Molecular marker QTL QMn (Zn). Yaas-4D for detecting manganese (zinc) content of wheat grains and application of molecular marker QTL QMn (Zn). Yaas-4D

Abstract

The invention discloses a molecular marker of QTL (Quantitative Trait Loci) QMn (Zn). Yaas-4D for detecting the manganese (zinc) content of wheat grains and application of the molecular marker. The molecular marker is a KASP molecular marker with the following nucleotide sequence: CAAGGCATGGATTTTCATAATAAGCCTTAC [C / T] GCCCTTAC CGATTCAACAATATCGATGCCTTT. The molecular marker can be used for detecting the manganese (zinc) content of the wheat grains. The KASP molecular marker can be used for molecular marker-assisted selective breeding of the major QTL site QMn (Zn). Yaas-4D related to the content of manganese and zinc in the wheat grains, and a good tool is provided for effective utilization of the major QTL site QMn (Zn). Yaas-4D related to the content of manganese and zinc in the wheat grains in breeding, so that the content of manganese and zinc in the wheat grains can be rapidly screened.

Description

Technical Field

[0001] The present invention belongs to the technical field of wheat breeding, and specifically relates to a method for detecting QTL for manganese (zinc) content in wheat grains. QMn (Zn).yaas-4D Molecular markers and their applications. Background Art

[0002] Zinc and manganese play a vital role in human health. Zinc is an essential trace element for the human body. It participates in the synthesis of proteins and nucleic acids, activates metabolic enzymes, and plays an extremely important role in growth and development, immune regulation, and the utilization of vitamins. Zinc deficiency may lead to decreased immunity, slow growth and development, loss of taste, loss of appetite, and other problems, especially affecting the growth and development of children. About one-third of the world's population does not have enough zinc intake, and zinc deficiency has become one of the important factors of disease and death in developing countries. Manganese plays an important role in the activity of various enzymes in the human body, helping to maintain normal brain function and the metabolism of fat and sugar. Manganese deficiency may lead to anemia, asthma, dwarfism, Parkinson's syndrome and other diseases. Manganese is mainly derived from rice, flour, lentils, etc. Therefore, ensuring adequate zinc and manganese intake is crucial to maintaining human health. Reasonable diet and balanced nutrition are the key to preventing trace element deficiency, and increasing the content of trace elements in crops is also an effective way to solve the problem of trace element deficiency.

[0003] So far, there are few studies on the genetic basis of trace elements, and since it is a quantitative trait, it is still difficult to accurately mine its main effect genetic loci. With the rapid development of wheat genome sequencing, various representative varieties have been sequenced by whole genome, and the application of high-throughput molecular markers in the mining of genetic loci of important agronomic traits of wheat has followed, such as wheat solid phase 660 K SNP, 55 K SNP, liquid phase 440 K SNP, 120 K SNP and 16 K SNP. Competitive allele specific PCR (kompetitive allele specific PCR, KASP) can perform readable allele typing for specified SNPs and InDels (insertions and deletions, InDels). Compared with other verification technologies, KASP has higher analytical stability and accuracy, lower cost and higher throughput. Previous studies on the genetic content of zinc and manganese trace elements in wheat are relatively few, and their main effect stable QTL loci or genes are very rare, and there are no directly applicable related molecular markers in wheat breeding. Summary of the invention

[0004] In view of the problem that the contents of trace elements such as manganese and zinc are quantitative traits and are difficult to detect within the genome, the present invention provides a QTL for detecting the manganese (zinc) content in wheat grains.QMn(Zn).yaas-4D The present invention uses wheat 55K SNP high-throughput gene chip to obtain genotype data, combines two-year phenotypic data of manganese and zinc, and performs QTL positioning, detecting a major QTL locus related to manganese and zinc from Yangmai No. 4. QMn(Zn) .yaas-4D Based on this, a KASP marker and primer set was developed to efficiently screen the manganese and zinc contents in wheat grains.

[0005] The present invention uses wheat 55K SNP high-throughput gene chip to obtain genotype data and detects a major QTL locus related to manganese and zinc content in wheat grains on chromosome 4D from Yangmai 4. QMn(Zn).yaas-4D , and further developed KASP markers and dedicated primer sets KASP-QMn(Zn)-4D .

[0006] In one aspect, the present invention provides a method for detecting QTL for manganese (zinc) content in wheat grains. QMn(Zn).yaas-4D A molecular marker, wherein the molecular marker is a KASP molecular marker having a nucleotide sequence as shown in SEQ ID No.4.

[0007] The second aspect of the present invention provides a primer set for detecting whether the 36th allele variation in the nucleotide sequence shown in SEQ ID No.4 is AA, GG or A and G, and the primer set is a complete primer set consisting of the upstream primers shown in SEQ ID No.1 and SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0008] Furthermore, the upstream primer is designed according to the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat genome and its upstream sequence, and the 3' terminal deoxyribonucleotide of one of the upstream primers is A, and the 3' terminal deoxyribonucleotide of the other upstream primer is G; The downstream primer is designed according to the downstream sequence of the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat genome.

[0009] Furthermore, the 5' end of the upstream primer shown in SEQ ID No. 1 is connected to a fluorescent label sequence FAM, and the 5' end of the upstream primer shown in SEQ ID No. 2 is connected to a fluorescent label sequence HEX.

[0010] The third aspect of the present invention provides a reagent or a kit containing the above-mentioned primer set.

[0011] The fourth aspect of the present invention provides the use of the above primer set or reagent or kit in any of the following: (A) Identify or assist in identifying the manganese (zinc) content of wheat grains; (B) Comparison of the manganese (zinc) content of the wheat grains to be tested; (C) Breeding or selecting wheat plants, lines, strains or varieties having relatively high manganese (zinc) content in wheat grains; (D) Breeding or selecting wheat plants, strains, lines or varieties having relatively low manganese (zinc) content in wheat grains; (E) preparing a product for comparing the manganese (zinc) content of wheat grains to be tested; (F) preparing a product for breeding or screening wheat plants, lines, strains or varieties with relatively high manganese (zinc) content in wheat grains; (G) preparing a product for breeding or screening wheat plants, strains, lines or varieties with relatively low manganese (zinc) content in wheat grains.

[0012] The fifth aspect of the present invention provides a method for detecting whether the 36th allele variation in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat genome is AA, GG, or A and G, which comprises the following steps (1) or (2): (1) Direct sequencing; (2) using the above primer set or a reagent or kit containing the above primer set to perform PCR amplification on the wheat genomic DNA to be tested, scanning the amplified product for fluorescence signals, analyzing the scanning data, and then determining whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat gene to be tested is AA, GG, or A and G according to the following method: If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as red, then the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the genome of the wheat to be tested is a homozygous G; If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and is displayed as blue, then the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the genome of the wheat to be tested is a homozygous A; If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as green, then the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the genome of the wheat to be tested is a hybrid of A and G.

[0013] A sixth aspect of the present invention provides any of the following methods: Method A: A method for comparing the manganese (zinc) content of wheat grains to be tested, comprising the following steps: (A1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat genome is AA, GG, or A and G; (A2) determining the manganese (zinc) content of the wheat grain to be tested as follows: the manganese (zinc) content of the wheat grain to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the genome is G is homozygous is higher than the manganese (zinc) content of the wheat grain to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the genome is A homozygous or A and G is a heterozygous; Method B: A method for breeding or screening wheat plants or lines or strains or varieties with relatively high manganese (zinc) content in wheat grains, comprising the following steps: (B1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat genome is AA, GG, or A and G; (B2) selecting a wheat plant to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D of the genome is G as a parent for breeding, and selecting a wheat plant in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D of the genome is G in each breeding generation, and finally obtaining a wheat plant or strain or variety with a relatively high manganese (zinc) content in the grain; Method C: A method for breeding or screening wheat plants or lines or strains or varieties with relatively low manganese (zinc) content in wheat grains, comprising the following steps: (C1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat genome is AA, GG, or A and G; (C2) selecting a wheat plant to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4D of the genome is A as a parent for breeding, and selecting wheat plants in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4D of the genome is A in each breeding generation, and finally obtaining wheat plants, strains, lines or varieties with relatively low manganese (zinc) content in grains.

[0014] Specifically, in the method A, the method B and the method C, the method for detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat genome is AA, GG or A and G is the method described in the fifth aspect of the present invention. The seventh aspect of the present invention provides the use of the above-mentioned KASP molecular marker, primer set, reagent or kit, and the above-mentioned method in molecular marker-assisted breeding of manganese (zinc) content in wheat grains.

[0015] Through the above technical solution, the present invention achieves the following beneficial effects: The KASP molecular marker of the present invention can be used for the major QTL loci related to manganese and zinc content in wheat grains QMn (Zn).yaas-4D Molecular marker-assisted selection breeding. The present invention is a major effect QTL locus related to manganese and zinc content in wheat grains QMn(Zn).yaas-4D It provides a good tool for effective use in breeding. This marker can quickly screen the manganese and zinc content in wheat grains, facilitate the screening of wheat materials carrying excellent allele variations, and improve breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the specific implementation of the present invention or the technical solution in the prior art, the following is a brief introduction to the drawings required for describing the specific implementation: Figure 1 It is the Yangmai 4 / Yanzhan 1 RIL group QMn(Zn).yaas-4D Positioning map; Figure 2 for QMn(Zn).yaas-4D KASP Mark KASP-QMn(Zn)-4D KASP genotype map amplified in 149 strains; DETAILED DESCRIPTION The specific implementation of the present invention is described in detail below in conjunction with the examples. It should be understood that the specific implementation described herein is only used to illustrate and explain the present invention, and is not used to limit the present invention.

[0017] Yangmai 4 (YM4) is a high-yield and disease-resistant wheat variety bred by the Lixiahe Agricultural Science Research Institute in Jiangsu Province. Yanzhan 1 (YZ1) is a high-yield and early-maturing wheat variety bred in the Huanghuai wheat region. In this experiment, the recombinant inbred lines (RIL) population created by crossing Yangmai 4 as the female parent and Yanzhan 1 as the male parent was used as the material. The genetic map was constructed using the Wheat 55K SNP chip. Combined with the two-year phenotypic data of manganese and zinc, the genetic regulatory sites of the trace element content of these grains were explored and the corresponding KASP markers were developed, in order to provide materials and methods for the breeding of trace element-enriched wheat varieties.

[0018] Example 1 Screening and verification of stable and significant QTL loci associated with manganese and zinc content in wheat grains 1. Materials and Methods 1.1 Experimental materials and field trials In the early stage, Yangmai 4 was used as the female parent and Yanzhan 1 as the male parent. A RIL population of 151 (F 10 The RIL population was planted in the Wanfu Experimental Base of Jiangsu Lixiahe Regional Agricultural Science Research Institute (Yangzhou, Jiangsu) in 2019 and 2020. The wheat sowing date in Yangzhou was uniformly set to October 25 in the experimental year. The experiment adopted a randomized block design, with 3 rows per line, 2 replicates, 40 grains per row, 1.33 m row length, and 0.23 m row spacing. Field fertilization and management refer to local field cultivation production, timely prevention and control of pests and diseases, and manual harvesting of each line according to the plot when mature. Grains were harvested at the maturity stage of wheat in 2020 and 2021. Wheat seeds were washed three times with deionized water, dried, dried in a constant temperature box to constant weight, ground and sieved for the following analysis and testing. The planting methods and trace element determination methods of 149 high-generation wheat lines in 2022 refer to the RIL population.

[0019] 1.2 Trace element determination method The determination of trace elements was completed by Nanjing Yizhiyuan Testing Technology Co., Ltd. Manganese and zinc determination method: weigh 0.2g of the sample (accurate to 0.0001g), place it in a PTFE tank, add 5mL concentrated nitric acid, 2mL hydrogen peroxide, place it on a graphene hot plate, heat and digest at 150℃, add nitric acid in the middle until the digestion solution is transparent, set 170℃ to drive out the acid until the solution remains about 1mL, cool it down and dilute it to 50mL with pure water, filter it, and use the Thermo Fisher dual-channel inductively coupled plasma emission spectrometer (ICP-AES) to determine the content of manganese and zinc elements. Perform a blank test at the same time. Inject the mixed standard solution into ICP-AES, determine the signal response value of the element and the internal standard element, and draw a standard curve with the concentration of the element as the horizontal coordinate and the ratio of the response signal value of the element to the selected internal standard element as the vertical coordinate. Inject the blank solution and the sample solution into ICP-AES respectively, determine the signal response value of the element and the internal standard element, and obtain the concentration of the element in the digestion solution according to the standard curve. The content of the element to be measured in the sample: X=

[0020] Where: X-element content in the sample (mg / kg); P-element mass concentration in the sample solution (mg / L); P 0-mass concentration of element in sample blank solution (mg / L); V-volume of sample digestion solution (mL); f-dilution factor of sample; m-weight of sample (g).

[0021] 1.3 Phenotypic data statistics SPSS 22.0 and Excel 2019 were used to process and statistically analyze the phenotypic data, mainly descriptive statistics, analysis of variance, and T test.

[0022] 1.4 Genetic map construction and QTL mapping The seedlings of the test materials were taken and the genomic DNA was extracted by CTAB method. The Wheat 55 K SNP markers were detected for the test parents and RIL population using Illumina SNP Genotyping Technology Test Platform (Beijing Biobio Co., Ltd.) Bead Array technology. Rht-B1 , Rht-D1 and TaGW2-6AThe corresponding KASP markers controlling important traits of wheat were integrated into the polymorphic markers. After filtering and screening the genotypes of all polymorphic markers, 7974 polymorphic SNP markers were obtained, and 1546 SNPs were removed from the redundancy. Finally, a genetic linkage map covering 21 chromosomes of wheat with a length of 3574.10 cM was constructed. There are 1440 SNPs marked in the above figure, and the average genetic distance between markers is 2.58 cM. The genetic map of each chromosome was drawn using MapChart 2.3 (https: / / www.wur.nl / en / show / Mapchart.htm). Inclusive composite interval mapping (ICIM) was used to detect QTLs significantly associated with the content of trace elements in wheat grains, and the LOD threshold was set to 2.5. Sites with genetic positions less than 10 cM apart at the peak detected on a chromosome were considered to be the same. The flanking marker sequences of the QTL located in this study and the flanking marker sequences of similar loci reported previously were compared with the Chinese spring reference genome sequence in the EnsemblPlants database (http: / / plants.ensembl.org / ) to determine the novelty of the QTL loci located in this study. 1.5 KASP marker development and detection According to the results of QTL mapping, KASP markers (PolyMarker, http: / / polymarker.tgac.ac.uk / ) were developed for the SNP sequences flanking the major effect loci. Two SNP-specific primers (SEQ ID No.1 / SEQID No.2) and one universal primer (SEQ ID No.3) were designed for each marker. A specific sequence that can bind to FAM fluorescence was added to the tail of F1, and a specific sequence that can bind to HEX fluorescence was added to the tail of F2. KASP primers were designed using Polymarker (http: / / www.polymarker.info / ) and synthesized by Beijing Jiacheng Biotechnology Co., Ltd. The developed KASP markers were used for PCR detection of the original 151 RIL populations and 149 wheat lines. The PCR reaction was performed on an ABI Veriti384 PCR instrument (Thermo Fisher), and the PCR amplification products were scanned and read with an Omega F SNP typing detector (LGC Genomics Ltd, KBS-0024-002). Kluster CallerTM (KBioscience) was used for genotyping, and the genotypes of SNP markers were determined based on the analysis results.

[0023] 2. Results A QTL was detected that was simultaneously associated with manganese and zinc content and was located on chromosome 4D. QMn.yaas-4D It can be detected in two-year environment that the synergistic allele variation comes from Yangmai 4, and the phenotypic contribution rate is 6.02%~8.31%. QZn.yaas-4D It can be detected in both environments that the synergistic allele variant originated from Yangmai 4, with a phenotypic contribution rate of 11.39% to 12.29% (Table 1, Figure 1 ).

[0024] Table 1 Information on QTLs simultaneously related to manganese and zinc contents

[0025] After comparison, it was found that this site was a new manganese (zinc) content-related site. Further using the marker information on both sides of the site, the flanking sequence SEQ ID No.4 was downloaded: CAAGGCATGGATTTTCATTCCTAATAAGCCTTTAC[C / T]GCCCTTTTACCGATTCAACAATATCGATGCCTTTT, and KASP primers were designed using Polymarker (http: / / polymarker.tgac.ac.uk / ). The primers were synthesized by Beijing Jiacheng Biotechnology Co., Ltd., and the flanking sequence was successfully converted into a KASP marker. KASP-QMn(Zn)-4D , and the corresponding mutation site is A / G, which is the reverse complementary sequence of position 36 [C / T] in the nucleotide sequence shown in SEQ ID No.4.

[0026] This embodiment is designed for this site KASP-QMn(Zn)-4D Primer set, the primer set includes, the nucleotide sequence of an upstream primer is shown as SEQ ID No.1, the nucleotide sequence of another upstream primer is shown as SEQ ID No.2, the nucleotide sequence of a shared downstream primer is shown as SEQ ID No.3, and at the same time, the 5' end of the upstream primer SEQ ID No.1 is connected to the fluorescent label sequence FAM, and the 5' end of the other upstream primer SEQ ID No.2 is connected to the fluorescent label sequence HEX. The 3' end of the upstream primer is the allelic variant base A / G of the site, and the downstream primer ensures the 4D chromosome specificity of PCR amplification. The primer sequences are shown in Table 2.

[0027] Table 2 QMn(Zn).yaas-4D KASP molecular marker primer information for the interval

[0028] Note: The underlined parts are the linker sequences FAM and HEX.

[0029] Preparation of KASP labeled primer working solution: Take 12 μL (100 μM) of each upstream primer (nucleotide sequence as shown in SEQ ID No.1 and SEQ ID No.2) and 30 μL (100 μM) of downstream primer (nucleotide sequence as shown in SEQ ID No.3), add sterile ultrapure water to 100 μL, mix thoroughly, and use as KASP-labeled primer working solution for later use.

[0030] PCR amplification reaction system: 2 μL of wheat DNA template to be tested (about 30 ng / μL), 0.08 μL of primer working solution, 2.5 μL of KASP Master Mix (LGC, KBS-1016-002), and add sterile ultrapure water to 5 μL; PCR reaction program: first step, 95℃ pre-denaturation for 15 min; second step, 95℃ denaturation for 20 s, 65-57℃ (1℃ decrease per cycle) for 60 s, 9 cycles in total; third step, 95℃ denaturation for 20 s, 57℃ renaturation for 1 min, 32 cycles; stored at 10℃. A blank control (NTC) without adding template DNA to the reaction system was set up in the experiment, and one or more blank controls were set up for each plate.

[0031] Wheat seedlings were taken and the genomic DNA of the wheat to be tested was extracted using the PVP-40 method.

[0032] The wheat genomic DNA to be tested was used as a template, and PCR amplification was performed using the above KASP primer set and PCR reagent to obtain PCR amplification products. The PCR reaction was performed on a S1000™ Thermal Cycler PCR instrument (Bio-Rad Laboratories Inc.), and the PCR amplification product was scanned and read using a multifunctional microplate reader (PHERAstar Plus, BMG LABTECH, Germany). The excitation wavelength of FAM was 485 nm and the emission wavelength was 520 nm; the excitation wavelength of VIC was 535 nm and the emission wavelength was 556 nm, and the excitation wavelength of the system reference fluorescence ROX was 575 nm and the emission wavelength was 610 nm. KlusterCaller software (KBioscience) was used for genotyping, and the significant correlation sites of manganese / zinc content were determined based on the analysis results. QMn (Zn).yaas-4D genotype.

[0033] 151 RIL populations and 149 wheat lines were amplified as above. The fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered near the X-axis (blue) in the fluorescence signal coordinate system of the typing results, which proved that the genotype of these wheats at the nucleotide sequence flanking the SNP site (such as the 36th base (SNP site) of SEQ ID No.4) was A; and the fluorescence signal data of the amplified products The Kluster Caller software analyzed the clusters near the Y axis in the coordinate system (red), proving that the genotype of these wheats at this SNP site is G. KASP-QMn(Zn)-4D The typing results after amplification were the same as those of the original SNP. The KASP typing results of 149 wheat lines are shown in the attached figure. Figure 2 The manganese and zinc contents of 149 varieties in 2022 and QMn (Zn).yaas-4D The typing results are shown in Table 3.

[0034] Table 3 Manganese and zinc content of 149 strains and QMn(Zn).yaas-4D KASP typing results

[0035] Table 4 Carrying QMn(Zn).yaas-4D Results of t-test on manganese and zinc contents in varieties with different genotypes at the locus

[0036] Table 4 is QMn(Zn).yaas-4D The results of the comparison of manganese and zinc content in strains with different genotypes at the locus were obtained by a two-sample t test using Excel 2019 data analysis. The above results show that under the experimental conditions in 2022, the manganese content of the grains of the strain with genotype G (Yangmai No. 4) was 24.75% higher than that of the strain with genotype A (Yanzhan No. 1), with a P value of 0.016. P There was a significant difference at the <0.05 level, indicating that the manganese content of wheat grains containing allele G (Yangmai 4) was higher than that of wheat containing allele A (Yanzhan 1). The zinc content of grains of lines with genotype G was 24.00% higher than that of lines with genotype A, with a P value of 0.00099. P There was a significant difference at the <0.001 level, indicating that the zinc content in the grains of wheat containing allele G was higher than that of wheat containing allele A.

[0037] At the same time, the above KASP mark KASP-QMn(Zn) -4D The primer set and genotype detection system can be applied to molecular marker-assisted selection breeding of manganese and zinc content in wheat grains.

[0038] It can be concluded from the above experimental results that: by using the primer set of the present invention to perform PCR amplification on wheat genomic DNA, the genotype at the site can be directly detected by KASP, the detection method is simple to operate, the detection result is very intuitive, the detection effect is obvious and effective, and the use of the molecular marker for screening can greatly improve the efficiency of molecular marker-assisted selection of wheat breeding for high and low manganese (zinc) content in wheat grains.

[0039] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0040] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0041] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A QTL for detecting manganese (zinc) content in wheat grains QMn(Zn).yaas-4D A molecular marker characterized in that The molecular marker is a KASP molecular marker having the following nucleotide sequence: CAAGGCATGGATTTTCATTCCTAATAAGCCTTTAC[C / T]GCCCTTTTACCGATTCAACAATATCGATGCCTTTT.

2. A primer set for detecting whether the allele variation at position 36 in the nucleotide sequence shown in SEQ ID No. 4 of claim 1 is AA, GG, or A and G, characterized in that: The primer set is a complete set of primers consisting of upstream primers shown in SEQ ID No.1 and SEQ ID No.2 and downstream primers shown in SEQ ID No.

3.

3. The primer set according to claim 2, characterized in that The upstream primer is designed according to the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat genome and its upstream sequence, and the 3' terminal deoxyribonucleotide of one of the upstream primers is A, and the 3' terminal deoxyribonucleotide of the other upstream primer is G; The downstream primer is designed according to the downstream sequence of the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat genome.

4. The primer set according to claim 2, characterized in that The 5' end of the upstream primer shown in SEQ ID No. 1 is connected to a fluorescent tag sequence FAM, and the 5' end of the upstream primer shown in SEQ ID No. 2 is connected to a fluorescent tag sequence HEX.

5. A reagent or kit comprising the primer set according to any one of claims 2 to 4.

6. Use of the primer set according to any one of claims 2 to 4 or the reagent or kit according to claim 5 in any of the following: (A) Identify or assist in identifying the manganese (zinc) content of wheat grains; (B) Comparison of the manganese (zinc) content of the wheat grains to be tested; (C) Breeding or selecting wheat plants, lines, strains or varieties having relatively high manganese (zinc) content in wheat grains; (D) Breeding or selecting wheat plants, strains, lines or varieties having relatively low manganese (zinc) content in wheat grains; (E) preparing a product for comparing the manganese (zinc) content of wheat grains to be tested; (F) preparing a product for breeding or screening wheat plants, lines, strains or varieties with relatively high manganese (zinc) content in wheat grains; (G) preparing a product for breeding or screening wheat plants, strains, lines or varieties with relatively low manganese (zinc) content in wheat grains.

7. A method for detecting whether the 36th allele variation in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat genome is AA, GG, or A and G, characterized in that: The method comprises the following steps (1) or (2): (1) Direct sequencing; (2) using the primer set of claim 4 or a reagent or kit containing the primer set of claim 4 to perform PCR amplification on the wheat genomic DNA to be tested, scanning the amplified product for fluorescence signals, analyzing the scanning data, and then determining whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat gene to be tested is AA, GG, or A and G according to the following method: If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as red, then the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the genome of the wheat to be tested is a homozygous G; If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and is displayed as blue, then the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the genome of the wheat to be tested is a homozygous A; If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as green, the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the genome of the wheat to be tested is a hybrid of A and G.

8. Either of the following methods: Method A: A method for comparing the manganese (zinc) content of wheat grains to be tested, comprising the following steps: (A1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat genome is AA, GG, or A and G; (A2) determining the manganese (zinc) content of the wheat grain to be tested as follows: the manganese (zinc) content of the wheat grain to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the genome is G is homozygous, which is higher than the manganese (zinc) content of the wheat grain to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the genome is A homozygous or a heterozygous of A and G; Method B: A method for breeding or screening wheat plants or lines or strains or varieties with relatively high manganese (zinc) content in wheat grains, comprising the following steps: (B1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat genome is AA, GG, or A and G; (B2) selecting a wheat plant to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D of the genome is G as a parent for breeding, and selecting a wheat plant in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D of the genome is G in each breeding generation, and finally obtaining a wheat plant or strain or variety with a relatively high manganese (zinc) content in the grain; Method C: A method for breeding or screening wheat plants or lines or strains or varieties with relatively low manganese (zinc) content in wheat grains, comprising the following steps: (C1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat genome is AA, GG, or A and G; (C2) selecting a wheat plant to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4D of the genome is A as a parent for breeding, and selecting wheat plants in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 4D of the genome is A in each breeding generation, and finally obtaining wheat plants, strains, lines or varieties with relatively low manganese (zinc) content in grains.

9. The method according to claim 8, characterized in that: In the method A, the method B and the method C, the method for detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 4D in the wheat genome is AA, GG or A and G is the method according to claim 7.

10. Use of the KASP molecular marker according to claim 1, the primer set according to any one of claims 2 to 4, the reagent or kit according to claim 5, or the method according to any one of claims 6 to 9 in molecular marker-assisted breeding for manganese (zinc) content in wheat grains.

Images