Transposon molecular marker for regulating and controlling advanced heading period of sorghum and application of transposon molecular marker

Abstract

The invention discloses a transposon molecular marker for regulating and controlling the advance heading period of sorghum and application. The gene SbDTH2 for regulating and controlling the heading stage of sorghum has a functional allelic variant inserted by a 7416bp transposon at a promoter 2622bp away from the upstream of an initiation codon, and the functional allelic variant is named as a Sbdth2 variation type. The functional allelic variation leads to earlier heading time of sorghum, a molecular marker for high-throughput detection is developed according to the functional allelic variation, and the molecular marker has the advantages of flexibility, high efficiency, high throughput, low cost and the like. The molecular marker can efficiently detect the distribution condition of the variation in the sorghum variety, and sorghum germplasm resources containing or not containing the allelic variation can be screened for crop improvement; meanwhile, marker-assisted selection can be carried out in breeding populations, new sorghum varieties suitable for heading stages in different regions are bred, and the method has important significance in enlarging regional planting of sorghum and improving the yield.

Description

Technical Field

[0001] The invention relates to the field of crop genetic breeding, and in particular to a transposon molecular marker for regulating the advancement of sorghum heading period and its application. Background Art

[0002] Heading period refers to the time interval between sowing and heading. It is one of the important agronomic traits of crops, a key factor in crop adaptation to the external environment, and a key trait that determines crop yield, planting season and regional adaptability. It plays a decisive role in the quantity and quality of crop production and is jointly affected by genes and the environment. When environmental conditions change, the heading period of crops will also change. Usually, when crops are transferred from short-day areas to long-day areas, the heading period of crops will be extended, and the vegetative growth period will also be extended. This extension mechanism can enable the various tissues and parts of crops to be fully developed, gradually forming complete and strong plants, so that there is sufficient nutrient supply for later reproductive growth, and ultimately increasing biomass. However, after the heading period is extended to a certain point, the reproductive growth of crops in the later stage will be limited, resulting in the inability to continue to increase yields, or even a serious reduction in yields. Therefore, the genetic basis of the heading period can enable crops to head at the right time, so that crops can maximize the use of temperature and light resources, thereby maximizing yields, which is of great significance for the cultivation of crop varieties suitable for specific planting environments.

[0003] Sorghum is the fifth largest cereal crop in the world. It is a multi-purpose crop that has been widely cultivated in different climatic zones around the world since it was domesticated in Ethiopia and Sudan many years ago. It is used as food, feed, fuel and fiber. Sorghum is a typical photoperiod-sensitive plant. Generally speaking, when sorghum is transferred from its original domesticated geographical environment to a new environment, the photoperiod changes, making it difficult for sorghum to bloom and grow normally. Different types of sorghum have different photoperiod sensitivities. Bioenergy sorghum is highly sensitive to photoperiods, while sorghum genotypes used for food production are generally insensitive to photoperiods. Therefore, the use of sorghum for food and biomass production in temperate regions depends mainly on the control of its flowering time.

[0004] Flowering time is one of the main targets of sorghum selection in the process of adapting to different geographical environments. It is a key agronomic trait that determines whether sorghum can be used as a food crop or a biomass crop. Although flowering time is crucial to sorghum agronomy, little is known about the molecular mechanisms that regulate sorghum flowering. Currently, only six maturation loci (named Ma1-Ma6) that change photoperiod sensitivity have been identified through genetic analysis. Under long-day conditions, these maturation loci will delay sorghum flowering. Among them, Ma1 was identified as SbPRR7, a pseudo-response regulator homolog of rice OsPRR37, which inhibits flowering under long-day conditions. Ma3 encodes phytochrome B (PHYB), while Ma6 corresponds to SbGhd7, a homolog of rice flower repressor Ghd7. In addition, studies have identified the sorghum flowering locus T (SbFT) gene. Among the 19 PEBP genes, SbFT1, SbFT8, and SbFT10 were identified by multiple methods as potential candidate genes encoding flowering promotion.

[0005] With the decreasing reserves of non-renewable energy sources such as coal, oil and natural gas, the development and utilization of biomass energy has attracted the attention of scientists from all over the world. Compared with the traditional sorghum breeding method, it is not only time-consuming and labor-intensive, but also susceptible to environmental interference and low accuracy. The new sorghum varieties obtained by using the base differences of the target gene to develop specific molecular markers for auxiliary selection and adjustment of the heading period are bound to become an indispensable raw material for biomass energy due to their advantages such as high biological yield, strong stress resistance, wide planting range and high ethanol conversion rate. However, the research on sorghum is still in its infancy, and it is still very difficult to conduct a thorough analysis of the huge gene network that regulates the heading period of sorghum. Therefore, we must obtain as much data related to the heading period as possible, conduct more in-depth and extensive research on the genes that regulate the heading period of sorghum, and cultivate high-yield, stable-yield and widely adaptable sorghum varieties. . Summary of the invention

[0006] In order to solve the above technical deficiencies, the present invention provides a transposon molecular marker and application for regulating the early heading period of sorghum.

[0007] The present invention is achieved through the following technical solutions:

[0008] The present invention provides a molecular marker of a new functional allele Sbdth2 of a sorghum heading period gene SbDTH2. The molecular marker is used to mark a new functional allele Sbdth2 of a sorghum heading period gene SbDTH2. The allele Sbdth2 is a gene SbDTH2 on chromosome 9 of sorghum with a transposon inserted 2622 bp before the promoter ATG. The allele Sbdth2 has an earlier heading period.

[0009] Preferably, the base number of the transposon is 7416 bp.

[0010] Preferably, the molecular marker comprises forward primers 1F and 2F; the reverse primer is 2R;

[0011] The primer DTH2-F-1 for labeling Sbdth2 is numbered as SEQ ID NO.1, and the sequence is as follows:

[0012] 5′TGTCCGGCTGTGATACAAAA 3′;

[0013] The primer DTH2-F-2 is numbered SEQ ID NO.2, and the sequence is as follows:

[0014] 5′TTCTTGCTGCGACGATAATG 3′;

[0015] DTH2-R-2 sequence number SEQ ID NO.3, the sequence is as follows:

[0016] 5'ACATTGTCCAACCATGCTCA 3'. Sequence number SEQ ID NO.2, the sequence is as follows:

[0017] Preferably, the molecular marker can identify the allelic variant Sbdth2;

[0018] Amplification using 2F and 2R showed 7416 bp of Sbdth2 genotype;

[0019] Amplification was performed using 1F and 2R, and the deletion of 7416 bp was the SbDTH2 genotype.

[0020] The molecular marker can be used to detect whether sorghum varieties, lines or germplasm resources are of the Sbdth2 genotype.

[0021] The molecular markers can be used to detect the distribution of key functional alleles in Chinese sorghum germplasm resources.

[0022] The molecular marker can be used for molecular marker-assisted selection breeding of sorghum heading period genes.

[0023] The beneficial effect of the present invention is that the present invention finds the variable site regulating the heading period of sorghum through QTL positioning, which is the transposon insertion on the SbDTH2 gene, and develops it into a molecular marker. The molecular marker closely linked to the heading period of sorghum is developed for early (low generation) selection in breeding, which plays an important role in reducing the time of breeding and improving the breeding of sorghum, and can also improve the economic benefits.

[0024] The present invention provides a sorghum heading period regulating gene

[0025] A new variant of SbDTH2 also provides a molecular marker for high-throughput detection of sorghum heading period genes with important utilization value in breeding. It can quickly, flexibly, efficiently and high-throughput detect the key variants in the SbDTH2 gene that cause changes in sorghum heading period. It can be used to detect the distribution of key functional alleles in sorghum germplasm resources, and can efficiently screen sorghum germplasm resources with ideal heading period and apply it to molecular marker-assisted selection breeding of sorghum heading period genes, which is of great significance to the utilization of

[0026] SbDTH2 expands the planting range of sorghum and has important utilization value. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Figure 2 shows the phylogenetic tree of SbDTH2.

[0028] Figure 2 Figure 2 shows the subcellular localization of SbDTH2.

[0029] Figure 3 This is a schematic diagram of the SbDTH2 transposon.

[0030] Figure 4 This is a gel image of Tx430 and P898012 transposon amplification, where T indicates transposon insertion and P indicates no transposon insertion.

[0031] Figure 5 It is the statistics of the presence or absence of transposons and heading period in different populations.

[0032] Figure 6 This is the gel image of F2 population genotyping, where A is primer 1F / 2R; B is the gel image of primer 2F / 2R amplification.

[0033] Figure 7 This is a gel image of the Sbdth2 / SbDTH2 genotyping of the natural population, where A is primer 1F / 2R; B is the gel image of primer 2F / 2R amplification. Figure 8 This is a gel image of the Sbdth2 / SbDTH2 genotyping of the natural population, where A is primer 1F / 2R; B is the gel image of primer 2F / 2R amplification. DETAILED DESCRIPTION

[0034] Example 1 Bioinformatics Analysis of SbDTH2

[0035] SbDTH2 protein encodes 745 amino acids and is most closely related to maize. The protein is a non-transmembrane, hydrophilic protein with a molecular weight of 80.4 kDa and an isoelectric point of 9.07. It does not have a temperature-responsive PolyQ repeat sequence and a PrD domain (see Figure 1 , 2 ).

[0036] Example 2 Subcellular localization of SbDTH2

[0037] In order to understand the subcellular localization of SbDTH2, an SbDTH2-pBI121 expression vector with a GFP tag was constructed and transferred into Agrobacterium GV3101. The Agrobacterium was then transferred into the lower epidermis of leaves of Nicotiana benthamiana that had grown for about 5 weeks. After the injection, the leaves were cultured for 2 days. Using pBI121-GFP as a control, the fluorescence of the leaves was observed by a two-photon laser confocal microscope (Zeiss, Germany). The subcellular localization results showed that the pBI121-GFP empty vector had fluorescence in the cell membrane, cytoplasm and nucleus, while the SbDTH2 gene had fluorescence only in the nucleus (see Figure 3 ), indicating that SbDTH2 is a nuclear protein.

[0038] Example 3 SbDTH2 polymorphism analysis

[0039] In order to analyze the polymorphism of SbDTH2 gene, we compared the sequence of the gene in the length of 3000bp upstream and 3600bp downstream of ATG in Tx430, P898012, RIO, Tx623 (heading stage) with published genomes, and found 31 polymorphic sites, 23 of which were located in the promoter, 2 in the exon, and 6 in the intron. Among them, only one was located upstream of ATG. 2622p had a 7416bp insertion ( Figure 4 ), and structural analysis revealed that it belonged to the Gypsy transposon, and was only present in the early-flowering varieties Tx430 and Tx623, and was absent in the late-flowering varieties P898012 and RIO, suggesting that the transposon was a functional mutation.

[0040]

[0041] Note: "." represents missing

[0042] Table 1 Statistics of nucleotide polymorphism sites in multiple varieties

[0043] The genotype with transposon insertion is named Sbdth2; the genotype without transposon insertion is SbDTH2.

[0044] Example 4 Transposon conversion into molecular markers

[0045] We designed two pairs of primers for transposon, including forward primers 1F and 2F; the reverse primer is 2R.

[0046] The primer sequence for labeling Sbdth2 is as follows:

[0047] DTH2-F-1 (SEQ ID NO.1)

[0048] 5′TGTCCGGCTGTGATACAAAA 3′;

[0049] DTH2-F-2 (SEQ ID NO. 2)

[0050] 5′TTCTTGCTGCGACGATAATG 3′;

[0051] DTH2-R-2 (SEQ ID NO. 3)

[0052] 5′ACATTGTCCAACCATGCTCA 3′;

[0053] Using 1F and 2R for amplification, it was found that the Tx430 variety could amplify a fragment of 8022 bp, and the P898012 variety amplified a fragment of 606 bp, that is, the P898012 variety lacked 7416 bp (see Figure 5 ); P898012 is SbDTH2 genotype.

[0054] Amplification with 2F and 2R revealed that Tx430 had a 533 bp target band, but P898012 had no target band (see Figure 5 ); Tx430 is Sbdth2 genotype;

[0055] Example 5 Determination of functional variation

[0056] Using molecular markers to count the heading dates and presence of transposons in different populations, we found that in the F2 population (Tx430 / Hongyingzi) and natural populations, the varieties with transposon insertions had an average heading date earlier than those without transposons ( Figure 6 ), the results indicated that the SbDTH2 gene regulated the heading date of sorghum and the insertion of the transposon was a functional mutation.

[0057] Example 6 Genotyping of Recombinant Inbred Line Population

[0058] The materials used in the population were 192 F2 plants of the recombinant inbred line population constructed by Tx430 (Sbdth2) / Hongyingzi (SbDTH2). The heading time statistics were as follows: Figure 7 38 materials were Sbdth2 genotype, 43 materials were SbDTH2 genotype, 117 materials were heterozygous, and the material separation ratio of 1:2:1 was in line with the separation ratio. The results are as follows Figure 7 Shown

[0059] Example 7 Identification of the presence or absence of transposons in sorghum varieties from different sources

[0060] The experimental materials used for identification of transposons included 161 sorghum varieties from China and Africa. The heading time of 161 varieties was counted. Figure 8 shown.

[0061] The presence of transposons in 161 sorghum varieties from China and Africa was identified by 1% agarose gel electrophoresis. 100 varieties contained transposons, while 61 varieties did not.

[0062] The above is only a preferred implementation of this patent. It should be pointed out that for ordinary technicians in this technical field, several improvements and substitutions can be made without departing from the technical principles of this patent. These improvements and substitutions should also be regarded as the scope of protection of this patent.

Claims

1. A molecular marker for a novel functional allele variant Sbdth2 of a sorghum heading date gene SbDTH2, characterized in that: The molecular marker is used to mark a new functional allele variant Sbdth2 of a sorghum heading period gene SbDTH2. The allele variant Sbdth2 is a sorghum chromosome 9 gene SbDTH2 with a transposon inserted 2622 bp before the promoter ATG. The allele variant Sbdth2 has an earlier heading period.

2. The molecular marker according to claim 1, characterized in that: The base number of the transposon is 7416 bp.

3. The molecular marker according to claim 1, characterized in that: The molecular marker comprises forward primers 1F and 2F; the reverse primer is 2R; The primer DTH2-F-1 for labeling Sbdth2 is numbered as SEQ ID NO.1, and the sequence is as follows: 5′TGTCCGGCTGTGATACAAAA 3′; The primer DTH2-F-2 is numbered SEQ ID NO.2, and the sequence is as follows: 5′TTCTTGCTGCGACGATAATG 3′; DTH2-R-2 sequence number SEQ ID NO.3, the sequence is as follows: 5'ACATTGTCCAACCATGCTCA 3'.

4. The molecular marker according to claim 1, characterized in that: The molecular marker can identify the allelic variant Sbdth2; Amplification using 2F and 2R showed 7416 bp of Sbdth2 genotype; Amplification was performed using 1F and 2R, and the deletion of 7416 bp was the SbDTH2 genotype.

5. The use of molecular markers according to claims 1-4, characterized in that: The molecular marker is used to detect whether sorghum varieties, lines or germplasm resources are of the Sbdth2 genotype.

6. The use of molecular markers according to claims 1-4, characterized in that: The molecular markers are used to detect the distribution of key functional alleles in Chinese sorghum germplasm resources.

7. The use of molecular markers according to claims 1-4, characterized in that: The molecular marker is used for molecular marker-assisted selection breeding of sorghum heading period genes.

Images