Detection method for gene residues of national standard chicken and application of detection method

Abstract

The invention provides a national standard chicken gene residue detection method and application, and relates to the technical field of gene residue detection. The primer group comprises a primer pair and a DBQ double-quenching probe, wherein the primer group and the ND1 gene conserved region of the national standard chicken have specificity. The primer group adopted by the invention has remarkable technical advantages in detection of animal-derived components of livestock and poultry, and an efficient, specific and sensitive novel method is provided for food safety detection.

Description

Technical Field

[0001] The present invention relates to the technical field of gene residue detection, and in particular to a method for detecting gene residues of national standard chickens and applications thereof. Background Art

[0002] Genetic residue detection technology is a key link in food safety supervision. It involves detecting whether food contains illegal or unexpected animal-derived ingredients, which is essential for protecting consumer health, complying with religious laws and international trade standards. With the improvement of global food safety standards and consumers' increasing attention to the source of food, the demand for accurate and efficient detection technology is also growing.

[0003] Existing technologies for detecting animal-derived ingredients in livestock and poultry include microscopy, DNA hybridization, gene chip, high-throughput sequencing, and quantitative PCR. Among them, quantitative PCR is favored for its high sensitivity, accuracy, and repeatability. This method uses specific primers and probes to detect DNA. During PCR amplification, the fluorescent signal is in positive proportion to the PCR product, so it has a high detection accuracy. The detection principle of quantitative PCR involves adding a pair of primers and a specific fluorescent probe to the amplification system. During PCR amplification, the fluorescent group or quenching group on the fluorescent probe separates, and the fluorescence monitoring system can receive the fluorescent signal, so that the accumulation of the fluorescent signal is in positive proportion to the amplification of the PCR product.

[0004] However, quantitative PCR has some defects in the detection of animal-derived ingredients in livestock and poultry. In particular, for specific probes and primers, such as TAMRA-based quenching probes, there are problems such as background signal interference, low sensitivity and low accuracy in the detection of animal-derived ingredients in livestock and poultry. These problems may lead to false positive or false negative results, affecting the reliability of the test results.

[0005] In summary, the challenges faced by quantitative PCR in the detection of animal-derived ingredients in livestock and poultry include interference from background signals, insufficient sensitivity, and low accuracy. These problems limit the scope of application and reliability of this method, making it challenging in actual production. Interference from background signals may lead to misjudgment of test results, while insufficient sensitivity and accuracy limit the application of detection technology in low-abundance samples. The existence of these problems is crucial to improving the reliability and applicability of livestock and poultry animal-derived ingredient detection technology to ensure the quality and safety of biological products. Summary of the invention

[0006] The purpose of the present invention is to provide a detection method and application of national standard chicken gene residues, wherein the primer group has strong specificity, and combined with the DBQ double quenching probe, the sensitivity and specificity of the detection are improved, the background interference is reduced, the repeatability and reliability of the results are enhanced, and a new efficient and accurate method is provided for the detection of livestock and poultry derived components.

[0007] In order to achieve the above-mentioned purpose of the present invention, the following technical scheme is adopted:

[0008] In a first aspect, the present invention provides a primer set, comprising: a primer pair and a DBQ double quenching probe; wherein the primer set is specific to a conserved region of the national standard chicken ND1 gene.

[0009] In an optional embodiment, the primer set includes a forward primer and a reverse primer;

[0010] The nucleotide sequence of the forward primer is shown in SEQ ID NO.1;

[0011] The nucleotide sequence of the reverse primer is shown in SEQ ID NO.2.

[0012] In an optional embodiment, the nucleotide sequence of the DBQ double quenching probe is shown in SEQ ID NO.3.

[0013] In an optional embodiment, the oligonucleotide sequence of the DBQ double quencher probe has a fluorescent group at the 5' end and a double quencher group at the 3' end;

[0014] Preferably, the dual quencher group is DBQ1 or DBQ2;

[0015] Preferably, the dual quencher group is DBQ1;

[0016] Preferably, the fluorescent group is selected from at least one of FAM, HEX, VIC, JOE, TET, CY3, ROX, TexasRed and CY5.

[0017] In a second aspect, the present invention provides a kit comprising a primer set as described in any one of the aforementioned embodiments.

[0018] In a third aspect, the present invention provides a method for detecting national standard chicken gene residues based on the primer set as described in any one of the aforementioned embodiments, comprising:

[0019] S1, synthesize single-stranded S1 molecules as target template DNA;

[0020] S2, amplifying the target template DNA using the primer pairs in the primer set, and using the amplified product as a positive standard;

[0021] S3, performing absolute quantification on the positive standard, and constructing a standard curve based on the absolute quantification of the positive standard;

[0022] S4, collecting the sample to be tested, and using the primer pair in the primer set and the DBQ double quenching probe to perform qPCR amplification reactions on the absolutely quantitative positive standard, the target template DNA and the sample to be tested, respectively, to obtain the fluorescence signals of the positive standard at different concentrations, and the fluorescence signals corresponding to the sample to be tested;

[0023] S5, obtaining a detection result of the sample to be tested based on the standard curve and the fluorescent signal corresponding to the sample to be tested;

[0024] Preferably, the nucleotide sequence of the single-stranded S1 molecule is as shown in SEQ ID NO.4.

[0025] In an optional embodiment, the step S4, collecting the sample to be tested, and using the primer pair and DBQ double quenching probe in the primer set to perform qPCR amplification reaction on the absolutely quantitative positive standard, the target template DNA and the sample to be tested, respectively, comprises:

[0026] preparing a template-free qPCR reaction mixture to perform a template-free qPCR reaction; and preparing a qPCR amplification reaction system containing a DNA sample;

[0027] Amplifying the positive standard and the target template DNA based on the qPCR amplification reaction system to obtain a fluorescent signal result corresponding to the positive standard;

[0028] Amplifying the sample to be tested by using the qPCR amplification reaction system to obtain a fluorescent signal result of the sample to be tested;

[0029] Preferably, the qPCR amplification reaction system comprises:

[0030] 2×qPCR Mix UDG, 12.5 μL;

[0031] The forward primer in the primer pair was at a concentration of 10 μM, 0.5 μL;

[0032] The reverse primer in the primer pair was 10 μM concentration, 0.5 μL;

[0033] The DBQ double quenching probe has a concentration of 10 μM, 0.5 μL;

[0034] ddH2O, 9 μL;

[0035] DNA sample, 2 μL;

[0036] Wherein, the DNA sample includes the positive standard and the target template DNA;

[0037] Preferably, the template-free qPCR reaction mixture comprises:

[0038] 2×qPCR Mix UDG, 12.5 μL;

[0039] The forward primer in the primer pair was at a concentration of 10 μM, 0.5 μL;

[0040] The reverse primer in the primer pair was 10 μM concentration, 0.5 μL;

[0041] The DBQ double quenching probe has a concentration of 10 μM, 0.5 μL;

[0042] ddH2O, 11 μL.

[0043] In an optional embodiment, the step S3, performing absolute quantification on the positive standard, and constructing a standard curve based on the absolute quantification of the positive standard, comprises:

[0044] The positive standard was diluted in a gradient manner, with a dilution factor of 10 1 ~10 8 times, to obtain the positive standard at different concentrations;

[0045] Take serial dilution 10 1 ~10 8 The positive standard sample after multiplication is subjected to qPCR detection, a standard curve is drawn, and the absolute quantitative result of the positive standard sample is obtained; wherein the standard curve is drawn with the copy number logarithm value obtained based on the concentration of the positive standard sample as the horizontal axis and the CT value measured by the positive standard sample as the vertical axis.

[0046] In a fourth aspect, the present invention provides a use of a primer set as described in any of the aforementioned embodiments in the preparation of a detection product for national standard chicken gene residues.

[0047] In a fifth aspect, the present invention provides an application of a primer set as described in any of the aforementioned embodiments in the detection of national standard chicken.

[0048] The present invention provides a detection method and application of national standard chicken gene residues. Among them, the primer set achieves high-specificity recognition by specific binding to the conservative region of the national standard chicken ND1 gene, thereby improving the accuracy of detection. The use of DBQ double quenching probe not only improves the sensitivity of detection, but also significantly reduces the interference of background signals, making the detection results clearer and reducing the risk of false positives. In addition, this probe design also improves the repeatability and reliability of the experimental results, making the detection process more stable and reliable. The present invention can effectively identify and prevent meat adulteration and protect consumer health by detecting animal-derived components in food and feed based on primer sets; through molecular detection technology, such as real-time fluorescence PCR (Polymerase Chain Reaction), high-precision identification of different animal-derived components can be achieved, thereby ensuring the authenticity and quality of meat products; through strict detection technology, potential dangerous components can be effectively monitored and controlled to protect the safety of animal husbandry. In short, the primer set used in the present invention has significant technical advantages in the detection of animal-derived components of livestock and poultry, and provides a new method for food safety detection that is efficient, specific and sensitive. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0050] Figure 1 This is a schematic diagram of the standard curve results (standard curve) established using the national standard chicken TAMRA modified probe for the comparative group in the embodiment;

[0051] Figure 2 This is a schematic diagram of the standard curve results established using the national standard chicken TAMRA modified probe for the comparative group in the embodiment (enlarged curve diagram);

[0052] Figure 3 This is a schematic diagram of the standard curve results (multi-component curve diagram) established using the national standard chicken TAMRA modified probe for the comparative example group in the embodiment;

[0053] Figure 4 This is a schematic diagram of the standard curve results (standard curve) established using the DBQ double quenching probe in the example group of the example;

[0054] Figure 5 This is a schematic diagram of the standard curve results established using the DBQ double quenching probe in the example group of the example (enlarged curve diagram);

[0055] Figure 6 This is a schematic diagram of the standard curve results (multi-component curve diagram) established using the DBQ double quenching probe in the example group of the example;

[0056] Figure 7 When the concentration of the standard in the embodiment is 450 pg / μL, the qPCR detection results of the embodiment group and the comparative example group using two different probes are shown (A is an amplification curve diagram; B is a multi-component curve diagram);

[0057] Figure 8 When the concentration of the standard in the embodiment is 45 pg / μL, the qPCR detection results of the embodiment group and the comparative example group using two different probes are shown (A is an amplification curve diagram; B is a multi-component curve diagram);

[0058] Fig. 9 When the concentration of the standard in the embodiment is 4.5 pg / μL, the qPCR detection results of the embodiment group and the comparative example group using two different probes are shown (A is an amplification curve diagram; B is a multi-component curve diagram);

[0059] Fig.10 When the concentration of the standard in the embodiment is 450 fg / μL, the qPCR detection results of the embodiment group and the comparative example group using two different probes are shown (A is an amplification curve diagram; B is a multi-component curve diagram);

[0060] Fig.11 When the concentration of the standard in the embodiment is 45 fg / μL, the qPCR detection results of the embodiment group and the comparative example group using two different probes are shown (A is an amplification curve diagram; B is a multi-component curve diagram);

[0061] Fig.12 The qPCR test results of the example group and the comparative example group using two different probes when the concentration of the standard in the example is 4.5 fg / μL (A is an amplification curve graph; B is a multi-component curve graph);

[0062] Fig.13 When the concentration of the standard in the embodiment is 0.45 fg / μL, the qPCR detection results of the embodiment group and the comparative example group using two different probes are shown (A is the amplification curve graph; B is the multi-component curve graph). DETAILED DESCRIPTION

[0063] The embodiments of the present invention will be described in detail below in conjunction with the examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially.

[0064] In an embodiment of the present application, a primer set is provided, comprising: a primer pair and a DBQ double quenching probe; wherein the primer set is specific to the conserved region of the national standard chicken ND1 gene.

[0065] As mentioned above, the DBQ double quenching probe is a fluorescent probe used in PCR (polymerase chain reaction) technology, which can have two quenching groups to improve the specificity and sensitivity of detection. The design of this probe is based on the principle of quenching fluorescence, that is, when there is no PCR amplification, the light emitted by the fluorescent group on the probe is absorbed by the adjacent quenching group, so no fluorescent signal is detected. When PCR amplification occurs, due to the exonuclease activity of DNA polymerase, the fluorescent group and the quenching group are separated, and the fluorescent signal is released and detected, thereby achieving quantitative analysis of PCR products.

[0066] In this embodiment, the technology of using DBQ double quenching probe shows significant advantages in improving detection specificity and sensitivity due to its double quenching group design, effectively reducing nonspecific binding and background noise, thereby improving the signal-to-noise ratio, making the detection results clearer and more accurate. This probe is particularly suitable for quantitative PCR (qPCR) applications, and can accurately quantify the starting amount of target DNA, improve experimental efficiency and the reliability and repeatability of results. Therefore, DBQ double quenching probes have been widely used in many fields such as molecular diagnosis, gene expression analysis, and food safety testing, providing more accurate data support for scientific research and clinical diagnosis. It should be noted that the DBQ double quenching group in the embodiment of the present application is prepared and provided by Sangon Biotech (Shanghai) Co., Ltd.

[0067] As mentioned above, national standard chicken refers to the detection regulations and requirements for chicken in the national standard detection method, refer to "GB / T38164-2019 Common Livestock and Poultry Animal-derived Component Detection Method Real-time Fluorescence PCR Method". The primer set provided in this technology is for national standard chicken used in food production and processing, and its DNA is used to detect whether the sample to be tested contains chicken-derived components.

[0068] As mentioned above, ND1 is a gene in mitochondrial DNA, and its full name is NADH dehydrogenase 1. Mitochondria are an organelle in cells that have their own DNA (mitochondrial DNA or mtDNA). The ND1 gene is a protein-coding gene on mitochondrial DNA that participates in the energy metabolism process of cells. In biology, conserved regions refer to nucleotide sequences that are highly conserved between different species. These regions have changed little during evolution and therefore remain similar in many species. Conserved regions are often critical for maintaining the structure and function of proteins.

[0069] Specificity refers to the high matching and recognition ability between the primer set (including forward primer and reverse primer) and the conserved region of the national standard chicken ND1 gene, which means that these primers can only bind to specific regions of the target gene and will not bind to other non-target gene sequences.

[0070] The primer set used in this embodiment achieves high specificity recognition by specific binding to the conservative region of the national standard chicken ND1 gene, thereby improving the accuracy of the detection. The use of DBQ double quenching probe not only improves the sensitivity of the detection, but also significantly reduces the interference of background signals, making the test results clearer and reducing the risk of false positives. In addition, this probe design also improves the repeatability and reliability of the experimental results, making the detection process more stable and reliable.

[0071] Further, the primer set includes a primer pair and a DBQ double quenching probe, wherein the primer pair includes a forward primer and a reverse primer. The specific sequences of the primer pair and the DBQ double quenching probe are:

[0072] (1) The nucleotide sequence of the forward primer is shown in SEQ ID NO. 1: 5'-CCCTCCTCCTTTCATCCTCAT-3'.

[0073] (2) The nucleotide sequence of the reverse primer is shown in SEQ ID NO. 2: 5'-GTCATAGCGGAACCGTGGATA-3'.

[0074] (3) The nucleotide sequence of the DBQ double quencher probe is shown in SEQ ID NO. 3: 5'-CTATGAATCCGGGCCTC-3'.

[0075] The oligonucleotide sequence of the DBQ dual-quencher probe has a fluorescent group at the 5' end and a dual-quencher group at the 3' end, and the dual-quencher group is DBQ1 or DBQ2.

[0076] In some embodiments, the dual quencher group is DBQ1;

[0077] Furthermore, the fluorescent group is selected from at least one of FAM, HEX, VIC, JOE, TET, CY3, ROX, TexasRed and CY5.

[0078] Above, the 5' end fluorescent group is a molecule that can emit fluorescent signals. When the probe is complete, since the fluorescent group is close to the quenching group, the fluorescence emitted by it will be absorbed by the quenching group, so in the absence of PCR amplification, almost no fluorescent signal can be detected. Wherein, the fluorescent group can be different fluorescent molecules, and FAM, HEX, VIC, TET and ROX, etc. are used in this embodiment. These groups are distinguished according to the different fluorescence wavelengths emitted by them, allowing multiple probes to be used simultaneously in multiplex PCR detection, and each probe has different fluorescent signals.

[0079] As mentioned above, the dual quencher group absorbs the light emitted by the fluorescent group, thereby "quenching" the fluorescent signal. This design makes the probe produce almost no fluorescent signal before it is cut by the PCR amplification enzyme. When PCR amplification occurs, due to the 5'-3' exonuclease activity of the DNA polymerase, the probe is cut, the fluorescent group is separated from the quencher group, and the fluorescent signal is released and detected by the detector.

[0080] DBQ1 and DBQ2 are two dual quenching groups with efficient fluorescence quenching ability.

[0081] This design allows the DBQ double-quenching probe to generate a fluorescent signal only when the probe is specifically cut during PCR amplification, thereby achieving quantitative detection of the target DNA sequence. This probe design improves the specificity and sensitivity of the detection, reduces the generation of nonspecific fluorescent signals, and makes the results more accurate and reliable.

[0082] In an embodiment of the present application, a kit is provided, comprising a primer set as described in any one of the aforementioned embodiments.

[0083] As mentioned above, the kit should contain the following key components: a pair of primers that specifically bind to the conserved region of the national standard chicken ND1 gene (forward primer SEQ ID NO.1 and reverse primer SEQ ID NO.2), a DBQ double quenching probe (SEQ ID NO.3), the 5' end of which can have a fluorescent group such as FAM, HEX, VIC, TET or ROX, and the 3' end can have a double quenching group of DBQ1 or DBQ2.

[0084] In addition, it may include but is not limited to:

[0085] (1) Premixed qPCR Mix UDG, which contains the buffer, enzymes, and other components required for PCR reaction.

[0086] (2) Deionized water is used to dilute the reaction system.

[0087] (3) And operating instructions, which provide detailed guidance to users on how to use the kit to conduct experiments.

[0088] In addition, the kit may also contain quality control standards, microplates, optical films, and waste disposal materials to ensure experimental accuracy and user convenience. All of these components are provided under appropriate storage conditions to ensure the stability and effectiveness of the kit.

[0089] In an embodiment of the present application, a method for detecting the national standard chicken gene residue based on the primer set as described in any one of the aforementioned embodiments is provided, comprising:

[0090] Step S1, synthesizing a single-stranded S1 molecule as a target template DNA.

[0091] The above steps involve synthesizing a single-stranded DNA molecule (S1) whose nucleotide sequence matches the conserved region of the national standard chicken ND1 gene (SEQ ID NO.4). This single-stranded DNA will be used as a template for PCR amplification reaction, thereby obtaining a single-stranded DNA template for subsequent PCR amplification.

[0092] Using single-stranded DNA templates can ensure consistency and efficiency of PCR amplification.

[0093] Specifically, the single-stranded DNA template can be obtained by chemical synthesis or PCR method.

[0094] The nucleotide sequence of the single-chain S1 molecule is shown in SEQ ID NO.4:

[0095] CCCTCCTCCTTTCATCCTCATTTCTATGAATCCGGGCCTCATATCCACGGTTCCGCT ATGAC.

[0096] Step S2, using the primer pairs in the primer set to amplify the target template DNA, and using the amplified product as a positive standard.

[0097] In the above steps, the S1 target template DNA is PCR amplified using a primer pair (forward primer and reverse primer) to generate double-stranded DNA, thereby obtaining amplified double-stranded DNA, which will be used as a positive standard for subsequent absolute quantification and construction of a standard curve.

[0098] The positive standard provides a DNA sample of known concentration for calibration and verification of experimental results.

[0099] Specifically, it can be achieved through conventional PCR amplification technology.

[0100] Step S3, performing absolute quantification on the positive standard, and constructing a standard curve based on the absolute quantification of the positive standard.

[0101] As described above, the exact amount of DNA in the positive standard is measured (absolute quantification), and these data are used to construct a standard curve that describes the relationship between DNA concentration and fluorescence signal, thereby obtaining a standard curve for converting fluorescence signal to DNA concentration.

[0102] The standard curve provides a means to accurately quantify the DNA concentration in unknown samples.

[0103] Specifically, a standard curve can be constructed through qPCR and fluorescence detection technology, as well as data analysis software.

[0104] The advantage of the above steps is that keeping the reaction conditions consistent helps ensure the repeatability of the experiment and the reliability of the results. Using the same system and procedure for qPCR of standards and samples can ensure that the quantitative results obtained from the standard curve are directly related to the sample results. Consistent conditions help reduce variables and thus improve the accuracy of the experiment. In qPCR experiments, using a unified reaction system and procedure can improve the efficiency of experimental operations. In addition, the unified conditions enable the standard curve established based on the fluorescence signal of the standard to be accurately applied to the quantitative analysis of the sample.

[0105] Step S4, collecting the sample to be tested, and using the primer pair and DBQ double quenching probe in the primer set to perform qPCR amplification reactions on the absolutely quantitative positive standard, the target template DNA and the sample to be tested, respectively, to obtain the fluorescence signals of the positive standard at different concentrations, and the fluorescence signals corresponding to the sample to be tested.

[0106] The above steps are used to perform qPCR amplification on the positive standard and the sample to be tested, and the DBQ double quenching probe is used to detect the fluorescence signal generated during the amplification process, thereby obtaining the fluorescence signal of the positive standard and the fluorescence signal of the sample to be tested at different concentrations.

[0107] Collection of the fluorescent signal allows for quantification of the target DNA in the sample.

[0108] Specifically, amplification and fluorescence signal collection can be performed through a qPCR instrument.

[0109] It should be noted that, using a qPCR reaction system comprising the primers in the primer set as described above and the DBQ double quenching probe, the positive standard and the template DNA after absolute quantification are subjected to qPCR amplification reactions respectively. At this time, the reaction system, reaction procedure and reaction conditions should remain consistent.

[0110] The advantage is that keeping the reaction conditions consistent helps ensure the repeatability of the experiment and the reliability of the results. Using the same system and procedure for qPCR of standards and samples can ensure that the quantitative results obtained from the standard curve are directly related to the sample results. Consistent conditions help reduce variables and thus improve the accuracy of the experiment. In qPCR experiments, using a unified reaction system and procedure can improve the efficiency of experimental operations. In addition, the unified conditions enable the standard curve established based on the fluorescence signal of the standard to be accurately applied to the quantitative analysis of the sample.

[0111] Step S5, based on the standard curve and according to the fluorescence signal corresponding to the sample to be tested, obtaining the test result of the sample to be tested.

[0112] In the above steps, the standard curve is used to convert the fluorescence signal of the sample to be tested into DNA concentration, so as to determine whether the national standard chicken gene residue exists in the sample, thereby obtaining the quantitative result of the target DNA in the sample to be tested. This step provides an accurate and rapid gene residue detection method.

[0113] Specifically, the DNA concentration can be calculated by comparing the fluorescence signal of the sample to be tested with the standard curve and using a mathematical model (such as linear regression).

[0114] It should be noted that constructing a standard curve is a key step in quantitative PCR (qPCR) experiments. Its purpose is that the standard curve allows researchers to convert the intensity of the fluorescent signal into the exact amount of DNA, thereby achieving accurate quantification of the target DNA in the sample. Different qPCR instruments and experimental conditions may affect the detection of fluorescent signals. The standard curve helps to calibrate these differences and ensure the consistency and comparability of the results. In addition, by analyzing the slope of the standard curve, the amplification efficiency of each qPCR reaction can be evaluated to ensure the reliability of the experiment. The standard curve provides a way to monitor variability during the experiment and help identify possible experimental errors or sample problems.

[0115] In qPCR, as the number of PCR cycles increases, the amount of target DNA increases exponentially, and the corresponding fluorescent signal also increases. Within a certain range, the increase in fluorescent signal is proportional to the logarithmic concentration of DNA.

[0116] In qPCR, the principle of constructing a standard curve is based on the quantitative relationship between the fluorescence signal and the DNA concentration: as the number of PCR cycles increases, the amount of target DNA increases exponentially, resulting in an increase in the corresponding fluorescence signal, and within a certain range, the increase in the fluorescence signal is proportional to the logarithmic concentration of DNA. In order to simplify quantitative analysis, this relationship is usually linearized using logarithmic transformation or a specific mathematical model (such as four-parameter or three-parameter fitting). A series of standards of different concentrations are prepared by gradient dilution of standard DNA of known concentrations, and the fluorescence signals of these standards in qPCR are used to construct a standard curve. Statistical software is used to perform linear or nonlinear fitting on the concentrations of these standards and the corresponding fluorescence signals to obtain a mathematical model describing the relationship between the two, namely the standard curve. Finally, the fluorescence signal generated by the sample to be tested in qPCR is compared with the standard curve, and the concentration of the target DNA in the sample to be tested is calculated by interpolation or curve fitting, thereby achieving accurate quantification of unknown samples.

[0117] For example, suppose the equation of the standard curve is y=mx+b, where y represents the fluorescence signal and x represents the DNA concentration. In the experiment, the sample to be tested produces a fluorescence signal y1. By substituting y1 into the standard curve equation, x1, i.e., the concentration of the target DNA in the sample to be tested, can be calculated.

[0118] In summary, the purpose of constructing a standard curve is to achieve accurate quantification of DNA in qPCR experiments. Its principle is based on the quantitative relationship between the fluorescence signal and the DNA concentration. This relationship is expressed through a mathematical model and used for quantitative analysis of unknown samples.

[0119] It should be noted that the DNA test results can be qualitative results, that is, whether the national standard chicken ingredients are present, or quantitative results, that is, the determination of the amount of national standard chicken DNA. Through the above-mentioned testing process, a method for rapid and accurate DNA quantification is provided, which helps to evaluate the safety and quality of biological products.

[0120] Specifically, you can use qPCR data analysis software, input the fluorescence signal, calculate the DNA concentration according to the standard curve, and compare and analyze the quantities of different samples to ensure compliance with regulatory standards.

[0121] Further, the step S4, collecting the sample to be tested, and using the primer pair and DBQ double quenching probe in the primer set to perform qPCR amplification reaction on the absolutely quantitative positive standard, the target template DNA and the sample to be tested, respectively, includes:

[0122] Step S41, preparing a template-free qPCR reaction mixture to perform a template-free qPCR reaction; and preparing a qPCR amplification reaction system containing a DNA sample.

[0123] The above steps involve preparing the qPCR reaction system, but without any DNA template, the so-called "no template control" (NTC). This helps to evaluate the possible non-specific amplification or contamination in the experiment, so as to obtain the qPCR reaction results without template for control and evaluation of the specificity and accuracy of the experiment.

[0124] By comparing the reaction results with and without template, it can be confirmed that the signal observed in the experiment is indeed generated by the target DNA, rather than caused by experimental manipulation or reagent contamination. Specifically, you can follow the recipe of the qPCR reaction system, but without adding DNA template.

[0125] The above steps involve preparing a qPCR reaction system containing the DNA of the sample to be tested, thereby obtaining a reaction system containing the DNA of the sample to be tested for qPCR amplification. This step ensures that the DNA in the sample to be tested is correctly amplified and detected. Specifically, the DNA of the sample to be tested can be added according to the formula of the qPCR reaction system.

[0126] Step S42, amplifying the positive standard and the target template DNA based on the qPCR amplification reaction system, so as to obtain a fluorescent signal result corresponding to the positive standard.

[0127] In the above, a qPCR amplification reaction system is used to amplify positive standards and target template DNA of known concentrations to obtain their fluorescence signals. The fluorescence signals of the positive standard at different concentrations are obtained and used to construct a standard curve. By comparing the fluorescence signal of the standard with the fluorescence signal of the sample to be tested, the DNA concentration in the sample to be tested can be accurately quantified.

[0128] Step S43: amplify the sample to be tested by using the qPCR amplification reaction system to obtain a fluorescence signal result of the sample to be tested.

[0129] In the above steps, the same qPCR amplification reaction system is used to amplify the sample to be tested, and the fluorescence signal is recorded. The fluorescence signal of the sample to be tested is obtained for subsequent quantitative analysis, thereby ensuring that the test results of the sample to be tested are comparable to the quantitative results of the standard.

[0130] A qPCR instrument can be used for amplification and the fluorescence signal of each cycle can be recorded.

[0131] Furthermore, the qPCR amplification reaction system is shown in Table 1:

[0132] Table 1. qPCR amplification reaction system

[0133] NO. Components Dosage μL 1 2×qPCR Mix UDG 12.5 2 Forward primer in the primer pair 10 μM concentration 0.5 3 Reverse primer in the primer pair 10 μM concentration 0.5 4 DBQ dual quencher probe 10 μM concentration 0.5 5 <![CDATA[ddH2O]]> 9 6 DNA samples 2

[0134] Wherein, the DNA sample includes the positive standard and the target template DNA;

[0135] In addition, the DNA sample may include the sample to be tested, the positive standard, and the template DNA. The DNA sample mentioned here should include the sample to be tested, because the ultimate goal of the experiment is to detect and quantify the specific DNA sequence in the sample to be tested. The qPCR amplification reaction system should include the sample to be tested so that the DNA content in the sample to be tested can be quantified by comparing the fluorescent signal generated by the sample to be tested with the standard curve.

[0136] Furthermore, the template-free qPCR reaction mixture is as shown in Table 2:

[0137] Table 2. qPCR reaction mixture without template

[0138] NO. Components Dosage μL 1 2×qPCR Mix UDG 12.5 2 Forward primer in the primer pair 10 μM concentration 0.5 3 Reverse primer in the primer pair 10 μM concentration 0.5 4 DBQ dual quencher probe 10 μM concentration 0.5 5 <![CDATA[ddH2O]]> 11

[0139] Furthermore, the step S3, performing absolute quantification on the positive standard, and constructing a standard curve based on the absolutely quantitative positive standard, comprises:

[0140] Step S31, the positive standard is diluted in a gradient manner, with a dilution factor of 10 1 ~10 8 times to obtain the positive standard at different concentrations.

[0141] The above steps involve serially diluting a known concentration of a positive standard to obtain different concentrations of DNA samples. The dilution factor ranges from 10 1 ~10 8 times. A series of positive standards with different concentrations are obtained for subsequent qPCR detection. Gradient dilution can cover a wide range of DNA concentrations and help to construct an accurate standard curve.

[0142] Specifically, the dilution can be performed according to a calculated dilution ratio using precise liquid transfer techniques, such as a pipette.

[0143] For example, dilution can be performed by precise liquid handling equipment to ensure the accuracy of concentration. For example, the step of gradient dilution can include:

[0144] (1) Determination of initial DNA concentration:

[0145] The concentration of the linearized plasmid DNA was measured using a spectrophotometer and the result was 4.5 ng / μL.

[0146] (2) Gradient dilution preparation process:

[0147] A. Tube 1: First prepare tube 1. Take 10 μL of plasmid DNA solution and add 90 μL of DNA diluent to make a solution with a concentration of 450 pg / μL.

[0148] B. Tube 2: Next, prepare Tube 2 by taking 10 μL of the solution in Tube 1 and adding 90 μL of DNA diluent to prepare a solution with a concentration of 45 pg / μL.

[0149] C. Tube 3: Then prepare Tube 3 by taking 10 μL of the solution in Tube 2 and adding 90 μL of DNA diluent to prepare a solution with a concentration of 4.5 pg / μL.

[0150] D. Tube 4: To prepare tube 4, take 10 μL of the solution in tube 3 and add 90 μL of DNA diluent to prepare a solution with a concentration of 450 fg / μL.

[0151] E. Tube 5: To prepare tube 5, take 10 μL of the solution in tube 4 and add 90 μL of DNA diluent to make a solution with a concentration of 45 fg / μL.

[0152] F. Tube 6: To prepare tube 6, take 10 μL of the solution in tube 5 and add 90 μL of DNA diluent to make a solution with a concentration of 4.5 fg / μL.

[0153] G. Tube 7: Finally, prepare Tube 7 by taking 10 μL of the solution in Tube 6 and adding 90 μL of DNA diluent to prepare a solution with a concentration of 0.45 fg / μL.

[0154] Target concentration range: Through the above serial dilution process, the concentration range of the obtained DNA solution is from 450pg / μL to 0.45fg / μL. This concentration range will be used as the standard concentration in the qPCR experiment.

[0155] Through this serial dilution method, a series of standards with decreasing concentrations can be prepared, which will be used in qPCR experiments to establish a standard curve, thereby achieving accurate quantification of DNA concentration in unknown samples.

[0156] Step S32, take gradient dilution 10 1 ~10 8 The positive standard sample after multiplication is subjected to qPCR detection, a standard curve is drawn, and the absolute quantitative result of the positive standard sample is obtained; wherein the standard curve is drawn with the copy number logarithm value obtained based on the concentration of the positive standard sample as the horizontal axis and the CT value measured by the positive standard sample as the vertical axis.

[0157] As described above, qPCR experiments were performed using diluted positive standards of different concentrations, and the CT value (the number of cycles at which the fluorescence signal reaches the threshold) of each sample was recorded to obtain the CT value at each dilution concentration, which will be used to draw the standard curve.

[0158] In this step, the dynamic range and amplification efficiency of the qPCR reaction can be evaluated by the CT values ​​at multiple concentration points.

[0159] Specifically, amplification can be performed on a qPCR instrument, and the CT value of each sample can be recorded.

[0160] Then, a standard curve is drawn using the concentration of the positive standard (expressed as the logarithmic value of the copy number) and the corresponding CT value. This curve is usually fitted using a linear or nonlinear regression method to obtain a mathematical model that describes the relationship between DNA concentration and CT value, namely the standard curve.

[0161] The standard curve allows the CT value of unknown samples to be converted into an accurate DNA concentration, achieving absolute quantification. Data fitting and curve drawing can be performed using statistical software or charting software.

[0162] Nonlinear regression analysis, such as a four-parameter logistic regression model, can be used to describe the relationship between fluorescence signal and DNA concentration.

[0163] It should be noted that the required amount needs to be calculated first, which can be calculated based on the carrier for the reaction. In the embodiment of the present application, a microplate is used as a reaction carrier, such as a 48-well plate or a 96-well plate. The total amount of the Mix solution required is calculated based on the number of reaction wells, and the calculation method can be:

[0164] Mixed solution = (number of reaction wells × 3) × (10 + 0.4 + 0.2 + 1); where number of reaction wells + 3 represents the loss of 3 wells. Three replicate wells are made for each test sample. In the gradient dilution process of the positive standard, starting from the original positive standard, a series of dilution steps are used to obtain DNA solutions of different concentrations. The specific dilution process is as follows:

[0165] Tube 1: First take 10 μL of the positive standard and add 90 μL of DNA diluent to obtain a final concentration of 450 pg / μL.

[0166] Tube 2: Next, take 10 μL of the solution from tube 1 and add 90 μL of DNA diluent to reduce the final concentration to 45 pg / μL.

[0167] Tube 3: Then take 10 μL of the solution from tube 2 and add 90 μL of DNA diluent to reduce the final concentration to 4.5 pg / μL.

[0168] Tube 4: Take 10 μL of the solution from tube 3 and add 90 μL of DNA diluent to reduce the final concentration to 450 femtograms per microliter (fg / μL).

[0169] Tube 5: Take 10 μL of the solution from tube 4 and add 90 μL of DNA diluent to reduce the final concentration to 45 femtograms per microliter (fg / μL).

[0170] Tube 6: Take 10 μL of the solution from tube 5 and add 90 μL of DNA diluent to reduce the final concentration to 4.5 femtograms per microliter (fg / μL).

[0171] Tube 7: Finally, take 10 μL of the solution from tube 6 and add 90 μL of DNA diluent to reduce the final concentration to 0.45 femtograms per microliter (fg / μL).

[0172] Through this series of dilution steps, a concentration gradient from 450 pg / μl to 0.45 femtogram / μl was obtained. These standards of different concentrations will be used to construct a standard curve and quantitative analysis in qPCR experiments.

[0173] In an embodiment of the present application, there is provided a use of a primer set as described in any of the aforementioned embodiments in the preparation of a detection product for national standard chicken gene residues.

[0174] The detection products provided in this embodiment include a series of products for national standard chicken gene residue detection, which may include a test kit, which may include a pre-made primer set and DBQ double quenching probe, a pre-mixed qPCR reaction system, reagents for DNA extraction and purification, standard substances and reference substances, data analysis software, operation manuals, quality control materials, storage and transportation equipment, micro-reaction plates and sealing films, and waste disposal kits. In addition, customized services and technical support may also be provided to ensure that users can efficiently and accurately perform gene residue detection and meet the high standards for food safety testing and quality control. These product combinations form a complete solution designed to simplify the experimental process and improve the reliability and repeatability of detection.

[0175] In addition, detection products may also include but are not limited to molecular diagnostic tools, analysis platforms, detection equipment, kits, etc.

[0176] In an embodiment of the present application, a primer set as described in any one of the aforementioned embodiments is provided for use in the detection of national standard chicken.

[0177] Example 1

[0178] In this example, target template DNA was prepared.

[0179] Experimental methods:

[0180] (1) Using the synthesized single-stranded S1 as the target template DNA for PCR amplification;

[0181] (2) Primers F / R were used as amplification primers and a PCR Mix kit was used to obtain the target fragment. The reaction system and reaction procedure are shown in Tables 3 and 4.

[0182] Table 3. Target gene amplification reaction system

[0183] Components Volume (μL) 2×PCR Mix 25 Forward primer F1 2 Reverse primer R1 2 Target template DNA 1 <![CDATA[ddH2O]]> 20

[0184] Table 4. Target gene amplification reaction procedure

[0185]

[0186] (3) After PCR amplification, 1% agarose gel was used to detect whether there was a target band and whether the target band was single. The target band was recovered using a gel recovery kit. The concentration of the template DNA was measured using a NanoDrop UV spectrophotometer and stored at -20°C for future use.

[0187] Example 2

[0188] In this example, a standard curve was established and compared with a conventional method.

[0189] Experimental methods:

[0190] A. Set up the experimental group:

[0191] In this embodiment, the technology in this application is compared with the conventional method, and different experimental groups (example group and comparative example group) are set using different primer sets. In the example group, that is, the technology of the embodiment of this application, the primer set in the reaction system used is:

[0192] (1) DBQ double quenching probe: 5'-FAM-CTATGAATCCGGGCCTC-DBQ1-3';

[0193] (2) Forward primer (detection primer-F): 5'-CCCTCCTCCTTTCATCCTCAT-3'

[0194] (3) Reverse primer (detection primer-R): 5'-GTCATAGCGGAACCGTGGATA-3'.

[0195] The primer set used in the comparative example group is:

[0196] (1) National standard chicken TAMRA probe: 5'-FAM-CTATGAATCCGGGCCTC-TAMRA-TAMRA-3';

[0197] (2) Forward primer (detection primer-F): 5′-CCCTCCTCCTTTCATCCTCAT-3′;

[0198] (3) Reverse primer (detection primer-R): 5'-GTCATAGCGGAACCGTGGATA-3'.

[0199] As described above, for the example group and the comparative example group, the following experiments were conducted, including the preparation of the reaction system, and the reaction and detection under specific procedures to obtain the results.

[0200] B. Preparation of reaction system:

[0201] (1) First prepare a template-free qPCR reaction mix, the reaction system is shown in Table 6, mix well and dispense 25 μL / well into a 96-well plate;

[0202] Table 5. qPCR Mix reaction system

[0203] Components Volume (μL) 2×qPCR Mix (UDG) 12.5 Detection primer-F (10 μM) 0.5 Detection primer-R (10 μM) 0.5 DBQ dual quenching probe (10 μM) 0.5 <![CDATA[ddH2O]]> 11

[0204] (2) The template DNA obtained in Example 1 was also prepared using the reaction system in Table 6 and dispensed into a 96-well plate;

[0205] (3) Then, the positive template is diluted with DNA diluent in a gradient manner. The template dilution is shown in Table 6.

[0206] Table 6. Gradient dilution process

[0207] Dilution tube Dilution ratio Final concentration Tube 1 10μL positive standard + 90μL DNA dilution solution 450pg / μL Tube 2 10μL tube 1 + 90μL DNA dilution buffer 45 pg / μL Tube 3 10μL tube 2 + 90μL DNA dilution buffer 4.5 pg / μL Tube 4 10μL tube 3 + 90μL DNA dilution buffer 450fg / μL Tube 5 10μL tube 4 + 90μL DNA dilution buffer 45fg / μL Tube 6 10μL tube 5 + 90μL DNA dilution buffer 4.5 fg / μL Tube 7 10μL tube 6 + 90μL DNA dilution buffer 0.45 fg / μL

[0208] Add the diluted samples with concentrations ranging from 450 pg / μL to 0.45 fg / μL to the qPCR Mix in a 96-well plate, add 1 μL to each well, and perform 3 replicates for each concentration.

[0209] The total amount of the required Mix solution needs to be calculated according to the number of reaction wells, and the calculation method can be:

[0210] Mixed solution = (number of reaction wells × 3) × (10 + 0.4 + 0.2 + 1); where number of reaction wells + 3 represents the loss of 3 wells. Three replicate wells were made for each test sample. Number of reaction wells + 3 represents the loss of 3 wells.

[0211] C. Program settings:

[0212] (1) Create a detection probe, select "FAM" as the reporter group, "None" as the quencher group, and "None" as the reference fluorescence.

[0213] (2) In the "Assign target(s) to the selected wells" panel, set the "Task" column of the standard curve wells to "Standard" and assign values ​​of 450000, 45000, 4500, 450, 450, 45, 2.5, and 0.45 (meaning the DNA concentration of each well, in fg / μL) in the "Quantity" column. Name the corresponding wells according to the corresponding concentrations in the "Sample name" column.

[0214] (3) Set the amplification program, see Table 7: reaction volume 20 μL, and start the run after setting.

[0215] Table 7. Amplification procedures

[0216]

[0217] D. Result analysis: Compare the experimental data of the embodiment group and the comparative example group.

[0218] In the example, firstly, a national standard chicken detection standard curve is established using different probes, and then the results of the example group and the comparative group are compared from the dimensions of the linear relationship of the standard curve, the qPCR fluorescence increment and the probe basal fluorescence value.

[0219] According to the comparative analysis of qPCR data, Δ Rn It is used to compare the fluorescence increment of two probes, and Fluorescence is used to compare the basal fluorescence values ​​of two probes.

[0220] (1)Reference Figure 1 to Figure 6 It can be seen that the linear relationship of the standard curves established by the two probes is good, and the standard curves for national standard chicken detection can be established. Among them, in the comparative example, for TEMRA, the regression equation is: y = -3.442x + 25.814, r 2 =0.999; while DBQ1 using the method in the embodiment of the present application, the regression equation is: y=-3.419x+25.616, r 2 =0.999.

[0221] (2) Figure 1 to Figure 3 The quenching group of the probe in the comparative group C has a fluorescent signal, and the base fluorescence value is high. Figures 4 to 6 The basal fluorescence value of the DBQ double-quenching probe in the present application is significantly lower in C, and the light gain increment is also higher than that of the control group probe in the test group, which is more conducive to result analysis.

[0222] (3) Furthermore, the qPCR results at each concentration of the standard were analyzed separately, and the fluorescence increment and basal fluorescence values ​​of the two probes were compared, and the detection results from the concentration of 450 pg / μL standard to 0.45 fg / μL standard were obtained.

[0223] refer to Figure 7 to Figure 13 The results show that compared with the national standard chicken TAMRA probe in the comparative group, the DBQ double quenching probe in the embodiment group has a low basal fluorescence value and a significantly better fluorescence increment, which is better than the control group probe.

[0224] In summary, by comparing the standard curves, basal fluorescence values, and fluorescence increments established for the two probes (example group and comparative example group), the DBQ double quenching probe of the example group has lower background fluorescence and better fluorescence increment. The test results were analyzed and compared, and it was concluded that the DBQ double quenching probe of the example group was superior, and its higher fluorescence increment was more conducive to result analysis. When observing test samples of different concentrations, the comparison was obvious and easy to analyze, thereby improving the accuracy and sensitivity of the experiment.

[0225] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer set, characterized in that: include: Primer pair and DBQ double quenching probe; wherein the primer set is specific to the conserved region of the national standard chicken ND1 gene.

2. The primer set according to claim 1, characterized in that: The primer set includes a forward primer and a reverse primer; The nucleotide sequence of the forward primer is shown in SEQ ID NO.1; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.

2.

3. The primer set according to claim 1, characterized in that: The nucleotide sequence of the DBQ double quenching probe is shown in SEQ ID NO.

3.

4. The primer set according to claim 1, characterized in that: The oligonucleotide sequence of the DBQ double quenching probe has a fluorescent group at the 5' end and a double quenching group at the 3' end; Preferably, the dual quencher group is DBQ1 or DBQ2; Preferably, the dual quencher group is DBQ1; Preferably, the fluorescent group is selected from at least one of FAM, HEX, VIC, JOE, TET, CY3, ROX, TexasRed and CY5.

5. A kit, characterized in that: Comprising the primer set according to any one of claims 1 to 4.

6. A method for detecting the national standard chicken gene residue based on the primer set according to any one of claims 1 to 4, characterized in that: include: S1, synthesize single-stranded S1 molecules as target template DNA; S2, amplifying the target template DNA using the primer pairs in the primer set, and using the amplified product as a positive standard; S3, performing absolute quantification on the positive standard, and constructing a standard curve based on the absolute quantification of the positive standard; S4, collecting the sample to be tested, and using the primer pair in the primer set and the DBQ double quenching probe to perform qPCR amplification reactions on the absolutely quantitative positive standard, the target template DNA and the sample to be tested, respectively, to obtain the fluorescence signals of the positive standard at different concentrations, and the fluorescence signals corresponding to the sample to be tested; S5, obtaining a detection result of the sample to be tested based on the standard curve and the fluorescent signal corresponding to the sample to be tested; Preferably, the nucleotide sequence of the single-stranded S1 molecule is as shown in SEQ ID NO.

4.

7. The method for detecting the national standard chicken gene residue as claimed in claim 6, characterized in that: The step S4, collecting the sample to be tested, and using the primer pair and DBQ double quenching probe in the primer set to perform qPCR amplification reaction on the absolutely quantitative positive standard, the target template DNA and the sample to be tested, respectively, includes: preparing a template-free qPCR reaction mixture to perform a template-free qPCR reaction; and preparing a qPCR amplification reaction system containing a DNA sample; Amplifying the positive standard and the target template DNA based on the qPCR amplification reaction system to obtain a fluorescent signal result corresponding to the positive standard; Amplifying the sample to be tested by using the qPCR amplification reaction system to obtain a fluorescent signal result of the sample to be tested; Preferably, the qPCR amplification reaction system comprises: 2×qPCR Mix UDG, 12.5 μL; The forward primer in the primer pair was at a concentration of 10 μM, 0.5 μL; The reverse primer in the primer pair was 10 μM concentration, 0.5 μL; The DBQ double quenching probe has a concentration of 10 μM, 0.5 μL; ddH2O, 9 μL; DNA sample, 2 μL; Wherein, the DNA sample includes the positive standard and the target template DNA; Preferably, the template-free qPCR reaction mixture comprises: 2×qPCR Mix UDG, 12.5 μL; The forward primer in the primer pair was at a concentration of 10 μM, 0.5 μL; The reverse primer in the primer pair was 10 μM concentration, 0.5 μL; The DBQ double quenching probe has a concentration of 10 μM, 0.5 μL; ddH2O, 11 μL.

8. The method for detecting the national standard chicken gene residue as claimed in claim 6, characterized in that: The step S3, performing absolute quantification on the positive standard, and constructing a standard curve based on the absolutely quantified positive standard, comprises: The positive standard was diluted in a gradient manner, with a dilution factor of 10 1 ~10 8 times, to obtain the positive standard at different concentrations; Take serial dilution 10 1 ~10 8 The positive standard sample after multiplication is subjected to qPCR detection, a standard curve is drawn, and the absolute quantitative result of the positive standard sample is obtained; wherein the standard curve is drawn with the copy number logarithm value obtained based on the concentration of the positive standard sample as the horizontal axis and the CT value measured by the positive standard sample as the vertical axis.

9. Use of the primer set according to any one of claims 1 to 4 in preparing a product for detecting national standard chicken gene residues.

10. Use of the primer set according to any one of claims 1 to 4 in the detection of national standard chicken.

Images