Reagent and method for detecting low-frequency pancreatic cancer KRAS G12D gene mutation based on Cas12a-Cas13a combined reaction system
Through the Cas12a-Cas13a combined reaction system, the nucleic acid cleavage activity and strand migration reaction of Cas12a and Cas13a is used to design a specific identification and cleavage DNA/RNA probe, which solves the complexity and high cost of detecting mutations in the medium and low frequency KRAS G12D genes in the prior art, and achieves a high sensitivity and low cost detection effect.
Patent Information
- Application Number
- CN202510196555.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-21
- Publication Date
- 2025-07-04
AI Technical Summary
The prior art cannot effectively and at low cost to detect low-frequency KRAS G12D gene mutations, especially in malignant tumors such as pancreatic cancer. Commonly used detection methods have problems such as complex operation, expensive equipment, low sensitivity or high cost.
Single-strand substrate DNA was prepared by asymmetric PCR using Cas12a-Cas13a combined reaction system, and the nucleic acid cleavage activity and strand migration reaction of Cas12a and Cas13a were used to design specific identification and cleavage DNA/RNA probes to achieve signal amplification, simplify operation and reduce costs.
It realizes high sensitivity and low cost detection of KRAS G12D mutations, can identify extremely low frequency mutations, has the advantages of simple operation and low equipment requirements, and is suitable for clinical applications.
Smart Images

Figure CN120249484A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of gene mutation detection, and particularly relates to a reagent and method for detecting low-frequency pancreatic cancer KRAS G12D gene mutation based on a Cas12a-Cas13a combined reaction system. Background Art
[0002] The KRAS gene (Kirsten rat sarcoma viral oncogene homolog) is a gene that plays a key role in multiple cell signaling pathways. The K-Ras protein encoded by this gene is a small GTPase, which plays an important role in processes such as cell proliferation, differentiation, survival, and migration. The KRAS G12D mutation is one of the most common mutations in the KRAS gene, mainly involving the substitution of glycine at the 12th position by aspartic acid. This mutation causes the loss of GTPase activity of the K-Ras protein, resulting in the continuous activation of the K-Ras protein, which in turn promotes abnormal cell proliferation and tumorigenesis. The KRAS G12D mutation has an important pathogenic role in various types of cancers, especially dominant in common malignant tumors such as pancreatic cancer, colorectal cancer, and non-small cell lung cancer. In pancreatic cancer, approximately 90% of patients have KRAS gene mutations, among which the KRAS G12D mutation is the most common.
[0003] Currently, the commonly used methods for detecting KRAS G12D gene mutations mainly include sequencing, amplification techniques mainly based on PCR such as ARMS-PCR, liquid biopsy techniques (ctDNA detection), and gene chip techniques. Sequencing has high accuracy, but has problems such as complex operation, expensive equipment, long detection cycle, and the need for professional training of personnel. ARMS-PCR has a short detection cycle, but low sensitivity and is not suitable for the detection of low-frequency mutations. Liquid biopsy techniques (ctDNA detection) are more convenient, but their detection sensitivity is limited by the scarcity of ctDNA, and there is also the problem that background noise in blood samples affects the accuracy of the results. Gene chip techniques can simultaneously detect multiple mutation sites in the KRAS G12D gene, with the advantage of high throughput, but gene chips are costly and require complex equipment support, making it difficult to popularize in routine clinical applications.
[0004] CN118745468A discloses a method for detecting low-frequency gene mutations based on the CRISPR / Cas system, with a detection sensitivity of 0.01%, which is superior to most gene mutation detection techniques, but still cannot meet the detection of some low-frequency gene mutations.
[0005] In summary, there is a need for a detection method that is simple to operate, low-cost, and can detect low-frequency KRAS G12D gene mutations. Summary of the Invention
[0006] The object of the present invention is to provide a reagent and method for detecting low-frequency pancreatic cancer KRAS G12D gene mutations based on a Cas12a-Cas13a combined reaction system. By jointly utilizing the nucleic acid cleavage activities of Cas12a and Cas13a to achieve multiple signal amplifications, a simple and low-cost low-frequency detection of KRAS G12D mutations can be realized, so as to solve or at least partially solve the problem that the prior art cannot combine simplicity of operation, low cost and detection of low-frequency gene mutations.
[0007] To achieve the above object, the present application adopts the following technical solutions:
[0008] In the first aspect, the present invention provides a reagent for detecting low-frequency pancreatic cancer KRAS G12D gene mutations based on a Cas12a-Cas13a combined reaction system. The reagent includes single-stranded substrate DNA, tRNA, 12CrRNA, 13CrRNA, 12Reporter, and 13Reporter;
[0009] The single-stranded substrate DNA is derived from the genomic DNA of the sample to be tested. After extracting the genomic DNA of the sample to be tested, asymmetric PCR is performed on the genomic DNA of the sample to be tested using PCR primer pairs, that is, the single-stranded substrate DNA is amplified. The single-stranded substrate DNA contains wild-type WT and mutant MT;
[0010] The mutant MT is completely matched with the recognition region of the 12CrRNA and has a one-base mismatch with the recognition region of the 13CrRNA;
[0011] The wild-type WT has a one-base mismatch with the recognition region of the 12CrRNA and is completely matched with the recognition region of the 13CrRNA;
[0012] The tRNA is a pre-synthesized single-stranded RNA, which has a one-base mismatch with the recognition region of the 12CrRNA and is completely matched with the recognition region of the 13CrRNA;
[0013] The 12Reporter is a DNA probe of FAM and BHQ double-labeled genes, and the 13Reporter is an RNA probe of FAM and BHQ double-labeled genes.
[0014] In the above technical solution, the PCR primer pair includes a forward primer and a reverse primer. The nucleic acid sequence of the forward primer is as shown in SEQ ID NO.1, which is TACCACAAGTTTATAT, and the nucleic acid sequence of the reverse primer is as shown in SEQ ID NO.2, which is TCAAGGCACTCTTGC;
[0015] The nucleic acid sequence of the mutant MT is shown in SEQ ID NO.3, which is AAACTTGTGGTAGTTGGAGCTGATGGCGT, and the nucleic acid sequence of the wild type WT is shown in SEQ ID NO.4, which is AAACTTGTGGTAGTTGGAGCTGGTGGCGT;
[0016] The nucleic acid sequence of the tRNA is shown in SEQ ID NO.5, which is AUAAACUUGUGGUA GUUGGAGCUGCUGG;
[0017] The nucleic acid sequence of the 12crRNA is shown in SEQ ID NO.6, which is UAAUUUCUACUAAGUGUAGAUACGCCATCAGCUCCAACUACCA, and the nucleic acid sequence of the 13crRNA is shown in SEQ ID NO.7, which is GAUUUAGACUACCCCAAAAACGAAGGGGACUAA AACCACCAGCUCCAACUACCACAAGUUUAUA;
[0018] The nucleic acid sequence of the 12Reporter is shown in SEQ ID NO.8, which is FAM-TTTTTTTTTT T-BHQ, and the nucleic acid sequence of the 13Reporter is FAM-UUUUUU-BHQ.
[0019] In the above technical solution, during asymmetric PCR, the volume ratio of the forward primer to the reverse primer is 10:1. The PCR reaction program is divided into three steps, namely: 1 cycle (95°C for 3 min), 40 cycles (95°C for 5 s, 55°C for 10 s, 72°C for 10 s), and 1 cycle (72°C for 5 min).
[0020] In a second aspect, the present invention provides a kit for detecting the KRAS G12D gene mutation in low-frequency pancreatic cancer, characterized in that: the kit includes the above reagents.
[0021] In the above technical solution, the kit further includes any one or a combination of at least two of PCR amplification reagents, restriction enzyme reaction reagents, or Cas enzyme reaction reagents.
[0022] In a third aspect, the present invention provides a method for detecting the KRAS G12D gene mutation in low-frequency pancreatic cancer based on a Cas12a-Cas13a combined reaction system for non-disease diagnosis and / or treatment purposes, and the method is carried out using the above reagents.
[0023] In the above technical solution, the method includes the following steps:
[0024] S1. After extracting the genomic DNA of the sample to be tested, prepare the single-stranded substrate DNA by asymmetric PCR, and simultaneously prepare the tRNA, 12CrRNA, and 13CrRNA.
[0025] S2. The mutant MT and wild-type WT are first mixed with the added 13CrRNA, and after heating and annealing, two pairs of DNA-RNA hybrid double strands, MT-13crRNA and WT-13crRNA, are formed respectively. The tRNA is mixed with the 12CrRNA, and after heating and annealing, a tRNA-12crRNA hybrid double strand is formed.
[0026] S3. The tRNA-12crRNA is then added to the system, mixed with the MT-13crRNA and the WT-13crRNA, and incubated at 37°C for half an hour for strand displacement reaction.
[0027] S4. Cas12a and Cas13a are added to the system. The complexes of Cas12a and Cas13a with their respective corresponding crRNAs bind and are incubated at 37°C.
[0028] S5. The 12Reporter and the 13Reporter are added to the system to form a reaction system to be detected, and the fluorescence reaction intensity is recorded at 37°C to determine whether there is a low-frequency pancreatic cancer KRAS G12D gene mutation in the sample to be tested.
[0029] In the above technical solution, in S2, the heating and annealing procedure is to stepwise cool from 90°C to 20°C, with a decrease of 0.5°C every 30 seconds, and the temperature maintenance time for each gradient is 30 seconds.
[0030] The beneficial effects of the present invention are as follows: The Cas12a-Cas13a combined detection system innovatively utilizes the high cleavage activity of Cas12a and Cas13a and the thermodynamic strictness of the strand displacement reaction to ensure the sensitivity and specificity of the system, provides a new discrimination mechanism for the identification of single nucleotide polymorphisms, and realizes the simple operation and low-cost low-frequency detection of the KRAS G12D mutation. Description of the Drawings
[0031] Figure 1 It is a schematic diagram of the Cas12a-Cas13a combined detection system.
[0032] Figure 2 It is a reaction fluorescence curve diagram of activating Cas12a after annealing of MT, WT, and tRNA.
[0033] Figure 3 It is a reaction fluorescence curve diagram of activating Cas13a after annealing of tRNA with MT and WT.
[0034] Figure 4 Reaction fluorescence curve graph activated by the combination of Cas12a and Cas13a.
[0035] Figure 5 Reaction fluorescence curve graph of the Cas12a-Cas13a combined detection system for detecting substrates with mutation frequencies ranging from 100% to 0.1%.
[0036] Figure 6 Reaction fluorescence curve graph of the Cas12a-Cas13a combined detection system for detecting substrates with mutation frequencies ranging from 0.1% to 0%. Detailed implementation manners
[0037] To better illustrate the purpose, technical solution and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. The present invention can be implemented in many different forms and should not be construed as limited to the embodiments set forth herein. On the contrary, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the concept of the present invention to those skilled in the art. The present invention will be defined only by the claims.
[0038] The present invention provides a reagent for detecting low-frequency pancreatic cancer KRAS G12D gene mutation in a Cas12a-Cas13a combined reaction system, including single-stranded substrate DNA, tRNA, 12CrRNA, 13CrRNA, 12Reporter and 13Reporter.
[0039] The single-stranded substrate DNA is derived from genomic DNA in actual clinical samples. The genomic DNA in the sample is extracted using a commercial DNA extraction kit, and the genomic DNA is subjected to asymmetric PCR using a preset pair of PCR primers (forward primer SEQ ID NO.1 and reverse primer SEQ ID NO.2) in a volume ratio of forward primer to reverse primer of 10:1 to amplify the single-stranded substrate DNA.
[0040] The PCR reaction program is divided into three steps, namely: 1 cycle (95°C for 3 min), 40 cycles (95°C for 5 s, 55°C for 10 s, 72°C for 10 s), 1 cycle (72°C for 5 min).
[0041] The single-stranded substrate DNA contains wild-type WT and mutant MT.
[0042] The recognition region of MT is completely matched with 12CrRNA and has a base mismatch with the recognition region of 13CrRNA.
[0043] The recognition region of WT has a base mismatch with 12CrRNA and is completely matched with the recognition region of 13CrRNA.
[0044] tRNA is a pre-synthesized single-stranded RNA, which has a base mismatch with the recognition region of 12CrRNA and is completely matched with the recognition region of 13CrRNA, playing a key role in the subsequent detection system.
[0045] 12Reporter is a DNA probe of FAM and BHQ double-labeled genes and is used for the trans-cleavage of Cas12a enzyme.
[0046] 13Reporter is an RNA probe of FAM and BHQ double-labeled genes and is used for the trans-cleavage of Cas13a enzyme.
[0047] The present invention also provides a method for detecting the KRAS G12D gene mutation of low-frequency pancreatic cancer based on the Cas12a-Cas13a combined reaction system, comprising the following steps:
[0048] S1. After extracting the genomic DNA of the sample to be tested, single-stranded substrate DNA is prepared by asymmetric PCR, and at the same time, tRNA, 12CrRNA and 13CrRNA are prepared.
[0049] Further, the single-stranded substrate DNA contains wild-type WT and mutant MT. The preparation method of the single-stranded substrate DNA is: asymmetric PCR is performed on the genomic DNA with the volume ratio of the forward primer (SEQ ID NO.1) to the reverse primer (SEQ ID NO.2) being 10:1. The specific steps are that the PCR reaction program is divided into three steps, namely: 1 cycle (95°C for 3 min), 40 cycles (95°C for 5 s, 55°C for 10 s, 72°C for 10 s), and 1 cycle (72°C for 5 min).
[0050] tRNA, 12CrRNA and 13CrRNA are synthesized by a biological company. The characteristics of tRNA, 12CrRNA and 13CrRNA are: MT is completely matched with the recognition region of 12CrRNA and has a base mismatch with the recognition region of 13CrRNA. WT has a base mismatch with the recognition region of 12CrRNA and is completely matched with the recognition region of 13CrRNA. tRNA is a single-stranded RNA, which has a base mismatch with the recognition region of 12CrRNA and is completely matched with the recognition region of 13CrRNA, playing a key role in the subsequent detection system.
[0051] S2. MT and WT are first mixed with the added 13CrRNA, and after heating and annealing, two pairs of DNA-RNA hybrid double strands, MT-13crRNA and WT-13crRNA, are respectively formed. tRNA is mixed with 12CrRNA, and after heating and annealing, a tRNA-12crRNA hybrid double strand is formed.
[0052] Further, the temperature-raising annealing procedure is to stepwise cool down from 90 °C to 20 °C, with a decrease of 0.5 °C every 30 seconds, and the temperature maintenance time for each gradient is 30 seconds.
[0053] S3. Subsequently, TRNA-12crRNA is added to the system, mixed with MT-13crRNA and WT-13crRNA, and incubated at 37 °C for half an hour for strand migration reaction.
[0054] S4. Cas12a and Cas13a are added to the system. The complexes of Cas12a and Cas13a with their respective corresponding crRNAs bind, and are incubated at 37 °C for half an hour.
[0055] Further, Cas12a and Cas13a are purified proteins prepared by a biological company and can be directly used in experiments. Cas12a recognizes the target single-stranded DNA by binding to the target recognition region of 12CrRNA, activates its trans-cleavage activity, and cleaves any single-stranded DNA. Cas13a recognizes the target single-stranded RNA by binding to the target recognition region of 13CrRNA, activates its trans-cleavage activity, and cleaves any single-stranded RNA.
[0056] S5. 12Reporter and 13Reporter are added to the system to form a reaction system to be detected. The fluorescence reaction intensity is recorded at 37 °C to determine whether there is a low-frequency pancreatic cancer KRAS G12D gene mutation.
[0057] Further, 12Reporter is a DNA probe with dual labels of FAM and BHQ genes and is used for the trans-cleavage of Cas12a enzyme. 13Reporter is an RNA probe with dual labels of FAM and BHQ genes and is used for the trans-cleavage of Cas13a enzyme.
[0058] The specific judgment method is as follows: Differential statistical analysis is performed according to the rate of fluorescence signal generation in the presence or absence of single-stranded substrate DNA. A P value < 0.05 is significant, indicating the presence of a single-base mismatch, that is, there is a gene mutation in the sample to be detected.
[0059] As Figure 1 shown, there are three single-stranded DNAs in the reaction system: MT, WT, and 12Reporter. MT and WT are the mutant type and wild type DNAs to be distinguished respectively, and 12Reporter is a single-stranded DNA modified by FAM and BHQ at the 5'-end (the end shown in the figure) and 3'-end (the arrow end shown in the figure) respectively.
[0060] There are four single-stranded RNAs in the reaction system, namely 12crRNA, 13crRNA, tRNA, and 13Reporter. Among them, 12crRNA and 13crRNA are the guide RNAs (crRNAs) corresponding to Cas12a and Cas13a respectively, tRNA is the target single-stranded RNA of 13crRNA, and 13Reporter is a single-stranded RNA modified with FAM and BHQ at the 5' end and 3' end respectively.
[0061] MT and WT are first mixed with the added 13crRNA, and after heating and annealing, two pairs of DNA-RNA hybrid double-strands, MT-13crRNA and WT-13crRNA, are formed respectively. Among them, there is a base mismatch (A pairs with C) between MT and 13crRNA, while there is no mismatch (G pairs with C) between WT and 13crRNA, which lays the foundation for the subsequent four-strand migration reaction.
[0062] tRNA-12crRNA is then added to the system and mixed with MT-13crRNA and WT-13crRNA for strand migration reaction. For MT-13crRNA and tRNA-12crRNA, each of them has a pair of base mismatches (A pairs with C, G pairs with T) by itself, while the resulting tRNA-13crRNA and MT-12crRNA after the strand migration reaction do not have mismatches; for WT-13crRNA and tRNA-12crRNA, there is only one pair of mismatches (G pairs with T) in tRNA-12crRNA, and the resulting tRNA-13crRNA and WT-12crRNA after the possible strand migration reaction also only have one pair of mismatches. For the strand migration reaction, the fewer the base mismatches after the reaction, the smaller the ΔG of the reaction, that is, the more thermodynamically advantageous the reaction is. Therefore, through the designed strand migration reaction, the system first makes a distinction between MT and WT thermodynamically to serve as the basis for the high-specificity recognition of the system. Next, by adjusting the lengths of the overhang regions at the 5' end and 3' end of the strand migration regions of 12crRNA, 13crRNA, and tRNA in the design, the strand migration reaction of the MT group is regulated to ΔG < 0, making the reaction easy to proceed forward; at the same time, the strand migration reaction of the WT group is regulated to ΔG > 0, making the reaction difficult to proceed forward. After the strand migration reaction, MT-13crRNA and tRNA-12crRNA are converted into tRNA-13crRNA and MT-12crRNA. WT-13crRNA and tRNA-12crRNA do not undergo strand migration and still exist in the system.
[0063] In the next step of the operation, Cas12a, Cas13a, 12Reporter, and 13Reporter are added to the system. The complexes of Cas12a and Cas13a with their respective corresponding crRNAs bind and perform recognition and cleavage. The biological functions of Cas12a / 13a are as follows: After binding to the crRNA corresponding to this type of enzyme and the DNA or RNA matched by this crRNA, the cis-cleavage activity is activated, the recognized DNA or RNA is cleaved, and at the same time, the trans-cleavage activity is also activated, and single-stranded DNA or single-stranded RNA in the system is non-specifically cleaved.
[0064] For the reaction system where WT is located, after Cas12a binds to tRNA-12crRNA, it is not activated because Cas12a specifically cleaves DNA; after Cas13a binds to WT-13crRNA, it is also not activated because Cas13a specifically cleaves DNA. In addition, since the cleavage activity of the Cas protein is inhibited by mismatches on the recognition sequence, even if a very small amount of WT-12crRNA is generated in the system, it is difficult to be activated due to the existence of mismatches. This mechanism is utilized here to play the function of secondary recognition, further improving the specificity.
[0065] For the reaction system where MT is located, after Cas12a binds to MT-12crRNA, the cis-cleavage and trans-cleavage activities are activated, cleaving MT and 12Reporter; after Cas13a binds to tRNA-13crRNA, the cis-cleavage and trans-cleavage activities are activated, cleaving tRNA and 13Reporter.
[0066] When 12Reporter / 13Reporter is not cleaved, the FAM and BHQ groups are very close, and fluorescence resonance energy transfer occurs, and no fluorescence signal is released; when 12Reporter / 13Reporter is cleaved, the distance between the FAM and BHQ groups increases, and fluorescence resonance energy transfer no longer occurs, generating a fluorescence signal. In the signal generation step, the cleavage functions of two enzymes with powerful cleavage activities, Cas12a and Cas13a, are jointly utilized, so this system has theoretically high sensitivity. High specificity and high sensitivity enable the detection method to detect extremely low-frequency mutations. In addition, this scheme is easy to operate, has low requirements for instrument equipment, and the cost of the components used is low. Therefore, this scheme has the advantages of being easy to operate and having low cost.
[0067] The specific DNA and RNA sequence designs used in the following examples are based on the KRAS G12D mutation site, and the specific sequences are as follows (from the 5'-end to the 3'-end):
[0068] Forward primer: TACCACAAGTTTATAT (SEQ ID NO.1)
[0069] Reverse primer: TCAAGGCACTCTTGC (SEQ ID NO.2)
[0070] MT: AAACTTGTGGTAGTTGGAGCTGATGGCGT (SEQ ID NO.3)
[0071] WT: AAACTTGTGGTAGTTGGAGCTGGTGGCGT (SEQ ID NO.4)
[0072] tRNA: AUAAACUUGUGGUAGUUGGAGCUGCUGG (SEQ ID NO.5)
[0073] 12 crRNA: UAAUUUCUACUAAGUGUAGAUACGCCATCAGCUCCAACUA CCA (SEQ ID NO.6)
[0074] 13 crRNA: GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACCACCAGCUCCAACUACCACAAGUUUAUA (SEQ ID NO.7)
[0075] 12 Reporter: FAM-TTTTTTTTTTT-BHQ (SEQ ID NO.8)
[0076] 13 Reporter: FAM-UUUUUU-BHQ
[0077] First, the Cas12a-related subsystem in the Cas12a-Cas13a combined detection system was verified. It was verified that either MT or WT alone could activate Cas12a. After adding tRNA annealing, since WT binds to 12 crRNA less tightly than MT, tRNA played a shielding role for 12 crRNA, and MT + tRNA could still activate Cas12a for enzymatic cleavage, while WT + tRNA was difficult to activate the trans-cleavage activity of Cas12a. The reaction fluorescence curves of MT, WT and tRNA annealing to activate Cas12a are as Figure 2 shown. In the absence of tRNA in the system, the discrimination between the MT and WT groups was very low, and the MT signal was slightly lower than that of WT; while in the presence of tRNA in the system, a significant discrimination was formed between MT + tRNA and WT + tRNA, and the former signal was much higher than the latter, and almost no fluorescence signal was generated in WT + tRNA.
[0078] Furthermore, the function of the Cas13a-related subsystem in the Cas12a-Cas13a combined detection system was verified. It was verified that a single tRNA could successfully activate the collateral cleavage activity of Cas13a to generate a fluorescence signal, and it could still be activated after adding MT annealing, while the experimental group with MT annealing could not normally activate Cas13. The reaction fluorescence curves of the tRNA activating Cas13a after annealing with MT and WT are as Figure 3 shown. The tRNA can normally activate Cas13a to generate a fluorescence signal; MT + tRNA can activate Cas13a to generate a high-intensity fluorescence signal; WT + tRNA is difficult to activate Cas13a, and the signal value is very low. The MT group and the WT group were clearly distinguishable.
[0079] Furthermore, the overall function of the Cas12a-Cas13a combined detection system was verified. When both Cas12a and Cas13a enzymes were present in the system, the experimental results were as Figure 4 shown. As can be seen from the figure, the Cas12a-Cas13a combined detection system can continue to effectively distinguish between MT and WT, and compared with the parts of simply activating Cas12a or separately activating Cas13a in the same group of experiments, the signal intensity of the MT + tRNA group is higher, indicating that Cas12a and Cas13a did indeed activate simultaneously and amplify the signal in the system as expected, significantly increasing the sensitivity and specificity of the system for single-base mutation recognition.
[0080] Furthermore, the lower limit of the lowest mutation frequency detection of this reaction system was verified. First, MT and WT were mixed at ratios of 1:1, 1:9, 1:99, 1:999, 1:1999, 1:9999, 1:19999, and 1:49999 to prepare substrates with mutation frequencies of 50%, 10%, 1%, 0.1%, 0.05%, 0.01%, 0.005%, and 0.002%, respectively. These substrates with different ratios were mixed with the detection system and reacted separately.
[0081] The experimental results were as Figure 5 and Figure 6 shown. It was found that this detection system could still effectively identify substrates with a mutation frequency as low as 0.002%.
[0082] In summary, the present invention combines the nucleic acid cleavage activities of Cas12a and Cas13a to achieve multiple signal amplifications, provides a super-sensitive and highly specific DNA mutation detection technology, realizes the simple operation and low-cost low-frequency detection of KRAS G12D mutations, and has good clinical application potential.
[0083] Obviously, the above embodiments are merely examples given for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all implementation manners here. And the obvious changes or modifications derived therefrom still fall within the protection scope of the present invention.
Claims
1. A reagent for detecting low-frequency pancreatic cancer KRAS G12D gene mutation in a Cas12a-Cas13a combined reaction system, characterized in that: The reagents include single-stranded substrate DNA, tRNA, 12CrRNA, 13CrRNA, 12Reporter, and 13Reporter; The single-stranded substrate DNA is derived from the genomic DNA of the sample to be tested. After extracting the genomic DNA of the sample to be tested, asymmetric PCR is performed on the genomic DNA of the sample to be tested using PCR primer pairs, that is, the single-stranded substrate DNA is amplified. The single-stranded substrate DNA contains wild-type WT and mutant MT; The recognition region of the mutant MT is completely matched with that of the 12CrRNA, and there is one base mismatch with the recognition region of the 13CrRNA; The recognition region of the wild-type WT has one base mismatch with that of the 12CrRNA and is completely matched with the recognition region of the 13CrRNA; The tRNA is a pre-synthesized single-stranded RNA, which has one base mismatch with the recognition region of the 12CrRNA and is completely matched with the recognition region of the 13CrRNA; The 12Reporter is a DNA probe of FAM and BHQ double-labeled genes, and the 13Reporter is an RNA probe of FAM and BHQ double-labeled genes.
2. The reagent according to claim 1, characterized in that: The PCR primer pair includes a forward primer and a reverse primer. The nucleic acid sequence of the forward primer is as shown in SEQ ID NO.1, which is TACCACAA GTTTATAT, and the nucleic acid sequence of the reverse primer is as shown in SEQ ID NO.2, which is TCAAGGC ACTCTTGC; The nucleic acid sequence of the mutant MT is as shown in SEQ ID NO.3, which is AAACTTGTGGTA GTTGGAGCTGATGGCGT, and the nucleic acid sequence of the wild-type WT is as shown in SEQ ID NO.4, which is AAACTTGTGGTAGTTGGAGCTGGTGGCGT; The nucleic acid sequence of the tRNA is as shown in SEQ ID NO.5, which is AUAAACUUGUGGUA GUUGGAGCUGCUGG; The nucleic acid sequence of the 12crRNA is as shown in SEQ ID NO.6, which is UAAUUUCUACUAAGUGUAGAUACGCCATCAGCUCCAACUACCA, and the nucleic acid sequence of the 13crRNA is as shown in SEQ ID NO.7, which is GAUUUAGACUACCCCAAAAACGAAGGGGACUAA AACCACCAGCUCCAACUACCACAAGUUUAUA; The nucleic acid sequence of the 12Reporter is as shown in SEQ ID NO.8, which is FAM-TTTTTTTTTT T-BHQ, and the nucleic acid sequence of the 13Reporter is FAM-UUUUUU-BHQ.
3. The reagent according to claim 1, wherein: In asymmetric PCR, the volume ratio of the forward primer to the reverse primer is 10:
1. The PCR reaction program is divided into three steps, namely: 1 cycle (95°C for 3 min), 40 cycles (95°C for 5 s, 55°C for 10 s, 72°C for 10 s), and 1 cycle (72°C for 5 min).
4. A kit for detecting low-frequency pancreatic cancer KRAS G12D gene mutation, characterized in that: The kit includes the reagent described in any one of claims 1-3.
5. The kit according to claim 4, characterized in that: The kit further includes any one or a combination of at least two of PCR amplification reagents, restriction enzyme reaction reagents, or Cas enzyme reaction reagents.
6. A method for detecting low-frequency pancreatic cancer KRAS G12D gene mutation based on a Cas12a-Cas13a combined reaction system for non-diagnostic and / or non-therapeutic purposes, characterized in that: The method is carried out using the reagent described in any one of claims 1-3.
7. The method according to claim 6, wherein: The method includes the following steps: S1. After extracting the genomic DNA of the sample to be tested, the single-stranded substrate DNA is prepared by asymmetric PCR, and at the same time, the tRNA, 12CrRNA, and 13CrRNA are prepared. S2. The mutant MT and the wild-type WT are first mixed with the added 13CrRNA, and after heating and annealing, two pairs of DNA-RNA hybrid double strands, MT-13crRNA and WT-13crRNA, are formed respectively. The tRNA is mixed with the 12CrRNA, and after heating and annealing, a tRNA-12crRNA hybrid double strand is formed. S3. The tRNA-12crRNA is then added to the system, mixed with the MT-13crRNA and the WT-13crRNA, and incubated at 37°C for half an hour for strand migration reaction. S4. Cas12a and Cas13a are added to the system. The complexes of Cas12a and Cas13a with their corresponding crRNAs bind and are incubated at 37°C. S5. The 12Reporter and the 13Reporter are added to the system to form a reaction system to be detected. The fluorescence reaction intensity is recorded at 37°C to determine whether there is a low-frequency pancreatic cancer KRAS G12D gene mutation in the sample to be tested.
8. The method according to claim 7, characterized in that: In S2, the heating and annealing program is to gradually cool from 90°C to 20°C, with a decrease of 0.5°C every 30 seconds, and the temperature is maintained for 30 seconds at each gradient.
Citation Information
Cited By
CrRNA and CRISPR / Cas13d detection kit for detecting carcinogenic mutation and application thereof
CN121896235A