Annular connection hypersensitive immunodetection method

Abstract

The invention relates to an antigen detection method which specifically comprises the following steps: reacting an antigen with an antibody, a first annular element and a second annular element to form an antigen-antibody-nucleic acid compound, then obtaining an annular template molecule under the catalytic action of ligase and excision enzyme, carrying out nucleic acid amplification reaction by taking the annular template molecule as a target, and detecting a signal. Therefore, a detection result is obtained. The method disclosed by the invention is good in specificity, high in detection efficiency and low in background signal, and has excellent stability and sensitivity in low-abundance protein detection.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, and in particular to a cyclic connection hypersensitive immunoassay method. Background Art

[0002] In the field of clinical diagnosis, proximity ligation (PLA) is a highly sensitive protein detection technology. PLA technology detects the expression level and post-translational modification of specific proteins. PLA helps to identify disease-related biomarkers, thereby improving the accuracy and reliability of diagnosis, especially in cases where high sensitivity and specificity are required. For example, PLA can be used to detect tumor markers, help diagnose cancer and monitor disease progression. PLA technology has also been applied to the detection of pathogens, such as the identification of viruses, bacteria, etc. This technology can provide higher sensitivity than traditional immunoassays and help to make rapid diagnosis in the early stages of infection.

[0003] The advantage of PLA technology lies in its high specificity and sensitivity. It combines the specificity of ELISA and the sensitivity of PCR, making it possible to detect low-abundance proteins. In addition, PLA technology does not require sample purification and can be directly detected in cell or tissue samples. It is suitable for a variety of sample types, including biological samples, cell lines, and fresh, frozen or formalin-fixed tissue sections. PLA technology can also be used for multiple detections to increase the throughput of experiments. Although PLA technology has many advantages, it also has some limitations, such as high dependence on the quality of the antibodies used, batch differences in antibody performance may lead to deviations in results, and non-specific ligation of oligonucleotides may produce background signals.

[0004] Therefore, there is an urgent need in the art for a PLA-based protein detection technology with good specificity, high stability and high sensitivity. Summary of the invention

[0005] The purpose of the present invention is to provide a protein detection technology based on PLA with good specificity, high stability and high sensitivity.

[0006] The first aspect of the present invention provides an antigen detection method, comprising the steps of:

[0007] (s1) mixing the sample to be tested with a first antibody and a second antibody, so that the first antibody and the second antibody bind to the target antigen in the sample to be tested to form a first antibody-antigen-second antibody complex, wherein the first antibody is coupled to a first connecting element, and the second antibody is coupled to a second connecting element;

[0008] (s2) mixing the first antibody-antigen-second antibody complex with a first loop element, a second loop element and a ligase, so that the first linking element coupled to the first antibody complements the terminal bases of the first loop element and the second loop element to form a double-stranded structure, and the second linking element coupled to the second antibody complements the other terminal bases of the first loop element and the second loop element to form a double-stranded structure;

[0009] There are a first gap and a second gap with a length of ≤1 nt between the first ring element and the second ring element;

[0010] The first gap and the second gap are connected under the action of ligase to form a circular template;

[0011] (s3) cutting the linear nucleic acid under the action of an exonuclease to obtain a circular template; and

[0012] (s4) performing a nucleic acid amplification reaction on the circular template, detecting a signal, and obtaining a detection result;

[0013] Wherein, the first loop element, the second loop element, the first connecting element and the second connecting element are single-stranded nucleic acids.

[0014] In another preferred embodiment, the length of the first loop element is 30-80 nucleotides, preferably 40-60, more preferably 45-60.

[0015] In another preferred embodiment, the length of the second loop element is 60-130 nucleotides, preferably 80-120, and more preferably 90-110.

[0016] In another preferred embodiment, the first connecting element has a structure shown in formula (I):

[0017] Z 0 -Z 1 -Z 2 -Z 3 (I);

[0018] In the formula, Z 0 0 to 5 nucleotides;

[0019] Z 1 and Z 2 Each independently is 5 to 15 nucleotides;

[0020] Z 3 10 to 30 nucleotides;

[0021] The second connecting element has a structure shown in formula (II):

[0022] X 0 -X 1 -X2 -X 3 (II);

[0023] Where, X 0 5 to 15 nucleotides;

[0024] X 1 and X 2 Each independently is 5 to 15 nucleotides;

[0025] X 3 15 to 30 nucleotides;

[0026] The first annular element has a structure shown in formula (III):

[0027] Z 1 '-L 1 -X 1 ' (III);

[0028] In the formula, Z 1 'With Z 1 complementary;

[0029] X 1 'With X 1 complementary;

[0030] L 1 20 to 50 nucleotides;

[0031] The second annular element has a structure shown in formula (IV):

[0032] Z 2 '-L 2 -X 2 ' (IV);

[0033] In the formula, Z 2 'With Z 2 complementary;

[0034] X 2 'With X 2 complementary;

[0035] L 2 It is 50 to 100 nucleotides.

[0036] In another preferred embodiment, L 1 20 to 40 nucleotides

[0037] In another preferred embodiment, L 2 It is 60 to 100 nucleotides.

[0038] In another preferred embodiment, Z 1 , Z 2 , X 1 and X2 Each independently has 7 to 13 nucleotides, preferably 8 to 12, more preferably 9 to 11, for example 10 nucleotides.

[0039] In another preferred embodiment, Z 3 The length of the nucleic acid sequence is 10 to 25 nucleotides, preferably 10 to 20, more preferably 12 to 16, for example, 14 nucleotides.

[0040] In another preferred embodiment, X 3 The length of the nucleic acid sequence is 15 to 25 nucleotides, preferably 17 to 22, more preferably 18 to 11, for example, 20 nucleotides.

[0041] In another preferred embodiment, Z 0 It is 1 to 4 nucleotides, preferably 1 to 3, for example, 2 nucleotides.

[0042] In another preferred embodiment, X 0 The length of the DNA sequence is 6 to 13 nucleotides, preferably 8 to 12, for example, 10 nucleotides.

[0043] In another preferred embodiment, L 1 The length of the nucleic acid sequence is 20 to 40 nucleotides, preferably 25 to 35, more preferably 30 to 35, for example, 32 nucleotides.

[0044] In another preferred embodiment, L 2 It is 70 to 100 nucleotides, preferably 80 to 90, more preferably 85 to 90, for example, 87 nucleotides.

[0045] In another preferred example, the first connecting element has a nucleotide sequence as shown in SEQ ID NO:1.

[0046] In another preferred example, the second connecting element has a nucleotide sequence as shown in SEQ ID NO:2.

[0047] In another preferred example, the first loop element has a nucleotide sequence as shown in SEQ ID NO:3.

[0048] In another preferred example, the second loop element has a nucleotide sequence as shown in SEQ ID NO:4.

[0049] In another preferred embodiment, the sample to be tested is 1-100 μL, preferably 1-50 μL.

[0050] In another preferred example, the first antibody is linked to one or more first linking elements.

[0051] In another preferred example, the second antibody is linked to one or more second linking elements.

[0052] In another preferred embodiment, the antibody is linked to the linking element via a covalent bond.

[0053] In another preferred embodiment, the antibody is linked to the linker via a click chemistry reaction.

[0054] In another preferred embodiment, the step (s1) is carried out at 20-50°C, preferably 25-40°C, more preferably 30-40°C, for example, about 37°C.

[0055] In another preferred embodiment, in step (s1), the time for mixing the sample to be tested with the first antibody and the second antibody is 0.5 to 5 hours, preferably 1 to 4 hours, more preferably 1 to 3 hours, for example, about 2 hours.

[0056] In another preferred embodiment, in step (s1), the sample to be tested is mixed with the first antibody and the second antibody in a sample incubation buffer containing components selected from the group consisting of: 0.01% to 1% goat IgG, 0.01 to 1 mg / mL single-stranded salmon sperm DNA, 0.01% to 1% BSA, 1 to 10 mM EDTA, 0.001% to 0.1% Triton-X100, 0.001% to 0.01% sodium azide and 0.001% to 0.01% blocking conjugate;

[0057] Preferably, 0.01% to 0.1% goat IgG, 0.05 to 0.51 mg / mL single-stranded salmon sperm DNA, 0.1% to 1% BSA, 3 to 8 mM EDTA, 0.005% to 0.05% Triton-X100, 0.005% to 0.05% sodium azide and 0.001% to 0.01% blocking conjugate;

[0058] For example, 0.05% goat IgG, 0.1 mg / mL single-stranded salmon sperm DNA, 0.5% BSA, 5 mM EDTA, 0.01% Triton-X100, 0.02% sodium azide, and 0.2% blocking conjugate.

[0059] In another preferred embodiment, in step (s2), the concentrations of the first ring element and the second ring element are independently 0.01 to 500 μM.

[0060] In another preferred embodiment, in step (s2), the concentrations of the first antibody and the second antibody are independently 0.01 to 5 nM, preferably 0.05 to 1 nM, more preferably 0.05 to 0.5 nM, for example, about 0.1 nM or 0.2 nM.

[0061] In another preferred embodiment, the first antibody and the second antibody are diluted in an antibody diluent containing components selected from the following: 10-50 mM Tris-HCl, 1-20 mM EDTA, 0.01-1 μg / mL biotin, 0.01-1 mg / mL single-stranded salmon sperm DNA, 0.001%-0.1% sodium azide and 0.01%-5% PEA conjugate;

[0062] Preferably, 10-30 mM Tris-HCl, 5-15 mM EDTA, 0.01-0.5 μg / mL biotin, 0.1-0.5 mg / mL single-stranded salmon sperm DNA, 0.01%-0.05% sodium azide and 0.1%-1% PEA conjugate;

[0063] For example, 20 mM Tris-HCl, 10 mM EDTA, 0.05 μg / mL biotin, 0.2 mg / mL single-stranded salmon sperm DNA, 0.02% sodium azide, and 0.5% PEA conjugate.

[0064] In another preferred embodiment, in step (s2), the molar ratio of the first cyclic element to the second cyclic element is 5:1 to 1:5, preferably 3:1 to 1:3, more preferably 2:1 to 1:2, for example, about 1:1.

[0065] In another preferred embodiment, in step (s2), the concentrations of the first ring element and the second ring element are independently 0.01 to 300 μM, preferably 0.05 to 100 μM, more preferably 0.5 to 50 μM, for example, 1 μM.

[0066] In another preferred embodiment, in step (s2), the double-stranded structure is spontaneously formed at 20-50°C, preferably 25-40°C, more preferably 30-40°C, for example, about 37°C.

[0067] In another preferred embodiment, in step (s2), the first antibody-antigen-second antibody complex is mixed with the first ring element and the second ring element for 0.5 to 5 hours, preferably 1 to 4 hours, more preferably 1 to 3 hours, for example, about 2 hours.

[0068] In another preferred embodiment, in step (s2), the ligase is selected from the following group: T4, T7, Ampligase, or a combination thereof.

[0069] In another preferred embodiment, in step (s2), the ligation is performed in a ligation mixture containing components selected from the group consisting of: Tris-HCl, MgCl 2 , ATP and DTT.

[0070] In another preferred embodiment, in step (s2), the ligation mixture comprises the following components: 5-50 mM Tris-HCl, 0.1-10 mM MgCl 2 , 0.1-10 mM ATP and 1-100 mM DTT;

[0071] Preferably, 10-30 mM Tris-HCl, 0.5-5 mM MgCl 2 , 0.5-5 mM ATP and 5-50 mM DTT;

[0072] More preferably, 20 mM Tris-HCl, 1.5 mM MgCl 2 , 1.5 mM ATP and 10 mM DTT.

[0073] In another preferred embodiment, in step (s2), the amount of the ligase is 1-10U, preferably 5-10U, more preferably 6-8U, for example, about 7.5U.

[0074] In another preferred embodiment, in step (s2), the connection is performed at 20-60°C, preferably 30-50°C, more preferably 40-48°C, for example, about 45°C.

[0075] In another preferred embodiment, in step (s2), the connection time is 10 to 120 min, preferably 20 to 60 min, more preferably 20 to 40 min, for example, about 30 min.

[0076] In another preferred embodiment, in step (s3), the exonuclease is exonuclease I and exonuclease III.

[0077] In another preferred embodiment, the step (s3) is carried out at 20-50°C, preferably 25-40°C, more preferably 30-40°C, for example, about 37°C.

[0078] In another preferred embodiment, in step (s3), the exonuclease is incubated for 10 to 120 min, preferably 20 to 60 min, more preferably 20 to 40 min, for example, about 30 min.

[0079] In another preferred embodiment, in step (s3), the concentration of the exonuclease is 0.1-20 U / μL, preferably 0.5-10 U / μL, more preferably 1-5 U / μL, for example, about 2.5 U / μL.

[0080] In another preferred embodiment, the step (s3) is carried out in an exonuclease mixture containing the following components: 1-100 mM Tris-HCl, 1-50 mM MgCl 2 and 0.1-10 mM DTT;

[0081] Preferably, 10-60 mM Tris-HCl, 1-30 mM MgCl 2 and 0.1-5 mM DTT;

[0082] More preferably, 20-40 mM Tris-HCl, 5-20 mM MgCl 2 and 0.5-3 mM DTT;

[0083] For example, about 40 mM Tris-HCl, about 10 mM MgCl 2 and about 1 mM DTT.

[0084] In another preferred embodiment, the exonuclease mixture comprises the following components: Tris-HCl, MgCl 2 and DTT.

[0085] In another preferred embodiment, after step (s3), a heating step (s3a) is further included, wherein the heating is performed at 60-85°C, preferably 70-85°C, more preferably 75-85°C, for example, about 80°C.

[0086] In another preferred embodiment, in the heating step (s3a), the heating time is 10 to 60 min, preferably 20 to 40 min, more preferably 20 to 30 min, for example, about 20 min.

[0087] In another preferred embodiment, the cyclic template has a structure selected from the following group:

[0088]

[0089] Among them, Z 1 ', L 1 , X 1 ', Z 2 ', L 2 and X 2 'As mentioned above.

[0090] In another preferred embodiment, in step (s4), in the nucleic acid amplification, the upstream primer spans the first gap and the downstream primer spans the second gap.

[0091] In another preferred embodiment, the upstream primer spanning the first gap means that the region where the upstream primer is complementary to the circular template includes the first gap.

[0092] In another preferred embodiment, the length of the upstream primer is 15 to 30 nucleotides, preferably 15 to 25, and more preferably 18 to 23.

[0093] In another preferred embodiment, taking the first gap as the base point, the length ratio of both sides of the upstream primer is 2:1 to 1:2.

[0094] In another preferred embodiment, the downstream primer spans the second gap, which means that the region where the downstream primer is complementary to the circular template includes the second gap.

[0095] In another preferred embodiment, the length of the downstream primer is 15 to 30 nucleotides, preferably 15 to 25, and more preferably 18 to 23.

[0096] In another preferred embodiment, taking the second gap as the base point, the length ratio of both sides of the downstream primer is 2:1 to 1:2.

[0097] In another preferred example, the upstream primer has a nucleotide sequence as shown in SEQ ID NO:5.

[0098] In another preferred example, the downstream primer has a nucleotide sequence as shown in SEQ ID NO:6.

[0099] In another preferred embodiment, in step (s4), the nucleic acid amplification further includes a probe.

[0100] In another preferred example, the probe has a nucleotide sequence as shown in SEQ ID NO:7.

[0101] In another preferred embodiment, in step (s4), the nucleic acid amplification reaction is selected from the following group: PCR, qPCR, dye-based PCR, ddPCR, RPA, or LAMP.

[0102] In another preferred embodiment, the nucleic acid amplification reaction is a qPCR reaction.

[0103] In another preferred embodiment, the reaction conditions of the nucleic acid amplification reaction include pre-denaturation at 95°C for 10 minutes, denaturation at 95°C for 15 seconds, and extension at 60°C for 60 seconds, for a total of 45 cycles.

[0104] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

[0105] In another preferred embodiment, the method is in vitro.

[0106] In another preferred embodiment, the antigen includes glial fibrillary acid protein and / or IL-6.

[0107] In another preferred embodiment, the content of the target protein in the sample to be tested is ≥100 pg / mL, preferably ≥10 pg / mL, preferably ≥1 pg / mL, and more preferably ≥1 pg / mL.

[0108] In another preferred example, the sample to be tested includes a plasma sample.

[0109] In a second aspect, the present invention provides an antigen detection system, the antigen detection system comprising:

[0110] (a) a first antibody and a second antibody, wherein the first antibody and the second antibody specifically bind to a target antigen, and the first antibody is coupled to a first connecting element, and the second antibody is coupled to a second connecting element;

[0111] (b) a first annular element; and

[0112] (c) a second annular element;

[0113] Wherein, the definitions of the first connecting element, the second connecting element, the first annular element and the second annular element are as described in the first aspect of the present invention.

[0114] In another preferred embodiment, the concentrations of the first antibody and the second antibody in the antigen detection system are independently 0.01 to 5 nM, preferably 0.05 to 1 nM, more preferably 0.05 to 0.5 nM, for example, about 0.1 nM or 0.2 nM.

[0115] In another preferred example, in the antigen detection system, the molar ratio of the first annular element to the second annular element is 5:1 to 1:5, preferably 3:1 to 1:3, more preferably 2:1 to 1:2, for example, about 1:1.

[0116] In another preferred example, in the antigen detection system, the concentrations of the first ring element and the second ring element are independently 0.01 to 300 μM, preferably 0.05 to 100 μM, more preferably 0.5 to 50 μM, for example, about 1 μM.

[0117] In another preferred embodiment, the antigen detection system further comprises primers and probes, and the definitions of the primers and probes are as described in the first aspect of the present invention.

[0118] In another preferred embodiment, the antigen detection system further comprises a ligase and / or an exonuclease.

[0119] In another preferred example, in the antigen detection system, the amount of the ligase is 1-10U, preferably 5-10U, more preferably 6-8U, for example, about 7.5U.

[0120] In another preferred example, in the antigen detection system, the concentration of the exonuclease is 0.1-20 U / μL, preferably 0.5-10 U / μL, more preferably 1-5 U / μL, for example, about 2.5 U / μL.

[0121] In a third aspect, the present invention provides an antigen detection kit, the kit comprising:

[0122] (i) a first container and a first antibody and a second antibody located in the first container; the first antibody is coupled to a first connecting element, and the second antibody is coupled to a second connecting element;

[0123] (ii) a second container and a first annular element and a second annular element located in the second container;

[0124] Wherein, the definitions of the first connecting element, the second connecting element, the first annular element and the second annular element are as described in the first aspect of the present invention.

[0125] In another preferred embodiment, the kit further comprises:

[0126] (iii) a third container and a ligase located in the third container;

[0127] (iv) a fourth container and an exonuclease located in the fourth container.

[0128] In another preferred embodiment, the kit further comprises a fifth container and primers and probes located in the fifth container, and the definitions of the primers and probes are as described in the first aspect of the present invention.

[0129] In another preferred example, the first container, the second container, the third container, the fourth container and / or the fifth container are the same or different containers.

[0130] In another preferred embodiment, the kit further comprises a sample incubation buffer, and the definition of the sample incubation buffer is as described in the first aspect of the present invention.

[0131] In another preferred embodiment, the kit further comprises a ligation mixture containing components selected from the group consisting of: 5-50 mM Tris-HCl, 0.1-10 mM MgCl 2 , 0.1-10 mM ATP and 1-100 mM DTT;

[0132] Preferably, 10-30 mM Tris-HCl, 0.5-5 mM MgCl 2 , 0.5-5 mM ATP and 5-50 mM DTT;

[0133] More preferably, 20 mM Tris-HCl, 1.5 mM MgCl 2 , 1.5 mM ATP and 10 mM DTT.

[0134] In another preferred embodiment, the kit further comprises an exonuclease mixture containing the following components: 1-100 mM Tris-HCl, 1-50 mM MgCl 2 and 0.1-10 mM DTT;

[0135] Preferably, 10-60 mM Tris-HCl, 1-30 mM MgCl 2 and 0.1-5 mM DTT;

[0136] More preferably, 20-40 mM Tris-HCl, 5-20 mM MgCl 2 and 0.5-3 mM DTT;

[0137] For example, about 40 mM Tris-HCl, about 10 mM MgCl 2 and about 1 mM DTT.

[0138] In another preferred embodiment, the kit further comprises an antibody diluent, and the antibody dilution buffer is defined as described in the first aspect of the present invention.

[0139] In another preferred embodiment, the kit further comprises a nucleic acid amplification reaction solution for nucleic acid amplification reaction.

[0140] In another preferred example, the first antibody and the second antibody specifically bind to the target antigen.

[0141] In a fourth aspect, the present invention provides a use of the antigen detection system as described in the second aspect of the present invention or the antigen detection kit as described in the third aspect of the present invention, for detecting antigens in a sample to be tested.

[0142] In another preferred embodiment, the sample to be tested contains an antigen, preferably glial fibrillary acid protein and / or IL-6.

[0143] In another preferred embodiment, the use is for the purpose of disease diagnosis.

[0144] In another preferred embodiment, the use is for non-disease diagnosis purposes.

[0145] In another preferred example, the sample to be tested includes a plasma sample.

[0146] In a fifth aspect, the present invention provides an antigen detection method, comprising the steps of:

[0147] The antigen detection system as described in the second aspect of the present invention or the antigen detection kit as described in the third aspect of the present invention is used to process the sample to be tested, and a nucleic acid amplification reaction is performed to obtain the test result.

[0148] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0149] Figure 1 A schematic diagram of the method of the present invention is shown.

[0150] Figure 2 The graph shows the result of detecting GFAP using the method of the present invention.

[0151] Figure 3 The effect of different lengths of oligonucleotides on the experimental results is shown.

[0152] Figure 4 A graph showing the results of detecting IL-6 using the method of the present invention.

[0153] Figure 5 A graph showing the results of PLA detection of IL-6. DETAILED DESCRIPTION

[0154] After extensive and in-depth research, a large number of experiments and screening, the inventor unexpectedly discovered a protein detection method based on a ring structure for the first time. The inventor optimized the length of the ring element and finally developed a protein detection method with good specificity and high detection efficiency. The method of the present invention solves the problem of strong background signal in the prior art, improves the stability and sensitivity of protein marker detection, and has excellent stability and sensitivity in the application of low-abundance protein detection. On this basis, the present invention was completed.

[0155] the term

[0156] In order to more easily understand the present invention, some technical and scientific terms are specifically defined below. Unless otherwise clearly defined in this article, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the present invention belongs. Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions, because such methods and conditions can be changed. It should also be understood that the terms used herein are intended only to describe specific embodiments, and are not intended to be restrictive, and the scope of the present invention will be limited only by the appended claims.

[0157] As used herein, the term “comprise” or variations thereof such as “include” or “comprising”, etc., are understood to include the stated elements or components but do not exclude other elements or components.

[0158] The term "about" can refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0159] As used herein, unless otherwise indicated, any concentration range, percentage range, ratio range or integer range should be understood to include any integer value within the range and fractional values ​​thereof (e.g., one tenth and one hundredth of an integer) where appropriate.

[0160] As used herein, the term "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items.

[0161] As used herein, the terms "first / second connecting element of the present invention" and "probe 1 / 2" are used interchangeably.

[0162] As used herein, the terms "first / second circular element of the present invention" and "oligonucleotide 1 / 2" are used interchangeably.

[0163] glial fibrillary acid protein

[0164] Glial Fibrillary Acidic Protein (GFAP) is an intermediate filament protein found in astrocytes of the central nervous system (CNS). GFAP plays an important role in maintaining cell structure, providing cell support, and regulating intracellular signaling. In neurological diseases, the expression and function of GFAP may change, and these changes are often closely related to the pathological process of the disease.

[0165] Method of the present invention

[0166] As used herein, the terms "the method of the present invention" and "the antigen detection method of the present invention" are used interchangeably and both refer to the method of the first aspect of the present invention, comprising the steps of:

[0167] (s1) mixing the sample to be tested with a first antibody and a second antibody, so that the first antibody and the second antibody bind to the target antigen in the sample to be tested to form a first antibody-antigen-second antibody complex, wherein the first antibody is coupled to a first connecting element, and the second antibody is coupled to a second connecting element;

[0168] (s2) mixing the first antibody-antigen-second antibody complex with a first loop element, a second loop element and a ligase, so that the first linking element coupled to the first antibody complements the terminal bases of the first loop element and the second loop element to form a double-stranded structure, and the second linking element coupled to the second antibody complements the other terminal bases of the first loop element and the second loop element to form a double-stranded structure;

[0169] There are a first gap and a second gap with a length of ≤1 nt between the first ring element and the second ring element;

[0170] The first gap and the second gap are connected under the action of ligase to form a circular template;

[0171] (s3) cutting the linear nucleic acid under the action of an exonuclease to obtain a circular template; and

[0172] (s4) performing a nucleic acid amplification reaction on the circular template, detecting a signal, and obtaining a detection result;

[0173] Wherein, the first loop element, the second loop element, the first connecting element and the second connecting element are single-stranded nucleic acids.

[0174] In a preferred embodiment, the first connecting element has a structure shown in formula (I):

[0175] Z 0 -Z 1 -Z 2 -Z 3 (I);

[0176] In the formula, Z 0 0 to 5 nucleotides;

[0177] Z 1 and Z 2 Each independently is 5 to 15 nucleotides;

[0178] Z 3 10 to 30 nucleotides;

[0179] The second connecting element has a structure shown in formula (II):

[0180] X 0 -X 1 -X 2 -X 3 (II);

[0181] Where, X 0 5 to 15 nucleotides;

[0182] X 1 and X 2 Each independently is 5 to 15 nucleotides;

[0183] X 3 15 to 30 nucleotides;

[0184] The first annular element has a structure shown in formula (III):

[0185] Z 1 '-L 1 -X 1 ' (III);

[0186] In the formula, Z1 'With Z 1 complementary;

[0187] X 1 'With X 1 complementary;

[0188] L 1 20 to 50 nucleotides;

[0189] The second annular element has a structure shown in formula (IV):

[0190] Z 2 '-L 2 -X 2 ' (IV);

[0191] In the formula, Z 2 'With Z 2 complementary;

[0192] X 2 'With X 2 complementary;

[0193] L 2 It is 50 to 100 nucleotides.

[0194] In a preferred embodiment, the first connecting element has a nucleotide sequence as shown in SEQ ID NO:1.

[0195] In a preferred embodiment, the second connecting element has a nucleotide sequence as shown in SEQ ID NO:2.

[0196] In a preferred embodiment, the first loop element has a nucleotide sequence as shown in SEQ ID NO:3.

[0197] In a preferred embodiment, the second loop element has a nucleotide sequence as shown in SEQ ID NO:4.

[0198] In a preferred embodiment, in the nucleic acid amplification, the upstream primer spans the first gap, and the downstream primer spans the second gap.

[0199] like Figure 1As shown, the principle of the method of the present invention is that two antibodies specifically recognize the target antigen (target protein) and bind thereto, and the two antibodies are respectively modified with a first connecting element and a second connecting element, thereby shortening the distance between the first connecting element and the second connecting element. In the presence of the first annular element and the second annular element, the first connecting element coupled to the first antibody is complementary to the terminal bases of the first annular element and the second annular element to form a double-stranded structure, and the second connecting element coupled to the second antibody is complementary to the other terminal bases of the first annular element and the second annular element to form a double-stranded structure, thereby forming a structure of the first gap and the second gap. The first gap and the second gap are connected under the action of a ligase to form a circular template. Exonuclease is added to remove the linear nucleic acid in the system to obtain a highly pure circular template. The circular template is subjected to a nucleic acid amplification reaction to obtain a test result.

[0200] The main advantages of the present invention include:

[0201] 1. The method of the present invention has good repeatability, high accuracy, simple operation, low cost and does not require large-scale instruments.

[0202] 2. The method of the present invention is suitable for trace detection and can detect 1 μL of sample.

[0203] 3. The method platform of the present invention has wide applicability, can detect multiple targets simultaneously, and is suitable for high-throughput detection.

[0204] 4. The method of the present invention can achieve rapid detection.

[0205] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0206] General Methods

[0207] 1. Prepare affinity probes: Combine polyclonal antibodies with oligonucleotides modified with amine groups through aromatic hydrazide chemistry to form affinity probes with phosphorylated 5' or 3' ends. Oligonucleotide and antibody conjugates can be directly connected by chemical methods, directly connecting the terminal functional groups of the oligonucleotide (such as amine or hydroxyl) with the corresponding functional groups on the antibody (such as carboxyl) through chemical reactions.

[0208] Alternatively, the oligonucleotide and the antibody are linked via a spacer arm. The linker typically contains one or more reactive chemical groups, such as isothiocyanate, N-hydroxysuccinimide ester (NHSester) or maleimide, which can react with lysine residues or cysteine ​​residues on the antibody.

[0209] Affinity probes can also be constructed by linking oligonucleotides with corresponding functional groups to antibodies using click chemistry principles, such as copper-catalyzed azide-alkyne cycloaddition reaction.

[0210] 2. Sample incubation: Add the sample to the affinity probe mixture and incubate at 37°C for 2 hours to allow the target analyte to bind to the antibody in the affinity probe (the two antibody concentrations are 0.1nM and 0.2nM, respectively). The sample volume can be 5 to 50μL.

[0211] 3. Ligation step: Add a ligation mixture to the incubated sample, which contains two circular ligation oligonucleotides (molar ratio of 1:1), ligase, NAD, DTT, etc., and incubate at 45°C for 30 minutes for ligation reaction. The ligase can be T4, T7, Ampligase and other commercially available ligases.

[0212] 4. Exonuclease treatment: After the ligation reaction, add an exonuclease mixture containing exonuclease I and exonuclease III, incubate at 37°C for 30 minutes, and then heat at 80°C for 20 minutes to inactivate the exonucleases to degrade the DNA that has not formed a circular shape.

[0213] 5. qPCR quantification: Add the ligation product after exonuclease treatment to the qPCR mixture (including primer sequence 3, primer sequence 4, probe sequence and qPCR reaction solution), and use real-time qPCR for quantitative analysis. The conditions of qPCR are 95℃ pre-denaturation for 10 minutes, then 95℃ denaturation for 15 seconds, 60℃ extension for 60 seconds, and 40 cycles in total. The detection method can also use dye-based PCR, isothermal amplification, such as RPA, LAMP and other methods that can amplify the signal.

[0214] 6. Data analysis: Convert the Ct values ​​from qPCR to the estimated number of linked molecules and calculate the detection limit.

[0215] Sample incubation buffer formulation: 0.05% goat IgG, 0.1 mg / mL single-stranded salmon sperm DNA, 0.5% BSA, 5 mM EDTA, 0.01% Triton-X100, 0.02% sodium azide, and 0.2% blocking conjugate.

[0216] Antibody diluent formula: 20 mM Tris-HCl, 10 mM EDTA, 0.05 μg / mL biotin, 0.2 mg / mL single-stranded salmon sperm DNA, 0.02% sodium azide and 0.5% PEA conjugate.

[0217] Ligation mixture formula: 20mM Tris-HCl, 1.5mM MgCl 2 , 1.5 mM ATP, 10 mM DTT, T4 ligase, oligonucleotides 1 and 2. Oligonucleotide concentration 1 μM, T4 ligase concentration 7.5 U / reaction.

[0218] Exonuclease mixture formula: 40mM Tris-HCl, 10mM MgCl 2 , 1 mM DTT, 2.5 U / μL exonuclease I and / or exonuclease III.

[0219] Example 1

[0220] 1.1 Methods

[0221] The detection target of this example is glial fibrillary acidic protein, and the antibody used is the antibody developed by Shanghai Bio-Technology Co., Ltd.

[0222] 10 μL clinical plasma samples (added with different concentrations of GFAP, 0.1 pg / mL, 1 pg / mL, 10 pg / mL and 100 pg / mL respectively) were used, and the CK group was a plasma sample without GFAP added, and the experiment was carried out according to the steps in the general method. The probes used in this example are shown in Table 1.

[0223] Table 1

[0224]

[0225]

[0226] Note: The sequences with the same label are the circular complementary regions where the ligation reaction occurs. Probes 1 and 2 are oligonucleotides attached to the antibody.

[0227] Probe 1 is NH 2 The modification is linked to the carboxyl group on the antibody, and probe 2 is linked to the NH 2 The modification was linked to the carboxyl group on the antibody using the Abcam coupling kit ab218260.

[0228] 1.2 Results

[0229] Table 2 Results of GFAP detection by the method of the present invention

[0230] CK 100pg / mL 10pg / mL 1pg / mL 0.1pg / mL Ct 1 NoC 24.6 27.8 31.12 33.74 Ct 2 NoC 24.9 27.55 31.54 33.2 AVE NoC 24.75 27.675 31.33 33.47

[0231] like Figure 2 As shown in Table 2, the method of the present invention can produce a good correlation for gradient dilution samples, with a sensitivity of up to 0.1 pg / mL, which fully meets the needs of clinical diagnosis. At the same time, low-concentration samples are completely unaffected by background signals, and the results are very stable.

[0232] Example 2

[0233] 2.1 Methods

[0234] The inventors explored the effect of oligonucleotides of different lengths on the detection results. The experimental method is as described in the general method, and the detection target is GFAP. The difference between this embodiment and embodiment 1 is that the sequence of oligonucleotide 1 is different. The rest are the same. The lengths of oligonucleotides 1 and 2 in this example are substantially the same.

[0235] 2.2 Results

[0236] Table 3 Detection results using oligonucleotides of substantially the same length

[0237] CK 100pg / mL 10pg / mL 1pg / mL 0.1pg / mL Ct1 39.06 33.94 36.05 37.65 38.01 Ct2 39.71 34.07 35.96 37.77 38.26 AVE 39.385 34.005 36.005 37.71 38.135

[0238] The results are as follows Figure 3 As shown in Table 3, compared with one long and one short oligonucleotide (Example 1), the use of a double long chain ring structure (this embodiment) is easy to produce a secondary structure, and the difficulty of looping and connection increases, and its sensitivity is reduced, which affects the efficiency of subsequent amplification to a certain extent, and there is a risk of non-specific amplification, and the instability of the experimental results increases. Therefore, the length of the oligonucleotide group is one long and one short, or the length of the oligonucleotide chain is shortened within the experimental allowable range, which has better amplification results.

[0239] Comparative Example

[0240] IL-6 was used as the target, 20 μL of plasma samples (0.5 pg / mL, 1 pg / mL, 10 pg / mL and 100 pg / mL of IL-6 were added respectively), CK group was plasma samples without IL-6, antibodies (A21264 and A24913 of Abclonal Company), and the experimental method was as described in the general method. The oligonucleotide sequence connected to the ring using the method of the present invention is as described in Example 1. The sequences used in the comparative example are shown in Table 4.

[0241] Table 4

[0242] name sequence SEQ ID NO: Oligonucleotides TTTCCAGCTTAACACTGCGCGAGAAA 9 Primer 3 GTTGGCAAGATCTACTCCGG 10 Primer 4 TTCTTGGGTGGGAACTTGG 11 Probe ACACTTCAGGACCCATCCAGCTTAACACTG 12

[0243] The results of the method of the present invention are shown in Table 5 and Figure 4 shown.

[0244] Table 5 Detection results of the method of the present invention

[0245] CK 100pg / mL 10pg / mL 1pg / mL 0.5pg / mL Ct 1 NoC 27.84 30.64 33.35 34.5 Ct 2 NoC 27.95 30.89 33.65 34.9 AVE NoC 27.895 30.765 33.5 34.7

[0246] The results of the comparative examples are shown in Table 6 and Figure 5 shown.

[0247] Table 6 PLA test results

[0248] CK 100pg / mL 10pg / mL 1pg / mL Ct 1 32.66 26.02 28.97 30.5 Ct 2 33.02 25.79 29.08 30.97 AVE 32.84 25.905 29.025 30.735

[0249] Conventional PLA detection background signals can reach Ct32-34. When the experimental results are not ideal, the signal may be stronger. The experimental background (CK) can be reduced to Ct38 or even no signal by ring detection (i.e., the method of the present invention), effectively reducing the impact of the background on low-concentration signals, and the overall experimental results are more stable. At the same time, removing the interference of background signals can obtain higher sensitivity when detecting low-abundance proteins, and obtain more accurate results in clinical diagnosis.

[0250] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. An antigen detection method, characterized in that: Includes steps: (s1) mixing the sample to be tested with a first antibody and a second antibody, so that the first antibody and the second antibody bind to the target antigen in the sample to be tested to form a first antibody-antigen-second antibody complex, wherein the first antibody is coupled to a first connecting element, and the second antibody is coupled to a second connecting element; (s2) mixing the first antibody-antigen-second antibody complex with a first loop element, a second loop element and a ligase, so that the first linking element coupled to the first antibody complements the terminal bases of the first loop element and the second loop element to form a double-stranded structure, and the second linking element coupled to the second antibody complements the other terminal bases of the first loop element and the second loop element to form a double-stranded structure; There are a first gap and a second gap with a length of ≤1 nt between the first ring element and the second ring element; The first gap and the second gap are connected under the action of ligase to form a circular template; (s3) cutting the linear nucleic acid under the action of an exonuclease to obtain a circular template; and (s4) performing a nucleic acid amplification reaction on the circular template, detecting a signal, and obtaining a detection result; Wherein, the first loop element, the second loop element, the first connecting element and the second connecting element are single-stranded nucleic acids.

2. The method according to claim 1, characterized in that The length of the first loop element is 30-80 nucleotides, preferably 40-60, more preferably 45-60.

3. The method according to claim 1, characterized in that The length of the second loop element is 60-130 nucleotides, preferably 80-120, more preferably 90-110.

4. The method according to claim 1, characterized in that The first connecting element has a structure shown in formula (I): Z0-Z1-Z2-Z3(I); In the formula, Z0 is 0 to 5 nucleotides; Z1 and Z2 are each independently 5 to 15 nucleotides; Z3 is 10 to 30 nucleotides; The second connecting element has a structure shown in formula (II): X0-X1-X2-X3(II); In the formula, X0 is 5 to 15 nucleotides; X1 and X2 are each independently 5 to 15 nucleotides; X3 is 15 to 30 nucleotides; The first annular element has a structure shown in formula (III): Z1'-L1-X1'(III); In the formula, Z1' is complementary to Z1; X1' is complementary to X1; L1 is 20 to 50 nucleotides; The second annular element has a structure shown in formula (IV): Z2'-L2-X2'(IV); Wherein, Z2' is complementary to Z2; X2' is complementary to X2; L2 is 50 to 100 nucleotides.

5. The method according to claim 1, characterized in that In step (s4), in the nucleic acid amplification, the upstream primer spans the first gap and the downstream primer spans the second gap.

6. The method according to claim 1, characterized in that In step (s4), the nucleic acid amplification reaction is selected from the group consisting of PCR, qPCR, dye-based PCR, ddPCR, RPA, or LAMP.

7. An antigen detection system, characterized in that: The antigen detection system comprises: (a) a first antibody and a second antibody, wherein the first antibody and the second antibody specifically bind to a target antigen, and the first antibody is coupled to a first connecting element, and the second antibody is coupled to a second connecting element; (b) a first annular element; (c) a second annular element; Wherein, the definitions of the first connecting element, the second connecting element, the first annular element and the second annular element are as described in claim 4.

8. An antigen detection kit, characterized in that: The kit comprises: (i) a first container and a first antibody and a second antibody located in the first container; the first antibody is coupled to a first connecting element, and the second antibody is coupled to a second connecting element; (ii) a second container and a first annular element and a second annular element located in the second container; Wherein, the definitions of the first connecting element, the second connecting element, the first annular element and the second annular element are as described in claim 4.

9. The antigen detection kit according to claim 8, characterized in that The kit also includes (iii) a third container and a ligase located in the third container; (iv) a fourth container and an exonuclease located in the fourth container.

10. A use of the antigen detection system according to claim 7 or the antigen detection kit according to claim 8, characterized in that: Used to detect antigens in the sample to be tested.

Images