidate region of grass carp, the results show that the 3rd chromosome of grass carp is its sex chromosome and Chr3: 11,000,000-11,300,000 is the sex determination region of grass carp Figure 1 ).

[0038] 3. Sex-specific region screening

[0039] According to the determined candidate sex determination region, the generated bam file is viewed using the visualization software IGV, and finally a 30 bp sequence difference exists in the genomes of male and female individuals at the position of grass carp chromosome Chr3: 11122641-11122741, that is, a 30 bp insertion sequence (TTTTTATTTATTTATTTTTTGTGTGTGTG, the nucleotide sequence is shown as SEQ ID NO. 1) exists in the genomes of male grass carp individuals identified as male. Further primer design is carried out on the upstream and downstream of this difference, and finally the upstream primer CY-F: 3'-ATAGTTGTGCTTGGAGTCA-5' (the nucleotide sequence is shown as SEQ ID NO. 2) and the downstream primer CY-R: 3'-CATCGGTCCTGTCTTGTT-5' (the nucleotide sequence is shown as SEQ ID NO. 3) are designed.

[0040] Example 2:

[0041] The molecular marker of Example 1 is applied to identify the genetic sex and sex determination system of grass carp, comprising the following steps:

[0042] 1. PCR amplification: the muscle tissue of the grass carp to be detected is cut, and the genomic DNA is extracted by using a genomic DNA extraction kit or by using a conventional phenol chloroform method. After extraction, the integrity of the extracted genomic DNA and whether the extraction is successful are detected by using agarose gel electrophoresis experiment;

[0043] 2. Synthesis of forward and reverse primers, the forward primer is named CY-F: 3'-ATAGTTGTGCTTGGAGTCA-5' (SEQ ID NO. 2), and the downstream primer is named CY-R: 3'-CATCGGTCCTGTCTTGTT-5' (SEQ ID NO. 3), and the primer synthesis is performed by a company (the primer synthesis is performed by a company Figure 2 );

[0044] 3. The extracted genomic DNA is used as a template to perform PCR amplification experiment, and the total system of PCR reaction is 10 μL, which specifically comprises the following components:

[0045] 1 μL of DAN template, 5 μL of Rapid Taq Master Mix (containing Tag DNA Polymerase, extension promoting factor, dNTP and optimized buffer system), 0.4 μL of forward and reverse primers, and finally 3.2 μL of ddH2O is added to make up to a total volume of 10 μL, and then the mixture is blown and mixed by using a pipette gun and centrifuged briefly;

[0046] 4. The PCR amplification is performed on a machine, and the PCR amplification program is set as follows:

[0047] 95 ℃ pre-denaturation for 3 min, 95 ℃ denaturation for 15 s, 46.5 ℃ annealing for 15 s, 72 ℃ extension for 15 s, 35 cycles, then 72 ℃ final extension for 5 min, and finally 4 ℃ preservation;

[0048] 5. The PCR amplification product is detected by agarose gel electrophoresis experiment, first, 3.5% agarose gel is prepared, after preparation, electrophoresis experiment is performed, the voltage is set to 220 V, the current is set to 100 mA, and the running time is set to 15 min, after electrophoresis, the agarose gel is taken out from the electrophoresis tank and placed in a gel imaging instrument for imaging analysis;

[0049] 6. Result judgment and analysis, the results are as follows Figure 3As shown, the results of agarose gel electrophoresis show a single length of 135 bp specific band, indicating that the grass carp individual to be detected is genetically female, with sex chromosome genotype XX, and the results of agarose gel electrophoresis show two bands of different sizes (135 bp and 164 bp), indicating that the grass carp individual to be detected is genetically male, with sex chromosome genotype XY. Thus, the sex determination system of grass carp is XX / XY type.

Claims

1. A molecular marker for identifying the genetic sex and / or sex determination system of grass carp, characterized in that, The molecular marker is a 30 bp insertion sequence in the genome of male grass carp individuals, with the nucleotide sequence TTTTTTATTTATTTATTTTTTGTGTGTGTG; the primer sequences for detecting the molecular marker are as follows: CY-F: 3'-ATAGTTGTGCTTGGAGTCA-5', CY-R: 3'-CATCGGTCCTGTCTTGTT-5'.

2. The application of a primer pair for amplifying the molecular marker described in claim 1 in identifying the genetic sex and / or sex determination system of grass carp, characterized in that, The primer pair includes an upstream forward primer CY-F and a downstream reverse primer CY-R, and their nucleotide sequences are as follows: CY-F: 3'-ATAGTTGTGCTTGGAGTCA-5', CY-R: 3'-CATCGGTCCTGTCTTGTT-5'.

3. A kit for identifying the genetic sex and / or sex determination system of grass carp, characterized in that, The kit includes the primer pair of claim 2, which is used to amplify the molecular marker of claim 1.

4. The application according to claim 3, characterized in that, The kit also includes one or more of Tag DNA Polymerase, elongation promoting factor, dNTPs, buffer system, and ddH2O.

5. The application of the molecular marker of claim 1 in identifying the genetic sex and / or sex determination system of grass carp.

6. A method for identifying the genetic sex and / or sex determination system of grass carp, characterized in that, Includes the following steps: (1) Extract DNA samples from the grass carp to be tested; (2) Using the DNA sample extracted in step (1) as a template, PCR amplification was performed using the primer pair as described in claim 2, and the PCR amplification product was subjected to agarose gel electrophoresis; the PCR amplification conditions were as follows: 95 °C pre-denaturation for 3 min, 95 °C denaturation for 15 s, 46.5 °C annealing for 15 s, 72 °C extension for 15 s, 35 cycles, then 72 °C final extension for 5 min, and finally stored at 4 °C; (3) If the agarose gel electrophoresis result shows a single specific band, it indicates that the grass carp being tested is a female with a sex chromosome genotype of XX; if the agarose gel electrophoresis result shows two bands of different sizes, it indicates that the grass carp being tested is a male with a sex chromosome genotype of XY; thus, the sex determination system of grass carp is determined to be XX / XY.

7. The method according to claim 6, characterized in that, The PCR amplification reaction system is as follows: 1 μL of DNA template, 5 μL of Rapid Taq Master Mix, 0.4 μL each of forward and reverse primers, and finally 3.2 μL of ddH2O to bring the total volume to 10 μL; the Rapid Taq Master Mix contains Tag DNA Polymerase, extension promoting factor, dNTPs and buffer system.

8. The method according to claim 6, characterized in that, The agarose gel electrophoresis was performed using a 3.0-3.5% agarose gel.

Images