Anti-pancreatic cancer target CAMK2A and application thereof in preparation of pancreatic cancer treatment medicine

Abstract

The invention belongs to the technical field of medicines, and particularly relates to an anti-pancreatic cancer target CAMK2A and application thereof in preparation of pancreatic cancer treatment medicines. According to the present invention, the research results show that the expression of the CAMK2Acicle149613485-149613861 in the pancreatic cancer tissue is significantly up-regulated, and the CAMK2Acicle149613485-149613861 is significantly related to the poor prognosis of the PDAC patient; knock-down of the expression of the CAMK2A is beneficial to reduction of malignant behaviors of pancreatic cancer cells, including invasion, migration, proliferation, clone formation and the like, so that pancreatic cancer tumor tissues are significantly reduced, which indicates that the CAMK2A is a potential effective treatment target for pancreatic cancer. The CAMK2A is found to be a treatment target of the pancreatic cancer for the first time, expression of the CAMK2A is remarkably related to malignant behaviors of the pancreatic cancer and poor prognosis of a PDAC patient, a new target is provided for clinical treatment of the pancreatic cancer, and a new direction is provided for immunotherapy of the pancreatic cancer.

Description

Technical Field

[0001] The present invention belongs to the field of medical technology, and specifically relates to an anti-pancreatic cancer target CAMK2A and an application thereof in preparing a pancreatic cancer therapeutic drug. Background Art

[0002] Pancreatic cancer is one of the most deadly types of cancer, with poor prognosis and insidious onset. Currently, surgery is still the only treatment to eradicate the disease, but about 75% of cases still metastasize after surgery. Therefore, pancreatic cancer currently lacks effective treatment options and therapeutic targets. Among them, pancreatic ductal adencarcinoma (PDAC) accounts for more than 90% and has become the third leading cause of cancer-related deaths in current cancer statistics. More worryingly, before 2040, PDAC will rank it as the second largest cancer after lung cancer, becoming the leading cause of cancer-related deaths. Chemotherapy and surgery remain the main treatment options for PDAC, but only 15%-20% of patients meet the surgical conditions at diagnosis, and about 75% of them metastasize regardless of whether they undergo surgery or not. In addition, except for a few cases (10%-15%) that can be attributed to germline mutations or known risk factors, the etiology of most patients is complex. Therefore, new treatment strategies are urgently needed to achieve an understanding of the mechanism of PDAC and provide potential therapeutic targets for PDAC patients.

[0003] In November 2019, the international academic journals Nature and Cell successively published important studies on extrachromosomal circular DNA (eccDNA), which completely overturned people's traditional understanding of oncogenes. They exist outside chromosomes and have a circular structure, so they are called extrachromosomal circular DNA. At the same time, more and more evidence shows that eccDNA is closely related to cancer progression. eccDNA is widely present in human cancer cells, and its enrichment usually increases the amplification of oncogenes, thereby increasing the cancer-promoting effect of oncogenes. Therefore, it may have important significance for the evolution of tumor cells, and is expected to open up new avenues for cancer research and provide new therapeutic targets for cancer. For example, studies have shown that eccDNA of tumor-related genes is frequently amplified in many types of cancer. These characteristics enable eccDNA to play a role in promoting tumor deterioration, and the elimination of extrachromosomal amplified proto-oncogenes shows significant therapeutic effects, which suggests that it may be an effective method for treating malignant tumors. However, there are no relevant research reports on the eccDNA map of pancreatic cancer and targets with potential therapeutic value. Summary of the invention

[0004] In order to overcome the deficiencies of the above-mentioned prior art, the present invention provides an anti-pancreatic cancer target CAMK2A and its use in the preparation of pancreatic cancer therapeutic drugs. The present invention discovers for the first time that CAMK2A is a therapeutic target for pancreatic cancer, and that the expression of CAMK2A is significantly correlated with the malignant behavior of pancreatic cancer and the poor prognosis of PDAC patients, which provides a new target for the clinical treatment of pancreatic cancer and a new direction for pancreatic cancer immunotherapy.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is:

[0006] The first aspect of the present invention provides the use of an agent for inhibiting or reducing CAMK2A expression in the preparation of a drug for treating pancreatic cancer.

[0007] The second aspect of the present invention provides the use of an agent for inhibiting or reducing CAMK2A expression in the preparation of a drug for reducing the proliferation and migration of pancreatic cancer cells.

[0008] The present invention detected and characterized the eccDNA expression profiles of 10 pairs of PDAC primary pancreatic cancer PDAC tissues and paired tissues. Through differential expression analysis and PCR combined with first-generation sequencing verification, the eccDNA significantly highly expressed in pancreatic cancer was identified. Furthermore, the combined prognostic analysis was performed using pancreatic cancer clinical tissue samples, and CAMK2A was identified. circle149613485 -149613861 (Gene ID: NM_015981) is significantly upregulated in pancreatic cancer tissues and is significantly associated with poor prognosis in PDAC patients. At the same time, using in vitro experiments with pancreatic cancer cells, it was found that knocking down CAMK2A expression helps reduce the malignant behavior of pancreatic cancer cells, including invasion, migration, proliferation and cloning. In an in vivo experiment of a nude mouse subcutaneous tumor model, by subcutaneously injecting pancreatic cancer cells and control cells with knockdown CAMK2A expression into nude mice, it was found that pancreatic cancer tumor tissue was significantly reduced in mice with knockdown CAMK2A gene expression. The above results indicate that CAMK2A is a potential effective therapeutic target for pancreatic cancer.

[0009] Preferably, the pancreatic cancer is pancreatic ductal adenocarcinoma.

[0010] Preferably, the agent for inhibiting or reducing CAMK2A expression is sgRNA, and its nucleotide sequence is shown in SEQ ID NO:25.

[0011] The third aspect of the present invention provides a drug for treating pancreatic cancer, wherein the drug has an agent that inhibits or reduces the expression of CAMK2A as a main active ingredient.

[0012] Preferably, the drug further comprises a pharmaceutically acceptable excipient. More preferably, the excipient is a functional pharmaceutical excipient available in the pharmaceutical field, including (but not limited to) surfactants, suspending agents, emulsifiers, and some new pharmaceutical polymer materials, such as cyclodextrin, chitosan, polylactic acid (PLA), polyglycolic acid-polylactic acid copolymer (PLGA), hyaluronic acid, etc.

[0013] Preferably, the dosage form of the drug includes injection, powder, granule, capsule, tablet.

[0014] Preferably, the administration of the drug includes injection and oral administration.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The present invention has been found through research that CAMK2A circle149613485-149613861 The expression of CAMK2A is significantly upregulated in pancreatic cancer tissues, and is significantly correlated with the poor prognosis of PDAC patients. Knocking down the expression of CAMK2A helps to reduce the malignant behavior of pancreatic cancer cells, including invasion, migration, proliferation and cloning, thereby significantly reducing pancreatic cancer tumor tissue, indicating that CAMK2A is a potential effective therapeutic target for pancreatic cancer and is expected to be used to prepare or screen pancreatic cancer therapeutic drugs. The present invention is the first to discover that CAMK2A is a therapeutic target for pancreatic cancer. The expression of CAMK2A is significantly correlated with the malignant behavior of pancreatic cancer and the poor prognosis of PDAC patients, providing a new target for the clinical treatment of pancreatic cancer and a new direction for pancreatic cancer immunotherapy. Therefore, the present invention provides a powerful molecular biological tool for the treatment of pancreatic cancer, which has far-reaching clinical significance and important prospects for promotion and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1To perform whole-genome detection and analysis of the eccDNA distribution in PADC cancer tissue (test) and paired adjacent normal tissue (control) by high-throughput sequencing; A: eccDNA types and numbers of related genes from PADC cancer tissue (Test) and paired adjacent normal tissue (control); B: size distribution of eccDNA in PADC cancer tissue (Test) and paired adjacent normal tissue (control), each test sample was marked with a different color; C, D: distribution of eccDNA of 23 pairs of chromosomes in paired adjacent normal tissue (C) and PADC cancer tissue (D); E: eccDNA frequency per Mb of each chromosome in paired adjacent normal tissue and PADC cancer tissue, eccDNA frequency per chromosome in cancer tissue The frequencies of ccDNA were higher than those in para-cancer tissues; F, G: GC content of eccDNA sites and adjacent upstream and downstream regions, F. Paired para-cancer tissues (control); G. PADC cancer tissues (Test); H: Genomic distribution of eccDNA in PADC cancer tissues (Test) and paired para-cancer tissues (control), CpG2kbD, located 2kb downstream of the CpG island; CpG2kbU, located 2kb upstream of the CpG island; Gene2kbD, 2kb downstream of the gene; Gene2kbU, 2kb upstream of the gene; I: Repeated regions read from the total eccDNA map of each sample, red, cancer tissue (Test); blue, para-cancer tissue (control).

[0018] Figure 2 The validation results of differentially expressed eccDNA in PADC cancer tissue (Test) and paired adjacent tissue (control) samples; A: KEGG pathway enrichment analysis was performed on the genes corresponding to the significantly upregulated eccDNA. Among the top 10 signaling pathways, they were mainly enriched in tumor-related signaling pathways, such as Pap1 signaling pathway, Focal Adhesion, etc.; B: Cluster heat map of sequencing analysis of differentially expressed circRNA (circular RNA) in paired primary and paracancerous tissues of PDAC patients, red, up-regulated; blue, down-regulated; C: GO analysis of the main molecular functions of circRNAs significantly overexpressed in cancer tissues; D: Cluster heat map of transcriptome sequencing analysis of differentially expressed mRNA in paired primary and paracancerous tissues of PDAC patients, red, up-regulated; blue, down-regulated; E: GO analysis of the main molecular functions of mRNAs significantly overexpressed in cancer tissues; F: Venn diagram showing the overlap of all differentially expressed mRNAs or circRNAs and eccDNAs of the same host gene, the left figure is the sequencing diagram of circRNA and eccDNA of the same host gene; the right figure is the mRNA and eccDNA of the same host gene.

[0019] Figure 3is the PCR verification result of the candidate eccDNA; among them, Figure 3 A: Outward PCR (green arrow) and inward PCR (red arrow) were performed to verify the genomic DNA and amplified eccDNA samples to detect the specific circular connection of the candidate eccDNA in pancreatic cancer tissue; BJ: Outward and inward PCR of 9 candidate eccDNAs, each candidate eccDNA was tested by outward PCR and inward PCR; band 1 is eccDNAinward after enrichment of pancreatic cancer tissue sample (Test1); band 2 is Test1 genomic DNAinward, band 3 is NTC inward (negative control), band 4 is eccDNAinward after Test1 rolling circle amplification; band 5 is eccDNA outward after Test1 enrichment; band 6 is Test1 genomic DNA outward; band 7 is NTC outward (negative control); band 8 is eccDNAoutward after Test1 rolling circle amplification.

[0020] Figure 4 Sanger sequencing was used to verify the eccDNA connection site. The Sanger sequencing results of the PCR product confirmed the existence of three eccDNA connection sites; among them, A and B: gene DOCK 4chr7:111508481-111509072 After Sanger sequencing, there is a splicing site and the sequence is consistent with expectations, so it is the target circular; C, D: gene WISP1 chr8:134225624-134225958 After Sanger sequencing, there is a splicing site and the sequence is consistent with expectations, so it is the target circular; E, F: gene CAMK2A chr5:149613485-149613861 After Sanger sequencing, there was a splicing site and the sequence was consistent with expectations, so it was the target circularity.

[0021] Figure 5 camk2A in pancreatic cancer circlechr5:149613485-149613861 and DOCK4 circlechr7:111508481-111509072 High expression is significantly associated with poor prognosis of patients; A, B: CAMK2A circlechr5:149613485-149613861 ,DOCK4 circlechr7: 111508481-111509072 and WISP1 circlechr8:134225624-134225958 Representative images of FISH detection in FFPE tissues of PADC tumor tissue (A) and adjacent adjacent tissues (B); CE: CAMK2A circlechr5:149613485-149613861 ,DOCK4 circlechr7: 111508481-111509072 WISP1 is significantly overexpressed in cancer tissues. circlechr8:134225624-134225958 There was no significant difference in expression between the two groups; F, G: CAMK2A circlechr5:149613485-149613861 and DOCK4circlechr7:111508481-111509072 Kaplan-Meier survival analysis of overall survival in PDAC patients stratified by expression in primary tumor FFPE tissues; high expression of CAMK2A circlechr5:149613485-149613861 and DOCK4 circlechr7:111508481-111509072 The patients had worse prognosis; data are expressed as mean±SD; ****P<0.0001.

[0022] Figure 6 Figure 3 Effects of knockout of CAMK2A and DOCK4 on cell growth and invasive characteristics of pancreatic cancer cells. Knockout of CAMK2A can significantly inhibit cell growth and promote the invasive characteristics of pancreatic cancer cells. A: Transwell migration and matrix invasion assays after Mia-CaPa cells were transfected with sh-NC, sh-CAMK2A, and sh-DOCK4. The images show cells invading the cell membrane in each group. B: Scratch assay of Mia-PaCa cells after shRNA transfection. C: Viability assay of Mia-PaCa cells after shRNA transfection. D: The number of colonies formed in each group of Mia-PaCa cells after shRNA transfection. E, F: shCAMK2A and shDOCK4 inhibited tumor growth of Mia-PaCa cell xenografts in nude mice. The tumor volume was measured and plotted as the mean ± SEM (n = 6 animals per group). t-test *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. DETAILED DESCRIPTION

[0023] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in each embodiment of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0024] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0025] In the following embodiments, the collection of clinical tissue samples is as follows:

[0026] Five pairs of PDAC primary and adjacent tissues were obtained from Shanghai Aotuduo Biotechnology Co., Ltd. (Table 1), and the clinical pathological data of the samples are shown in Table 1. The FFPE tissues of the above PDAC patients were verified by FISH (Table 2), and the clinical pathological information is shown in Table 2. The above clinical samples were pathologically confirmed to be PDAC and approved by the Ethics Committee (YBM-05002). According to the Declaration of Helsinki, all patients agreed to use and publish clinical information for research purposes.

[0027] Table 1 Clinical pathological data of primary and adjacent tissues of PDAC

[0028]

[0029] Table 2 Clinical pathological information of FFPE tissues verified by FISH

[0030]

[0031]

[0032]

[0033]

[0034] Example 1: Analysis of whole genome eccDNA using Circle-seq in paired PDAC samples

[0035] (1) Experimental method: Circle-Sequencing analysis

[0036] Circle-Sequencing was used to detect eccDNA in paired primary tissues of PDAC patients (Table 1 samples), and sequencing analysis was provided by CloudSeq Biotech Inc. (Shanghai, China). The analysis process was based on the previously reported Circle-Seq method (PLCG2 can exist in eccDNA and contribute to the metastasis of non-small cell lung cancer by regulating mitochondrial respiration. Cell Death Dis. 2023.14 (257).

[0037] (2) Experimental results:

[0038] To detect eccDNA in paired PDAC primary and paracancerous tissues, circle-sequencing assays were performed on PDAC tissues (Table 1). Total circular DNA was separated by column chromatography, and the separated samples were treated with endonucleases and restriction exonucleases to remove mitochondrial circular DNA and residual linear chromosomal DNA, and then The purified eccDNA was amplified by DNA polymerase rolling circle, and the amplified products were finally located to the reference genome (UCSC hg19) for analysis by high-throughput sequencing. The results showed that there was abundant eccDNA expression in PDAC tissues, and the eccDNA characteristics of PDAC were characterized from the following aspects: expression frequency, length distribution, GC content, and genomic distribution. First, by comparing the human genome (UCSC hg19), 112,648 eccDNAs and 56,508 eccDNA amplified genes were identified in PDAC paracancerous tissue samples (control), and 414,723 eccDNAs and 210,494 eccDNA amplified genes were identified in PDAC samples (sample Test). Figure 1 A). Size distribution analysis showed that eccDNA smaller than 1000 bp was the dominant subtype in PDAC tissues (85.5% in cancer tissues and 92.35% in paracancerous tissues) ( Figure 1 B). Genomic distribution analysis showed that eccDNA originated from all 23 pairs of chromosomes, except for the Y chromosome, which had a lower frequency of eccDNA per Mb ( Figure 1 C, D), the frequency of cDNA per Mb in other chromosomes varies ( Figure 1 C, D). Secondly, it was also found that among different chromosomes, the frequency of gene-rich chromosomes and eccDNA formation in cancer tissue samples was significantly higher than that in the control group ( Figure 1 E). In addition, cancer tissue ( Figure 1 The GC content in the eccDNA sequence of F) was higher than that in the control group ( Figure 1 G) is more enriched. This indicates that GC-rich content is a characteristic of eccDNA, which is consistent with the literature (Yixuan C, Yifeng F, Yan R, Shiyuan H, Weiguo L, et al. Global characterization of extrachromosomal circular DNAs in advanced high grade serous ovarian cancer. Cell Death Dis. 2022.13(4):342.). In addition, by locating eccDNA to different genomic elements ( Figure 1 H) and repetitive elements ( Figure 1 I) to explore the possible origin of eccDNA. The results showed that eccDNA was enriched in the 5'UTR region, 3'UTR region and exons, indicating that in PDAC tissues, these regions preferentially produce eccDNA than gene-rich regions.

[0039] Example 2: Cross-analysis of Circle-seq data and transcriptomics data

[0040] (1) Experimental method: RNA-Seq analysis

[0041] Total RNA was extracted from paired primary tissues of 5 pairs of PDAC patients (Table 1 samples), and subsequent library preparation and RNA sequencing were performed by CloudSeq Biotech Inc. (Shanghai, China) on an Illumina HiSeq 4000 sequencer. After that, high-quality clean reads were aligned to the reference genome (UCSC hg19) using hisat2 software (v2.0.4), and the fold change and P value were calculated based on the gene-level FPKM obtained by cuffdiff software to identify differentially expressed mRNAs. Finally, GO and Pathway enrichment analysis were performed based on the filtered differentially expressed mRNAs. The specific analysis methods were referred to the literature (Yixuan C, Yifeng F, Yan R, Shiyuan H, Weiguo L, et al. Global characterization of extrachromosomal circular DNAs in advanced high grade serous ovarian cancer. Cell Death Dis. 2022.13(4):342.).

[0042] (2) Experimental results:

[0043] The enrichment analysis of significantly highly expressed eccDNA-related genes revealed that the top 10 enriched pathways were shown in Figure 2 In A, including the Rap1 pathway, the molecular functions of related genes are mainly related to protein binding ( Figure 2 B). The same 4 pairs of pancreatic cancer PDAC samples were further used for transcriptome RNA sequencing analysis and circRNA sequencing analysis to identify differentially expressed genes (DEGs) between the same PDAC tumors. The results showed that 1310 differentially expressed genes (DEGs) were identified in cancer tissues compared with adjacent cancer tissues, of which 850 genes were upregulated and 460 genes were downregulated (|FC (fold change)| ≥ 2 or < 2, P < 0.05) ( Figure 2 C, D). In addition, the Circle-Seq data were jointly analyzed with the RNA-seq results, and 10 genes (P<0.05 between the two sequencing results) were found to overlap ( Figure 2E). Then, based on the tumor-related functions predicted by bioinformatics analysis and the expression level of eccDNA, 9 eccDNAs were selected as candidates for subsequent verification and in-depth research. These eccDNAs were named according to their gene origin: CUX1 circlechr7:101795357-101795523 , PLK2 circlechr5:57721715-66250917 ,DOCK4 circlechr7:111508481-111509072 ,WISP1 circlechr8:134225624-134225958 ,CAMK2A circlechr5:149613485-149613861 ,PAK7 circlechr20:9746674-9747222 ,COL22A1 circlechr8:134583175-140951183 ,PRR15 circlechr7:28096611-37875317 ,IGFBP3 circlechr7:43255413-46402721 ( Figure 2 F).

[0044] Example 3: PCR and first-generation sequencing verification of eccDNA

[0045] (1) Experimental methods:

[0046] 1) Materials:

[0047] qPCR SYBR Green master mix (GenSeq); clean bench (Shanghai Boxun Industrial Co., Ltd. Medical Equipment Factory); primer design software: Primer 5.0; QuantStudio 5 Real-Time PCR System (ThermoFisher).

[0048] 2) Methods:

[0049] ① DNA was extracted from 5 pairs of PDAC primary and adjacent tissues, and all DNA samples were configured with Realtime PCR reaction system. The system configuration is as follows:

[0050] 2×Master Mix 5 μL; 10 μM PCR specific primer F (Table 3) 0.5 μL; 10 μM PCR specific primer R 0.5 μL, add water to a total volume of 8 μL, gently tap the bottom of the tube to mix the solution, and briefly centrifuge at 5000 rpm.

[0051] ②Add sample:

[0052] a. Add 8 μL of the mixture to each corresponding well of the 384-PCR plate;

[0053] b. Add the corresponding 2 μlL DNA;

[0054] c. Carefully stick the Sealing Film on the tube and centrifuge briefly to mix;

[0055] d. Place the prepared PCR plate on ice before setting up the PCR program.

[0056] ③ Place the above 384-PCR plate on a Realtime PCR instrument to perform PCR reaction.

[0057] All indicators are carried out according to the following procedures:

[0058] 95°C, 10 min; 40 PCR cycles (95°C, 10 sec; 60°C, 60 sec (collecting fluorescence)).

[0059] In order to establish the melting curve of the PCR product, after the amplification reaction, the reaction was performed in sequence: 95°C for 10 seconds; 60°C for 60 seconds; 95°C for 15 seconds; and then slowly heated from 60°C to 99°C (automatically performed by the instrument - Ramp Rate is 0.05°C / second).

[0060] Table 3: PCR-specific primers for 9 candidate eccDNAs

[0061]

[0062] Note: The primer sequences correspond to SEQ ID NO: 1-20 in the nucleotide sequence table.

[0063] (2) Experimental results:

[0064] In order to verify the above 9 candidate eccDNAs, PCR detection was performed using specific primers for each candidate connection site, and all amplified products were separated on electrophoresis gel. Figure 3 As shown in the figure, the marker is 2000bp DNA Ladder (Dye Plus), band 1 is the enriched eccDNA inward / outward, band 2 is the genomic DNA inward / outward, band 3 is the NTC inward / outward, and band 4 is the eccDNA inward / outward after rolling circle amplification. The results show that the PCR band of eccDNA is in the same position as the PCR band after rolling circle amplification, indicating that the candidate eccDNAs are all circular eccDNAs ( Figure 3 ). In order to further verify whether the gene eccDNA circular connection site matches, Sanger sequencing was used to confirm the detected eccDNA connection site. The results showed that the target circularity was found to have a splicing site and the sequence was consistent with the expectation after Sanger sequencing: including DOCK4 circlechr7:111508481-111509072 ,WISP1 circlechr8:134225624-134225958 and CAMK2A circlechr5:149613485-149613861 ( Figure 4). The Sanger sequencing results of the remaining candidate sequences did not match the corresponding junction sites, indicating that they were not true circular DNA.

[0065] Example 4: CAMK2A circlechr5:149613485-149613861 and DOCK4 circlechr7:111508481-111509072 High expression is associated with poor prognosis in pancreatic cancer patients

[0066] (1) Experimental method: fluorescence in situ hybridization (FISH) assay

[0067] FISH detection was performed in FFPE tissues of PDAC patients (the tissue chip was purchased from Shanghai Xinchao Company, chip number: HPanA170Su04) (Table 2 samples). Cy3-labeled probe specific for CAMK2A circle149613485-149613861 ,DOCK4 circlechr7:111508481-111509072 and WISP1 circlechr8:134225624-134225958 The probes were designed, tested and scanned at Savier (Wuhan, China). The probe sequences are as follows:

[0068] CAMK2A target gene sequence (SEQ ID NO: 21):

[0069]

[0070] (The gray mark is the cleavage site).

[0071] DOCK4 target gene sequence (SEQ ID NO: 22):

[0072]

[0073] (The gray mark is the cleavage site).

[0074] WISP1 target gene sequence (SEQ ID NO: 23):

[0075]

[0076] (The gray mark is the cleavage site).

[0077] (2) Experimental results:

[0078] Multiple immunofluorescence detection of three eccDNAs was performed using cancer tissues and paired adjacent tissues from FFPE tissue array chips of 171 PDAC pancreatic cancer patients (Table 2). After the expression levels were converted according to the fluorescence signals of eccDNA, the expression of different eccDNAs (camk2a and dock4, WISP) in all samples was divided into low or high expression groups. The results showed that the expression of DOCK4 and CAMK2A in pancreatic cancer tissues was significantly higher than that in adjacent tissues, but there was no difference in the expression of WISP1 between the two groups. Further Kaplan-Meier survival analysis showed that high expression of DOCK4 and CAMK2A in primary pancreatic cancer tumors was significantly associated with shorter survival ( Figure 5 , P<0.001). The above research results show that CAMK2A circlechr5:149613485-149613861 and DOCK4 circlechr7:111508481-111509072 The increase of TNF-α is a key factor for the poor prognosis of pancreatic cancer patients.

[0079] Example 5: Inhibition of DOCK4 and CAMK2A expression can reduce the malignant behavior of pancreatic cancer cells and reduce tumor volume (1) Experimental method:

[0080] 1) The expression vectors of shCAMK2A, shDOCK4 and sh-NC (control) were constructed (Guangzhou Dahong Biotechnology Co., Ltd.). The specific sequences of the knockdown sites of shCAMK2A and shDOCK4 are as follows:

[0081] sequence name sequence HY241246-5DOCK4-sh3(SEQ ID NO:24) GCTTGTCTCCTGTCCCTATTA HY241246-8CAMK2A-sh3(SEQ ID NO:25) GCAGCTGATTGAAGCCATAAG

[0082] 2) Cell culture and transfection of shRNADOCK4 and shRNACAMK2A

[0083] The pancreatic cell line MIA-PaCa-2 was obtained from ATCC (Manassas, VA, USA). MIA-PaCa-2 cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco, Carlsbad, CA, United States) supplemented with 10% fetal bovine serum (FBS, Gibco, Carlsbad, CA, United States) at 37°C and 5% CO2. shRNA DOCK4 (HY241246-5DOCK4-sh3) and shCAMK2A (HY241246-8CAMK2A-sh3) were designed and synthesized by Guangzhou Dahong Biotechnology Co., Ltd., and shRNA was transfected into MIA-PaCa-2 cells using lipofectamine 3000 reagent (ThermoFisher, USA) according to the manufacturer's protocol, and the transfection efficiency was detected by WB.

[0084] 3) Cell proliferation, colony formation assay, Transwell and scratch assay:

[0085] Cell proliferation assay: The proliferation capacity of MIA-CaPa-2 cells transfected with shDOCK4 and shCAMK2A was determined using a cell counting kit-8 (CCK-8). 10 mL of CCK-8 reagent was added directly to each well of a 96-well plate in which DOCK4 and CAMK2A cells were knocked out at the specified time (1, 2, 3, 4, and 5 d), and then incubated at 37 ° C for 1.5 h. Finally, the selectable density (OD) was measured at 450 nm using a microplate reader (BioTek Instruments, USA). For colony formation experiments: Freshly isolated cells were cultured in matrix-coated 6-well culture dishes at clonal density (1000 cells per well) for 14 days, after which they were fixed, stained, and counted. Meanwhile, a 24-well migration chamber (pore size 8 mm, Corning, USA) was used for migration assay: the knockout cells were resuspended in 200 mL serum-free DMEM and implanted in the inner chamber, 500 mL DMEM medium containing 20% ​​FBS was added to the bottom chamber as an attractant, and after incubation for 24 hours, the cells that did not pass through the membrane were gently removed with cotton balls, and the cells that passed through the membrane were fixed with 4% paraformaldehyde and stained with crystal violet for 15 minutes, and finally the number of migrated cells was counted by Image J software. In addition, the migration ability of cells after shRNA transfection was detected by scratch test: the transfected cells were spread on 6-well plates and cultured to 90% confluence, and the monolayer of each well was scratched with a 200 mL micropipette needle, and the detached cell debris was washed away with phosphate buffered saline (PBS), and then the cells were cultured in serum-free DMEM medium, and finally the horizontal distance of the migrating cells was photographed with a microscope for 24 hours and measured with Image J software.

[0086] 4) Subcutaneous tumor formation in nude mice: 18 female BALB / c nude mice, 4 weeks old, were divided into three groups, with 6 mice in each group. Mia-PaCa cells transfected with sh-NC, DOCK4-sh3, and CAMK2A-sh3 were placed at 5×10 6 / mouse or PBS (control) and matrix gel at a volume ratio of 1:1 were injected subcutaneously into nude mice, 100uL / mouse, and the mice were fed for 14 days. The tumor volume was measured every 3 days during this period.

[0087] (2) Experimental results:

[0088] To further explore the role of DOCK4 and CAMK2A in the proliferation, invasion, and migration of pancreatic cancer cells, the effects of knockdown of DOCK4 and CAMK2A on pancreatic cancer cells were examined. Figure 6 As shown, migration / invasion assay ( Figure 6 A) and scratch test ( Figure 6B) showed that compared with the sh-NC group, knockdown of DOCK4 and CAMK2A alone significantly inhibited the migration and invasion of pancreatic cancer cells. Figure 6 C) and colony formation ( Figure 6 D) Experimental detection found that DOCK4 and CAMK2A had a significant inhibitory effect on the proliferation of pancreatic cancer cells. In order to confirm the role of DOCK4 and CAMK2A in vivo, a mouse subcutaneous human pancreatic cancer tumor model was further established. The results of mouse tumor tissue analysis showed that the tumor size of the shCAMK2A and shDOCK4 groups was significantly reduced compared with the shNC group ( Figure 6 E, F). In addition, the effect of inhibiting CAMK2A expression is more significant than that of inhibiting DOCK4. It can be seen that inhibiting CAMK2A expression can significantly reduce the migration and growth of pancreatic cancer cells, thereby significantly reducing the volume of pancreatic cancer tumor tissue.

[0089] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions and variations of these embodiments are made without departing from the principles and spirit of the present invention, and still fall within the protection scope of the present invention.

Claims

1. Use of an agent that inhibits or reduces CAMK2A expression in the preparation of a drug for treating pancreatic cancer.

2. Use of agents that inhibit or reduce CAMK2A expression in the preparation of drugs for reducing the proliferation and migration of pancreatic cancer cells.

3. The use according to claim 1 or 2, characterized in that: The pancreatic cancer is pancreatic ductal adenocarcinoma.

4. The use according to claim 1 or 2, characterized in that: The reagent for inhibiting or reducing CAMK2A expression is sgRNA, and its nucleotide sequence is shown in SEQ ID NO:

25.

5. A drug for treating pancreatic cancer, characterized in that: The drug has an agent that inhibits or reduces CAMK2A expression as a main active ingredient.

6. A drug for treating pancreatic cancer according to claim 5, characterized in that: The drug also includes pharmaceutically acceptable excipients.

7. The drug for treating pancreatic cancer according to claim 5, characterized in that: The dosage forms of the medicine include injection, powder, granule, capsule and tablet.

8. The drug for treating pancreatic cancer according to claim 5, characterized in that: The administration methods of the drug include injection and oral administration.

Images