Mutated influenza virus, pharmaceutical composition and application

Abstract

The invention belongs to the field of medicines, and relates to a mutated influenza virus, a pharmaceutical composition and application. Specifically, the invention relates to a replication-deficient influenza virus, a pharmaceutical composition and application. More specifically, the present invention relates to a mutated influenza virus wherein the nucleic acid encoding the HA protein and / or the nucleic acid encoding the NA protein of the influenza virus comprises one or more UAG codons. The replication-deficient influenza virus or the pharmaceutical composition can effectively treat or prevent tumors, and has a good application prospect.

Description

Mutated influenza virus, pharmaceutical composition and use Technical Field

[0001] The present invention belongs to the field of medicine and relates to a mutant influenza virus, a pharmaceutical composition and its use. Specifically, the present invention relates to a replication-deficient influenza virus, a pharmaceutical composition and its use. Background Art

[0002] Influenza viruses are segmented, single-stranded, negative-sense RNA viruses belonging to the Orthomyxovoridae family and the genus Influenzavirus. Based on the antigenic differences in the nucleoprotein (NP) and matrix protein (M), influenza viruses are classified into types A, B, C, and D. Type A influenza virus can infect humans, pigs, horses, and poultry; type B influenza virus infects only humans; type C influenza virus primarily infects humans and pigs; and type D influenza virus is a recently discovered bovine influenza virus. Type A influenza virus contains eight single-stranded, negative-sense RNA segments encoding 11 proteins: three polymerase proteins (PB2, PB1, and PA); the nucleoprotein (NP); the hemagglutinin (HA); the neuraminidase (NA); the matrix protein (M1) and ion channel (M2) encoded by the M gene; and the nonstructural proteins (NS1, NS2), as well as PB1-F2, encoded by the NS gene. Influenza viruses can be divided into different subtypes based on the antigenic differences in their surface structural proteins HA and NA. There are 18 different hemagglutinin subtypes (H1-H18) and 11 neuraminidase subtypes (N1-N11) of influenza A viruses.

[0003] Influenza viruses are typically spherical, with a diameter of 80-120 nm. Two glycoproteins, HA and NA, are distributed on the surface of the virus particles. These glycoproteins vary in morphology and are both antigenic, with a HA to NA ratio of 4-5:1. The M2 ion channel transmembrane protein is also present on the surface of the virus particles, with an M2 to HA ratio of 1:10-100. Beneath the viral envelope lies the matrix layer, composed of the matrix protein M1, which is present at the highest concentration in the virion and forms the backbone of the viral envelope. Within the matrix layer, and linked to the M1 protein, is the ribonucleoprotein (RNP) complex and nonstructural protein 2 (also known as nuclear export protein NEP). The RNP complex is composed of four proteins and RNA: three polymerase proteins (PB1, PB2, and PA) form the RNA-dependent RNA polymerase complex, while the nucleoprotein (NP) surrounds the viral RNA genome.

[0004] Reverse genetics, the process of generating viruses from full-length cDNA copies of viral genomes, is one of the most powerful genetic tools in modern virology. Currently, de novo influenza virus synthesis is primarily achieved by co-transfecting cells with 8-12 plasmids. Among these, the 12-plasmid system is the most widely used for rescuing influenza A viruses. Eight plasmids contain promoters and terminators that encode RNA polymerase I, with cDNAs for each segmented influenza virus genome between the promoters and terminators. Four additional plasmids express four proteins (PA, PB1, PB2, and NP).

[0005] Genetic codon expansion technology is relative to the normal protein translation system. There are a total of 64 triplet codons in nature. In typical organisms, 61 of these codons encode the 20 natural amino acids, while the remaining three codons (UAA, UGA, and UAG) do not encode any amino acids. When the ribosome encounters these codons, normal termination factors terminate protein translation. Normally, each amino acid in an organism has a matching aminoacyl-tRNA synthetase and tRNA, forming a matching system. The matching systems for two amino acids cannot be interchanged. For example, glycine will not be recognized and utilized by the glutamate system, and conversely, glutamate will not be recognized and utilized by the glycine system. Each system exists independently and is extremely rigorous. Therefore, there are 20 corresponding systems in living organisms, corresponding to the 20 amino acids. Genetic codon expansion technology involves independently adding a new system to a living organism, creating a total of 21 systems. In this 21st system, bioorthogonal aminoacyl-tRNA synthetases and tRNAs recognize amber stop codons and artificially designed, synthetic unnatural amino acids (such as NAEK). These unnatural amino acids are then inserted into the amber stop codon's position, effectively increasing the number of codons encoding amino acids from 61 to 62, adding an additional unnatural amino acid and expanding the organism's genetic codon. Amber stop codons can be introduced into any position in the wild-type viral genome through site-directed mutagenesis, allowing the design of viruses containing premature termination codons (PTC viruses). PTC viruses can then undergo normal viral protein translation and replication in cells harboring bioorthogonal aminoacyl-tRNA synthetases and tRNAs in the presence of unnatural amino acids. Therefore, the 21st bioorthogonal system can be used for large-scale production of PTC viruses. However, normal cells do not have bioorthogonal aminoacyl-tRNA synthetases and tRNAs, nor do they have unnatural amino acids. Therefore, the virus can only infect normal cells like a wild-type virus and cannot replicate after infection. It is safe for normal cells. Therefore, the PTC virus can be developed into a live influenza virus vaccine with controllable replication.

[0006] Tumor vaccines aim to utilize tumor cell mutations to produce antigens that are different from autologous cells, and use vaccines to enhance the immune system's recognition of tumor antigens, thereby identifying and eliminating tumor cells. In the past 30 years, tumor vaccines have mainly focused on two aspects of research: 1. Identification of tumor-associated antigens and neoantigens. 2. Research on vaccine vectors, that is, based on existing tumor antigens, studying how to deliver identified tumor antigens and activate tumor immune responses against the antigens. They are mainly divided into the following categories: (1) Tumor cell vaccines, that is, separating tumor cells, artificially inactivating them, obtaining full tumor antigens, and then immunizing patients. The advantage of this method is that it is simple to prepare, and the disadvantage is that the activation of the immune response is weak; (2) Gene vaccines, using gene therapy vectors such as lentivirus and adenovirus to artificially encode a specific tumor antigen. The advantage of this method is that it can selectively select immunogenic and specific antigens for immunization. The disadvantage is that it requires special gene therapy vectors, and the stimulation of the body's immune response is usually weak; (3) Peptide vaccines, based on Predictable tumor antigen epitope amino acid sequence, artificially synthesize a specific amino acid sequence for immunization, and activate immune cells to kill tumors through dendritic cell presentation in vivo. The advantage is that it can be designed for specific tumor antigens, and the cost of chemically synthesized peptides is low. The disadvantage is that the immunogenicity is poor; (4) Dendritic cell vaccine, using the human body's professional antigen presenting cells dendritic cells, loaded with tumor antigens through in vitro culture, and activated the immune system through in vivo transfusion. The advantage is that dendritic cells are autologous cells and are the most important antigen presenting cells with the strongest T cell activation ability. The disadvantage is that dendritic cells are obtained through a method similar to CAR-T preparation, which requires in vitro culture of dendritic cells, which is extremely expensive and has harsh in vitro culture conditions and is not easy to scale up.

[0007] As can be seen from the above technologies, the foundation of tumor vaccine development lies in tumor antigen peptides. Tumor antigen peptides are synthetic peptides of approximately 20 amino acids in length that contain T-cell or B-cell epitopes. Due to their small molecular weight, peptides have limited immunogenicity. Since tumor immunity relies on a strong immune response, research on peptide-based tumor vaccines over the past few decades has primarily focused on improving their immunogenicity.

[0008] Immune checkpoint inhibitors are a new type of tumor immunotherapy with significant clinical efficacy. However, the systemic toxicity caused by their systemic application cannot be ignored. How to deliver immune checkpoint inhibitors specifically to tumor tissues while avoiding systemic toxicity is one of the key research and development directions in this field.

[0009] In recent years, with the continued advancement of research into the tumor immune microenvironment, the concepts of "cold" and "hot" tumor microenvironments have been proposed. "Cold" tumors, defined as those with low immune cell infiltration and poor response to immunotherapy, are currently difficult to treat clinically. Therefore, reversing this "cold" tumor microenvironment could significantly enhance the effectiveness of current tumor immunotherapies and is a key area of ​​research for this approach.

[0010] As far as the present inventors are aware, there has been no report on the use of replication-defective viruses as tumor antigen peptide carriers for the preparation of tumor vaccines.

[0011] Summary of the Invention

[0012] After in-depth research and creative work, the inventors used replication-deficient influenza viruses as carriers, coupled tumor antigen peptides to the influenza virus envelope protein (hemagglutinin) via unnatural amino acids, modified the immune adjuvant CpG on the surface of the influenza virus envelope through membrane insertion technology, and inserted immune checkpoint inhibitor expression genes through influenza virus gene modification. This combined the advantages of tumor antigen peptide vaccines + immune checkpoint inhibitors + tumor microenvironment regulators + active targeting, solving the following problems existing in existing tumor immunotherapy: 1) low immunogenicity of tumor antigen peptides used alone; 2) systemic toxicity of systemic immune checkpoint inhibitors; 3) tumor suppressive immune microenvironment reduces the efficacy of tumor immunotherapy. The following inventions are provided:

[0013] One aspect of the present invention relates to a mutant influenza virus, wherein the nucleic acid encoding the HA protein and / or the nucleic acid encoding the NA protein of the influenza virus comprises one or more (eg, 2-10, 2-5, 2, 3, 4 or 5) UAG codons or TAG codons.

[0014] The mutated influenza virus is an artificially mutated influenza virus.

[0015] In some embodiments of the present invention, in the mutant influenza virus, the encoding nucleic acid codon of the HA protein selected from one or more of the following sites is mutated to a UAG codon:

[0016] C84, S86, S92, S126, E132, P135, G147, K170, K176, N179, S201, I256, S53, K57, K62, I64, A65, L67, K71, or P82.

[0017] In some embodiments of the present invention, the mutant influenza virus, wherein the nucleic acid encoding the PB1 protein, PA protein and / or NP protein of the influenza virus contains one or more (e.g., 2-10, 2-5, 2, 3, 4 or 5) UAG codons or TAG codons.

[0018] In some embodiments of the present invention, the mutant influenza virus has the following coding nucleic acid codons mutated to UAG codons:

[0019] R52 site of PB1 protein,

[0020] R266 site of PA protein,

[0021] and / or

[0022] D101 site of NP protein.

[0023] In some embodiments of the present invention, the mutant influenza virus has the following coding nucleic acid codons mutated to UAG codons:

[0024] The R52 site of the PB1 protein, the R266 site of the PA protein, the S53 site of the HA protein, and the D101 site of the NP protein;

[0025] K33 site of PB2 protein, R266 site of PA protein, S53 site of HA protein and D101 site of NP protein;

[0026] or

[0027] The K33 site of PB2 protein, the R52 site of PB1 protein, the S53 site of HA protein and the D101 site of NP protein.

[0028] In some embodiments of the present invention, the mutated influenza virus is a wild-type influenza virus before mutation; preferably, it is a wild-type influenza virus A / WSN / 1933.

[0029] In some embodiments of the present invention, the mutant influenza virus, wherein:

[0030] The amino acid sequence of the unmutated PB2 protein is identical to the amino acid sequence encoded by SEQ ID NO: 1;

[0031] The amino acid sequence of the unmutated PB1 protein is identical to the amino acid sequence encoded by SEQ ID NO: 2;

[0032] The amino acid sequence of the unmutated PA protein is identical to the amino acid sequence encoded by SEQ ID NO: 3;

[0033] The amino acid sequence of the unmutated HA protein is identical to the amino acid sequence encoded by SEQ ID NO: 4;

[0034] The amino acid sequence of the unmutated NP protein is identical to the amino acid sequence encoded by SEQ ID NO:5;

[0035] The amino acid sequence of the unmutated NA protein is identical to the amino acid sequence encoded by SEQ ID NO: 6;

[0036] The amino acid sequence of the unmutated M protein is identical to the amino acid sequence encoded by SEQ ID NO:7;

[0037] and / or

[0038] The amino acid sequence of the unmutated NS protein is identical to the amino acid sequence encoded by SEQ ID NO:8.

[0039] In some embodiments of the present invention, in the mutant influenza virus, the one or more UAG codons are located upstream of the stop codon.

[0040] In some embodiments of the present invention, in the mutant influenza virus, the amino acids at the positions corresponding to the one or more UAG codons are the same or different non-natural amino acids such as NAEK.

[0041] The present invention also relates to a mutant influenza virus, wherein the following position is mutated to an unnatural amino acid such as NAEK:

[0042] The R52 site of the PB1 protein, the R266 site of the PA protein, the S53 site of the HA protein, and the D101 site of the NP protein;

[0043] K33 site of PB2 protein, R266 site of PA protein, S53 site of HA protein and D101 site of NP protein;

[0044] or

[0045] The K33 site of PB2 protein, the R52 site of PB1 protein, the S53 site of HA protein and the D101 site of NP protein.

[0046] In another aspect, the present invention relates to a recombinant influenza virus, which is obtained by recombining the mutated influenza virus described in any one of the present invention with an exogenous nucleic acid;

[0047] Preferably, the exogenous nucleic acid is inserted into the nucleic acid of PB2, PB1 or PA;

[0048] Preferably, the exogenous nucleic acid is a nucleic acid encoding an anti-tumor antibody;

[0049] Preferably, the anti-tumor antibody is an anti-PD-1 antibody, an anti-PD-L1 antibody and / or an anti-CTLA-4 antibody;

[0050] Preferably, the anti-tumor antibody is a nanobody, a single-chain antibody, a monoclonal antibody or a bispecific antibody;

[0051] Preferably, the anti-tumor antibody is an anti-PD-1 nanobody or an anti-CTLA-4 nanobody;

[0052] Preferably, the amino acid sequence of the anti-PD-1 nanobody is as shown in SEQ ID NO: 9;

[0053] Preferably, the amino acid sequence of the anti-CTLA-4 nanobody is as shown in SEQ ID NO:10.

[0054] Amino acid sequence of anti-PD-1 nanobody 5dxw:

[0055]

[0056] Amino acid sequence of anti-CTLA-4 nanobody 5e03:

[0057]

[0058] Another aspect of the present invention relates to a modified influenza virus, wherein one or more anti-tumor antigenic peptides are linked to the surface of the mutant influenza virus or the recombinant influenza virus according to any one of the present invention.

[0059] In some embodiments of the present invention, the modified influenza virus, wherein the antigenic peptide is linked to the hemagglutinin protein (HA) or NA on the surface of the virus; preferably, it is linked to an unnatural amino acid such as NAEK in the HA protein or NA protein.

[0060] In some embodiments of the present invention, the modified influenza virus, wherein the antigenic peptide is linked to the non-natural amino acid of the HA protein in the form of any compound selected from the group consisting of compounds represented by Formula III-1 to Formula III-6:

[0061]

[0062]

[0063] In some embodiments of the present invention, in the modified influenza virus, the amino acid sequence of the antigenic peptide is independently selected from any one of SEQ ID NOs: 49-55.

[0064] The click reaction is an efficient, rapid, orthogonal reaction between azide and compounds containing alkyne bonds. By modifying an exogenous antigen peptide with an alkyne-containing group, the present invention enables a click reaction with the azide group on the viral surface hemagglutinin protein (HA), thereby achieving covalent modification.

[0065] In some embodiments of the present invention, the modified influenza virus has 100-500 antigenic peptides coupled to one virus particle, preferably 200-400 antigenic peptides, more preferably 250-350 antigenic peptides or 300 antigenic peptides.

[0066] In some embodiments of the present invention, the modified influenza virus further has a CpG adjuvant attached to its surface;

[0067] Preferably, the sequence of the CpG adjuvant is shown in SEQ ID NO: 20 (TCCATGACGTTCCTGACGTT);

[0068] Preferably, the CpG adjuvant is attached to the virus surface in the form of a compound represented by formula IV,

[0069]

[0070] Wherein, "TCCATGACGTTCCTGACGTT" (SEQ ID NO: 20) in Formula IV is a CpG adjuvant.

[0071] Another aspect of the present invention relates to a pharmaceutical composition comprising the mutant influenza virus, the recombinant influenza virus and / or the modified influenza virus according to any one of the present invention;

[0072] Optionally, the pharmaceutical composition further comprises one or more pharmaceutically acceptable excipients;

[0073] Preferably, the pharmaceutical composition is a vaccine composition;

[0074] Preferably, the vaccine composition is an anti-tumor vaccine composition;

[0075] Preferably, the tumor is selected from primary lung tumors and lung metastatic tumors;

[0076] Preferably, the tumor is selected from one or more of lung cancer (small cell lung cancer or non-small cell lung cancer), melanoma lung metastasis, breast cancer lung metastasis and colon cancer lung metastasis.

[0077] Another aspect of the present invention relates to use of the mutant influenza virus, the recombinant influenza virus and / or the modified influenza virus according to any one of the present invention in the preparation of a medicament for treating or preventing tumors;

[0078] Preferably, the tumor is selected from primary lung tumors and lung metastatic tumors;

[0079] Preferably, the tumor is selected from one or more of lung cancer (small cell lung cancer or non-small cell lung cancer), melanoma lung metastasis, breast cancer lung metastasis and colon cancer lung metastasis.

[0080] Another aspect of the present invention relates to a method for treating or preventing tumors, comprising the step of administering to a subject in need thereof an effective amount of the mutated influenza virus, the recombinant influenza virus and / or the modified influenza virus described in any one of the present invention;

[0081] Preferably, the tumor is selected from primary lung tumors and lung metastatic tumors;

[0082] Preferably, the tumor is selected from one or more of lung cancer (small cell lung cancer or non-small cell lung cancer), melanoma lung metastasis, breast cancer lung metastasis and colon cancer lung metastasis.

[0083] The mutated influenza virus, the recombinant influenza virus and / or the modified influenza virus according to any one of the present invention, for use in treating or preventing tumors;

[0084] Preferably, the tumor is selected from primary lung tumors and lung metastatic tumors;

[0085] Preferably, the tumor is selected from one or more of lung cancer (small cell lung cancer or non-small cell lung cancer), melanoma lung metastasis, breast cancer lung metastasis and colon cancer lung metastasis.

[0086] Another aspect of the present invention relates to a plasmid-based influenza virus reverse genetics system comprising:

[0087] (1) 8 recombinant plasmids containing PB2 gene, PB1 gene, PA gene, HA gene, NP gene, NA gene, M gene and NS gene, respectively; and

[0088] (2) four additional recombinant plasmids containing the PB2 gene, PB1 gene, PA gene, and NP gene, respectively;

[0089] The vector used in the recombinant plasmid in (2) is different from the vector used in the recombinant plasmid in (1); and the PB2 gene, PB1 gene, PA gene and NP gene in (2) are wild type;

[0090] The HA gene and / or the NA gene contains one or more (eg, 2, 3, 4 or 5) TAG codons.

[0091] In some embodiments of the present invention, in the plasmid-based influenza virus reverse genetics system, the nucleic acid codons encoding one or more of the following sites in the HA gene are mutated to TAG codons:

[0092] C84, S86, S92, S126, E132, P135, G147, K170, K176, N179, S201, I256, S53, K57, K62, I64, A65, L67, K71, or P82.

[0093] In some embodiments of the present invention, the plasmid-based influenza virus reverse genetics system, wherein the PB1 gene, PA gene and / or NP gene in (1) contains one or more (eg, 2, 3, 4 or 5) TAG codons.

[0094] In some embodiments of the present invention, in the plasmid-based influenza virus reverse genetics system, the nucleic acid codons encoding the following sites are mutated to TAG codons:

[0095] R52 site of PB1 protein,

[0096] R266 site of PA protein,

[0097] and / or

[0098] D101 site of NP protein.

[0099] In some embodiments of the present invention, in the plasmid-based influenza virus reverse genetics system, the nucleic acid codons encoding the following sites are mutated to TAG codons:

[0100] The R52 site of the PB1 protein, the R266 site of the PA protein, the S53 site of the HA protein, and the D101 site of the NP protein;

[0101] K33 site of PB2 protein, R266 site of PA protein, S53 site of HA protein and D101 site of NP protein;

[0102] or

[0103] The K33 site of PB2 protein, the R52 site of PB1 protein, the S53 site of HA protein and the D101 site of NP protein.

[0104] In some embodiments of the present invention, in the plasmid-based influenza virus reverse genetics system, the influenza virus is a wild-type influenza virus before mutation; preferably, it is a wild-type influenza virus A / WSN / 1933.

[0105] In some embodiments of the present invention, the plasmid-based influenza virus reverse genetics system, wherein:

[0106] The nucleic acid sequence of the unmutated PB2 gene is shown in SEQ ID NO: 1;

[0107] The nucleic acid sequence of the unmutated PB1 gene is shown in SEQ ID NO: 2;

[0108] The nucleic acid sequence of the unmutated PA gene is shown in SEQ ID NO: 3;

[0109] The nucleic acid sequence of the unmutated HA gene is shown in SEQ ID NO: 4;

[0110] The nucleic acid sequence of the unmutated NP gene is shown in SEQ ID NO: 5;

[0111] The nucleic acid sequence of the unmutated NA gene is shown in SEQ ID NO: 6;

[0112] The nucleic acid sequence of the unmutated M gene is shown in SEQ ID NO: 7;

[0113] and / or

[0114] The nucleic acid sequence of the unmutated NS gene is shown in SEQ ID NO:8.

[0115] In some embodiments of the present invention, in the plasmid-based influenza virus reverse genetics system, the one or more TAG codons are located upstream of the stop codon.

[0116] In some embodiments of the present invention, in the plasmid-based influenza virus reverse genetics system, the amino acids at the sites corresponding to the one or more TAG codons are the same or different non-natural amino acids such as NAEK.

[0117] Another aspect of the present invention relates to an influenza virus rescued by any one of the plasmid-based influenza virus reverse genetics systems of the present invention.

[0118] In the present invention, the term "armed influenza virus" refers to the modification of influenza virus envelope protein by chemical means or the transformation of influenza virus genome by genetic engineering means, so that it has special properties that wild-type influenza virus does not have.

[0119] In the present invention, the term "bioorthogonal reaction" refers to a chemical reaction that can be carried out in living cells or tissues without interfering with the biochemical reactions of the organism itself.

[0120] In the present invention, the term "click chemistry reaction" refers to the rapid and reliable completion of chemical synthesis reactions of various molecules by splicing small units.

[0121] In the present invention, the term "nanobody" comprises only one heavy chain variable region (VHH) and is the smallest unit known to bind to a target antigen.

[0122] In the present invention, the term "bioorthogonal aminoacyl-tRNA synthetase" is derived from archaea and has been artificially evolved. It cannot recognize natural amino acids but can recognize unnatural amino acids such as NAEK.

[0123] The structural formula of NAEK is shown in Formula V below.

[0124]

[0125] The present invention overcomes the shortcomings of low autoimmunogenicity of tumor antigen peptide vaccines, the shortcomings of systemic side effects of immune checkpoint inhibitors, and the problem of pathogenicity of influenza virus as an oncolytic virus.

[0126] The present invention is applied to tumor treatment, especially the treatment of lung tumors and lung metastatic tumors, and can be used in combination with other tumor immunotherapies.

[0127] Advantageous Effects of the Invention

[0128] The present invention achieves one or more of the following technical effects:

[0129] 1) The replication-deficient influenza virus is a new type of influenza virus vaccine independently developed by our team and has good safety.

[0130] 2) The influenza virus itself is a single-stranded negative-strand RNA virus and a natural mRNA vaccine vector. The present invention utilizes the influenza virus to deliver nanoantibodies that can encode anti-pdl1.

[0131] 3) The present invention utilizes a non-natural amino acid system to couple tumor antigen peptides to the surface of influenza viruses through a bioorthogonal reaction, thereby delivering tumor antigens to the lungs through the respiratory tract. This is particularly useful for treating lung tumors and lung metastases, and has a natural targeting advantage.

[0132] 4) This discovery takes advantage of the immunogenicity of the influenza virus itself to change the tumor microenvironment and can be used in conjunction with multiple tumor immunotherapies to enhance the effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0133] Figure 1: Using Glcui as an example to verify the expression efficiency of exogenous genes inserted into viral genes with different truncations (PB1, PB2, PA).

[0134] Figure 2A: Fluorescent western blot analysis confirmed that exogenous peptides can be covalently coupled to the hemagglutinin protein of replication-defective influenza virus.

[0135] Figure 2B: Confocal laser scanning microscopy confirmed that CpG can be anchored on influenza virus.

[0136] Figure 3: Laser confocal microscopy verified that P1-OVA1-FITC can promote the internalization and presentation of antigen peptides by dendritic cells.

[0137] Figure 4A: Efficiency of antigen presentation after processing by dendritic cells in different drug-dosing groups.

[0138] Figure 4B: The degree of dendritic cell activation in different drug administration groups was verified by the expression of dendritic cell surface markers.

[0139] Figure 4C: The degree of dendritic cell activation in different drug administration groups was verified by the secretion of cytokines by dendritic cells.

[0140] Figure 5A: Immunofluorescence images of mouse lungs after intranasal administration.

[0141] Figure 5B: Statistics of fluorescence intensity of antigenic peptides in mouse lungs after nasal administration.

[0142] Figure 5C: Statistics of CpG adjuvant fluorescence intensity in mouse lungs after nasal administration.

[0143] Figure 6A: Analysis of antigen-carrying dendritic cells in the lungs and lymph nodes of mice after intranasal administration.

[0144] Figure 6B: Analysis of changes in immune cells in mouse lungs after nasal administration.

[0145] Figure 6C: Analysis of antigen-specific T lymphocytes in the lungs and spleens of mice after intranasal administration.

[0146] Figure 7A: Analysis of antibody levels in mouse serum after intranasal administration.

[0147] Figure 7B: Analysis of antibody levels in lung lavage fluid of mice after nasal administration.

[0148] Figure 8A: Photographs of the effects of pre-immunized mice against melanoma lung metastasis.

[0149] Figure 8B: Statistical graph of the effect of pre-immunized mice against melanoma lung metastasis.

[0150] Figure 8C: Statistics of lung antigen-specific T cell content in a melanoma lung metastasis model in pre-immunized mice.

[0151] Figure 9A: Flowchart of vaccine administration for therapeutic experiments.

[0152] Figure 9B: Statistics of the proportions of different immune cells in tumor tissues.

[0153] Figure 9C: Fluorescent sections of infiltrating T cells in tumor tissue.

[0154] Figure 9D: Statistics of the proportions of memory T cells and tissue-resident T cells after drug administration.

[0155] FIG10A : Gel electrophoresis confirmed that the 5dxw or 5e03 fragments can be packaged into influenza virus.

[0156] Figure 10B: Western blot confirmed that cells infected with P15dxw-OVA1 or P15e03-OVA1 can secrete 5dxw or 5e03.

[0157] FIG10C : Fluorescence sections confirm that P15dxw-OVA1 or P15e03-OVA1 infected the lungs and secreted antibodies after nasal administration.

[0158] Figure 11A: Small animal imaging of melanoma lung metastasis treated with nasal drug delivery.

[0159] Figure 11B: Statistics of fluorescence intensity of lung tumors.

[0160] Figure 11C: Survival rate curve of mice after treatment.

[0161] Figure 11D: Immunohistochemical analysis of T cell infiltration in the lungs of tumor-bearing mice.

[0162] Figure 11E: Analysis of immune cells in the lungs, peripheral blood, and spleen of tumor-bearing mice.

[0163] FIG12A : Validation of the therapeutic effect of P15dxw-4T1 in a mouse 4T1 breast cancer lung metastasis model.

[0164] FIG12B : Verification of the therapeutic effect of P15dxw-CT26 in the mouse CT26 colon cancer lung metastasis model.

[0165] FIG13A : Experimental flow chart for verifying the therapeutic effect of P15dxw-B16 on distal tumors.

[0166] Figure 13B: Imaging of animals with distal tumors treated with P15dxw-B16.

[0167] FIG. 13C : Tumor size statistics of distal tumors treated with P15dxw-B16.

[0168] Figure 13D: Photograph of distal tumor treated with P15dxw-B16.

[0169] FIG13E : Survival curves of mice bearing distal tumors treated with P15dxw-B16.

[0170] Figure 13F: Statistics of intratumoral antigen-specific T cells in the P15dxw-B16 treatment of distal tumors.

[0171] Figure 14A: Using P15dxw-OVA1 as an example, it was verified that the vaccine can only replicate in transgenic cells and in the presence of unnatural amino acids.

[0172] Figure 14B: By monitoring the weight of immunized mice, it was verified that P15dxw-OVA1 or P1-OVA1 is absolutely safe compared to the wild-type virus.

[0173] FIG14C : Safety of P15dxw-OVA1 or P1-OVA1 was demonstrated by pulmonary edema in mice.

[0174] FIG14D shows the H&E staining results of various tissues in different drug-administered groups.

[0175] The partial sequences involved in the present invention are as follows:

[0176] PB2

[0177]

[0178]

[0179] PB1

[0180]

[0181]

[0182] PA

[0183]

[0184]

[0185] HA

[0186]

[0187]

[0188] NP

[0189]

[0190] NA

[0191]

[0192]

[0193] M

[0194]

[0195] NS

[0196]

[0197] PB2-Gluci

[0198]

[0199]

[0200] PB1-Gluci

[0201]

[0202]

[0203]

[0204] PA-Gluci

[0205]

[0206]

[0207] PB2-5dxw

[0208]

[0209]

[0210] PB1-5dxw

[0211]

[0212]

[0213] PA-5dxw

[0214]

[0215]

[0216]

[0217] PB2-5e03

[0218]

[0219]

[0220] PB1-5e03

[0221]

[0222]

[0223] PA-5e03

[0224]

[0225] DETAILED DESCRIPTION

[0226] The embodiments of the present invention will be described in detail below with reference to the examples, but it will be understood by those skilled in the art that the following examples are merely illustrative of the present invention and should not be construed as limiting the scope of the invention. Where specific conditions are not specified in the examples, the methods were performed according to conventional conditions or the conditions recommended by the manufacturer. Where the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be obtained commercially.

[0227] Preparation Example 1: Construction of influenza virus gene vector containing site-directed mutagenesis

[0228] (1) Construction of plasmids for rescuing wild-type influenza virus WSN (the wild-type virus corresponding to PTC virus is A / WSN / 1933, abbreviated as WSN)

[0229] Based on the gene sequence of influenza virus A / WSN / 1933 published in PubMed, genes for each gene segment of this influenza virus were obtained through complete gene synthesis. The sequences of each influenza virus gene are shown in SEQ ID NOs: 1-8. These genes were then ligated into pHH21, pCDNA 3(neo), or pcAAGGS / MCS vectors to obtain 12 plasmids that rescue wild-type influenza virus WSN. The names and compositions of the obtained plasmids are shown in Table 1.

[0230] Table 1

[0231] Plasmid name Vector used Key gene restriction site Key gene sequence number Ben1PHH21PB2BsmBISEQ ID NO:1Ben2PHH21PB1BsmBISEQ ID NO:2Ben3PHH21PABsmBISEQ ID NO:3Ben4PHH21HABsmBISEQ ID NO:4Ben5PHH21NPBsmBISEQ ID NO:5Ben6PHH21NABsmBISEQ ID NO:6Ben7PHH21MBsmBISEQ ID NO:7Ben8PHH21NSBsmBISEQ ID NO:8Ben9pcDNA3(neo)PB2EcoRISEQ ID NO:1Ben10pcDNA3(neo)PB1EcoRISEQ ID NO:2Ben11pcDNA3(neo)PAEcoRISEQ ID NO:3Ben12pcAGGS / MCSNPEcoRISEQ ID NO:5

[0232] (2) Design of site-directed mutagenesis sites

[0233] Amino acid sites that are highly conserved and will not revert to mutations were selected for mutation on the PB2, PB1, PA, and NP proteins. Based on the resolved crystal structure of the influenza virus HA protein (PDB: 1RVT), amino acid sites close to the solvent side of the protein were selected for mutation. The mutation sites selected on each protein are shown in Table 2.

[0234] Table 2

[0235] Plasmid name Amino acid site Plasmid name Amino acid site Ben1-1K33 Ben4-9C84 Ben2-1R52 Ben4-10S86 Ben3-1R266 Ben4-11S92 Ben5-1D101 Ben4-12S126 Ben4-1S53 Ben4-13E132 Ben4-2K57 Ben4-14P135 Ben4-3K62 Ben4-15G147 Ben4-4I64 Ben4-16K170 Ben4-5A65 Ben4-17K176 Ben4-6L67 Ben4-18N179 Ben4-7K71 Ben4-19S201 Ben4-8P82 Ben4-20I256

[0236] (3) Construction of mutation vector

[0237] Ben2, Ben3, Bne4, and Ben5 were used as plasmid templates and site-directed mutagenesis kit ( Lightning Site-Directed Mutagenesis Kits (Catalog #210518) were used to mutate the amino acid codons at selected sites on each protein to the amber stop codon, TAG, according to the manufacturer's instructions. Sequencing confirmed the successful mutation. The constructed mutation vectors are shown in Table 2.

[0238] Preparation Example 2: Construction of influenza virus gene vector containing foreign genes

[0239] (1) Construction of Ben1-Gluci, Ben2-Gluci, and Ben3-Gluci plasmids

[0240] Taking Ben1-Gluci as an example, the construction process of Ben1-Gluci, Ben2-Gluci, and Ben3-Gluci is described. The Ben1 vector is subjected to reverse PCR using the pHH21-F and pHH21-R primers in Table 3 by a high-fidelity PCR enzyme (NEB, M0541S), and a linearized vector is obtained after gel recovery. The PB2 gene of influenza virus A / WSN / 1933 is used as a template, and the Gaussia luciferase sequence (abbreviated as Gluci) is inserted into its C-terminus, and the sequence is synthesized by BGI. The synthesized PB2-Gluci sequence (SEQ ID NO: 11) is subjected to PCR using the PB2-Gluci-F and PB2-Gluci-R primers in Table 3, and then gel recovery is performed to obtain a PB2-Gluci sequence with homology arms. The sequence is then homologously recombined with the linearized vector under the action of a homologous recombinase (Bomade, CL117), transformed, single cloned, and shaken. After sequencing the bacterial liquid sample, it was compared with the whole genome sequence to screen out the positive monoclonal PB2-Gluci plasmid Ben1-Gluci with a reliable sequence. Finally, the plasmid was extracted using an endotoxin-free plasmid extraction kit (Promega, A2393). The obtained plasmid can be used to rescue the recombinant virus.

[0241] Similarly, using the PB1 and PA genes of influenza virus A / WSN / 1933 as templates, Ben2-Gluci and Ben3-Gluci plasmids were constructed and extracted according to the above method, as shown in Table 6.

[0242] Table 3

[0243]

[0244] (2) Construction of Ben1-5dxw, Ben2-5dxw, and Ben3-5dxw plasmids

[0245] Taking Ben1-5dxw as an example, the construction process of Ben1-5dxw is described. Using the aforementioned synthesized Ben1-Gluci as a vector template, reverse PCR is performed using the pHH21-Ben1-F and pHH21-Ben1-R primers in Table 4 by high-fidelity PCR enzyme, and the linearized vector is obtained after gel recovery. Subsequently, the nucleic acid sequence of the nanobody 5dxw is synthesized by BGI (the amino acid sequence is shown in SEQ ID NO: 9, 5dxw is the PDB (protein data bank) number of a protein crystal, which is itself a nanobody against mouse PD-L1 protein, a reported antibody for anti-tumor use), and PCR and gel recovery are performed using the PB2-5dxw-F and PB2-5dxw-R primer pairs in Table 2 to obtain a sequence with a homology arm. Then, homologous recombination is performed with the linearized vector under the action of the homologous recombinase, transformation is carried out, single clones are picked, and bacteria are shaken. After sequencing the bacterial liquid sample, the positive monoclonal Ben1-5dxw plasmid with a reliable sequence was screened out. Finally, the plasmid was extracted using an endotoxin-free plasmid extraction kit, and the obtained plasmid can be used to rescue the recombinant virus.

[0246] Similarly, using Ben2-Gluci and Ben3-Gluci plasmids as vector templates and following the construction method of Ben1-5dxw, Ben2-5dxw and Ben3-5dxw plasmids were constructed as shown in Table 6.

[0247] Table 4

[0248] Primer name Primer sequence (primer 5'-3') SEQ ID

[0249] NO:pHH21-Ben1-Fgcgaaaggagagaaggctaatgtg29pHH21-Ben1-Rgggcccagggttctcctc30PB2-5dxw-Ftggaggagaaccctgggcccatggagacagacaccctg31PB2-5 dxw-Rttagccttctctcctttcgcttacaggtcctcctcgctg32pHH21-Ben2-Ftaatccagagcccgaattgatgc33pHH21-Ben2-Rgggcccagggttctcctc34PB1-5dxw-Ftgga ggagaaccctgggcccatggagacagacaccctg35PB1-5dxw-Rgcatcaattcgggctctggattacaggtcctcctcgctg36pHH21-Ben3-Ftaagaacctgggacctttgatcttgg37pH H21-Ben3-Rgggcccagggttctcctc38PA-5dxw-Ftggaggagaaccctgggcccatggagacagacaccctg39PA-5dxw-Ragatcaaaggtcccaggttcttacaggtcctcctcgctg40

[0250] (3) Construction of Ben1-5e03, Ben2-5e03, and Ben3-5e03 plasmids

[0251] According to the plasmid construction method in (2) above, the primers in Table 5 were used to replace the 5dxw sequence with the 5e03 sequence (SEQ ID NO: 10, 5e03 is the PDB (protein data bank) number of a protein crystal, which itself is a nanobody against mouse CTLA-4 protein, a reported antibody used for anti-tumor purposes), thereby constructing the Ben1-5e03 / Ben2-5e03 / Ben3-5e03 series of plasmids as shown in Table 6.

[0252] Table 5

[0253]

[0254] Table 6

[0255] Plasmid name Vector Key gene Key gene number Ben1-GluciPHH21PB2-GluciSEQ ID NO:11Ben2-GluciPHH21PB1-GluciSEQ ID NO:12Ben3-GluciPHH21PA-GluciSEQ ID NO:13Ben1-5dxwPHH21PB2-5dxwSEQ ID NO:14Ben2-5dxwPHH21PB1-5dxwSEQ ID NO:15Ben3-5dxwPHH21PA-5dxwSEQ ID NO:16Ben1-5e03PHH21PB2-5e03SEQ ID NO:17Ben2-5e03PHH21PB1-5e03SEQ ID NO:18Ben3-5e03PHH21PA-5e03SEQ ID NO:19

[0256] Preparation Example 3: Preparation of replication-deficient influenza virus capable of delivering exogenous genes

[0257] (1) According to the normal method of rescuing influenza virus, the 12 plasmids used for rescuing influenza virus (see Table 1) were transfected with a plasmid capable of stably expressing tRNA (tRNA Pyl ) and pyrrolysyl-RNA synthetase (tRNA Pyl The HEK293-PYL stable mammalian cell line ( Longlong Si et al., Generation of influenza A viruses as live but replication-incompetent virus vaccines science, 2016, 6316, 1170-1173 ) was used to replace the corresponding plasmids in the 12 plasmids with plasmids containing site-directed mutagenesis and plasmids containing the exogenous gene (or wild-type plasmid). 0.1 μg of each plasmid was added to each well of a six-well plate. Six hours after transfection, the culture medium was replaced with fresh culture medium containing 1% FBS, 2 μg / ml TPCK-trypsin, and 1 mM of the unnatural amino acid Nε-2-azidoethyloxycarbonyl-L-lysine (NAEK). Culture medium without the unnatural amino acid served as a control. Cell pathology was observed. Mutants that exhibited pathology in cells cultured with the unnatural amino acid medium but not in cells cultured without it were considered positive mutants.

[0258] As an example, Ben1-Gluci, Ben2-1, Ben3-1, Ben4-1, Ben5-1, Ben6, Ben7, Ben8, Ben9, Ben10, Ben11 and Ben12 were co-transfected into HEK293-PYL, thereby rescuing influenza viruses containing the Gaussia luciferase expression gene (Gluci) after the PB2 gene segment, and a replication-deficient influenza virus in which the packaging exogenous gene of TAG was introduced at the corresponding sites of the PB1, PA, NP and HA gene segments.

[0259] (2) When the stable cell line of the rescued virus is completely diseased, collect the cell supernatant, centrifuge at 5000g for 10 minutes, take the supernatant and filter it through a 0.45μm filter membrane; 5 Centrifuge at 4000 × g for 2 h, resuspend the precipitate in 1 ml PBS; add 20% sucrose solution to a 15 ml centrifuge tube, drop the PBS resuspended solution onto the sucrose solution, and 11x10 4 g centrifugation for 2 h; add 15 ml PBS to the above precipitate, 11x10 4 Centrifuge at 4°C for 2 h, and resuspend the precipitate in PBS.

[0260] Some combinations that can rescue the virus and are dependent on non-natural amino acids were screened out. As shown in Table 7, the results show that when the PB2 gene segment is introduced into Gluci, the four sites Ben2-1, Ben3-1, Ben4-1, and Bne5-1 have the highest virus rescue efficiency. When the PB1 gene segment is introduced into Gluci, the four sites Ben1-1, Ben3-1, Ben4-1, and Bne5-1 have the highest virus rescue efficiency. When the PA gene segment is introduced into Gluci, the four sites Ben1-1, Ben2-1, Ben4-1, and Bne5-1 have the highest virus rescue efficiency, which is a more ideal combination. The inventors compared the expression levels of Gluci in cells infected with the replication-deficient influenza virus containing the Glcui gene rescued by the above three combinations. The results are shown in Figure 1. When the PB2 gene is inserted into an exogenous gene such as the Glcui reporter gene, the expression efficiency is the highest.

[0261] Table 7

[0262]

[0263]

[0264] Table 7 Description: Taking the packaging of P1Glcui-1 virus as an example, among the 5 plasmids listed, Ben2-1, Ben3-1, Ben4-1, and Bne5-1 are plasmids for introducing tags (see Table 2), Ben1-Gluci is a plasmid for introducing Gluci by truncation at PB2 (see Table 6), and the other 7 plasmids are wild-type plasmids for the remaining packaging viruses, namely Ben6, Ben7, Ben8, Bne9, Bne10, Ben11 and Ben12.

[0265] Similarly, according to the preparation method of P1Gluci-1, the Ben1-Gluci plasmid is replaced with the Ben1-5dxw plasmid or the Ben1-5e03 plasmid when rescuing the virus to obtain the replication-defective influenza virus P15dxw or P15e03 that can express nanobodies.

[0266] Preparation Example 4: Preparation of Armed Influenza Virus Tumor Vaccine

[0267] The compound of formula I was purchased from Shanghai Taopu Biotechnology Co., Ltd., and the compound of formula II was purchased from Sangon Biotechnology Co., Ltd. OVA1 in the compound of formula I is an amino acid sequence, and the specific amino acid sequence is shown in Table 8.

[0268]

[0269] CpG adjuvants typically refer to the sequence TCCATGACGTTCCTGACGTT (SEQ ID NO: 20) (as included in Formula II). The modified group (cholesterol) on the left side of this sequence facilitates anchoring of the CpG adjuvant to the viral envelope. A fluorescent group is located on the right side of this sequence, which is used to subsequently verify the adjuvant's anchoring to the viral envelope. CpG adjuvants are TLR9 agonists and are commonly used in vaccines to enhance the function of DCs.

[0270] If not otherwise specified, CpG or CpG adjuvant in this embodiment refers to chemically modified CpG (ie, compound of formula II).

[0271] Feasibility verification of covalent coupling of replication-defective influenza virus with tumor antigen peptide and insertion modification of immune adjuvant membrane. Taking the packaged virus P1-1 in Table 7 as an example, 10 8P1-1 at pfu / ml was mixed with the compound of formula I and the compound of formula II containing the OVA1 sequence in Table 8, and click chemistry reaction and membrane insertion modification were performed to obtain a final concentration of 100 μM for the compound of formula I and 10 μM for the compound of formula II. The reaction was carried out at 4°C while gently shaking for 2 hours. Unreacted compounds of formula I and formula II were then removed by size exclusion chromatography (HiTrap Capto Core 700, GE Healthcare). The viral particle elution peak was collected using a 100KDa centrifugal filter unit (Millipore), concentrated, and buffer exchanged into PBS buffer. The carbon-carbon triple bond in the structure of formula I reacts with the azide on the non-natural amino acid NAEK on the virus by click reaction, and the connection mode of formula I is shown below. Formula II is inserted into the viral cell membrane through cholesterol.

[0272]

[0273] In the above reaction, NAEK already exists in an amino acid sequence, where the two wavy lines They represent the carboxyl terminus of the preceding amino acid and the amino terminus of the following amino acid, respectively.

[0274] Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions was used to examine the conjugation of OVA1 to the influenza virus HA protein using fluorescence imaging, as shown in Figure 2A. Confocal imaging was used to verify that CpG was anchored to the influenza virus cell membrane (the infected cells were the lung tumor cell line A549, which mimics the lung), as shown in Figure 2B. The resulting virus was named P1-OVA1-FITC.

[0275] Since the right side of the compound of formula I and the compound of formula II both have a fluorescent group, the main purpose of this experiment is to verify that small peptides and CpG can be loaded onto the surface of the virus. In actual application, fluorescent groups cannot be contained. Preferably, the compound of formula III-1, formula III-2, formula III-3, formula III-4, formula III-5, or formula III-6 is used to replace the compound of formula I; and the compound of formula IV is used to replace the compound of formula II. Preferably, the antigenic peptides (tumor antigen peptides) in the compounds of formula III-1 to formula III-6 are selected from the antigenic peptides in Table 8.

[0276]

[0277]

[0278] Compounds of formula III-1 to formula III-6 (used to load antigen peptides) are coupled to the hemagglutinin protein containing an azide group on the surface of the virus through a click reaction. Currently, there are many groups that react with azide. Compounds of formula III-1 to formula III-6 only list two reactive groups and two connection methods: N-terminus and C-terminus.

[0279] The compound of formula IV is the compound of formula II minus the fluorescent group. Replacing formula II with formula IV can prepare armed influenza virus tumor vaccines, which are named P1-OVA1, P1-OVA2, P1-B16, P1-CT26, and P1-4T1, respectively.

[0280] Similarly, P15dxw or P15e03 virus particles were modified with antigen peptides and CpG using the above method to prepare armed influenza virus tumor vaccines carrying anti-PDL1 (5dxw) nanoantibody genes and anti-CTLA4 (5e03) nanoantibody genes, which were named P15dxw-OVA1, P15dxw-OVA2, P15dxw-B16, P15dxw-CT26, P15dxw-4T1, P15e03-OVA1, P15e03-OVA2, P15e03-B16, P15e03-CT26 and P15e03-4T1, respectively.

[0281] Table 8

[0282]

[0283]

[0284] Effect Example 1: Armed influenza virus enhances dendritic cell (DC) function assay

[0285] The inventors co-cultured P1-OVA1-FITC with mouse bone marrow-derived dendritic cells (BMDCs), took cells at different culture time points, stained them for lysosomes, and used laser confocal microscopy to observe the distribution of FITC-labeled OVA1 antigen peptide sequences in the cells. Specifically: immature BMDC cells were adjusted to 10 with 1640 complete medium (1640 medium supplemented with 10% fetal bovine serum, 20ng / ml GM-CSF, and 10ng / ml IL-4). 6 Cells / well were plated in 12-well plates and cultured at 37°C, 5% CO2 for 24 hours. Then, a mixture of 100 nM CpG and 3 μM small peptide or P1-OVA1-FITC at an MOI of 100 was added. After culturing under the same culture conditions for 6 hours or 24 hours, the cultured cells were taken out for lysosomal staining and imaged using a laser confocal microscope to observe the distribution of the FITC-labeled OVA1 antigen peptide sequence in the cells.

[0286] Different drugs were added during the culture process, as shown in Figure 4A, there are six groups 1, 2, 3, 4, 5, and 6, 1 is the PBS control group without drugs; 2 is the group with 3 μM small peptide added; 3 is the group with MOI = 100 added to P1-1; 4 is the group with 100 nM CpG added; 5 is the group with a mixture of 3 μM small peptide, 100 nM CpG, and P1-1 with MOI = 100 added at the same time; 6 is the group with MOI = 100 added to P1-OVA1.

[0287] The results are shown in Figure 3. After 6 hours of culture, more green fluorescence signals were observed in the P1-OVA1-FITC group compared to the control group (FITC-modified OVA1 sequence peptide) in BMDCs, indicating that P1-OVA1-FITC greatly promoted the uptake of antigens by DC cells. After 24 hours of culture, compared to the control group, a clear green fluorescence signal was observed on the BMDC cell membrane in the P1-OVA1-FITC group, indicating that OVA1 has been processed by DC cells and presented on the surface of dendritic cells to form an epitope peptide-MHC-I complex.

[0288] The inventors used flow cytometry to examine BMDCs under different drug-addition conditions. The results, shown in Figure 4A, show that the SIINFEKL-MHCI complex was significantly detected on the BMDC cell surface in the P1-OVA1 group compared to the other experimental groups. This indicates that P1-OVA1 promotes DC cells to process and present tumor antigen peptides onto the MHCI complex on their cell surface, facilitating DC cell activation of specific T cells and generating tumor immunity. Furthermore, the expression of MHCII, CD86, and CD80 surface markers on DC cells was significantly elevated, indicating that DC cells can be activated by P1-OVA1 and produce costimulatory receptors that facilitate T cell activation (Figure 4B).

[0289] At the same time, the inventors used ELISA to detect the secretion of cytokines in the cell culture supernatant. The results showed that the amount of TNF-α, IL-12β, IL-1β, and IL-6 cytokines secreted by BMDC cells under P1-OVA1 co-culture (Group 6) was significantly increased. These cytokines are only significantly secreted when DC cells mature, which once again proves that P1-OVA1 has the effect of maturing DC cells (Figure 4C).

[0290] The above data show that P1-OVA1 can efficiently deliver the exogenous antigen peptides covalently coupled to its surface (hemagglutinin protein on the viral envelope) to DC cells, and P1-OVA1 further activates DC cells by carrying the immune adjuvant CpG, which is more conducive to the anti-tumor effect of T cell activation, and has significantly beneficial technical effects.

[0291] Effect Example 2: Armed influenza virus activates humoral and cellular immunity through respiratory infection

[0292] (1) To prove that armed influenza virus can simulate the real virus and enter the lungs through the respiratory tract, fluorescently labeled P1-OVA1-FITC was used for verification. C57BL / 6 mice (6 to 8 weeks old, female) were intranasally administered with P1-OVA1-FITC (10 5 pfu per mouse) or control (15 μg OVA1-FITC and 3 μg CpG-Cy3 per mouse) (6 mice per group), and lung tissues were harvested at 24 h and 48 h, sectioned, stained, and imaged.

[0293] The results are shown in Figure 5A. 24 hours and 48 hours after administration, obvious green (OVA1) and red (CpG) fluorescence could be observed in the P1-OVA1-FITC group, while almost no fluorescence was observed in the control group. This indicates that the armed influenza virus can deliver exogenous peptides and adjuvants to the lungs, while the mixture of antigenic peptides and adjuvants administered alone is difficult to enter the lungs through the respiratory mucosa. The fluorescence statistics are shown in Figures 5B and 5C.

[0294] At the same time, the lung tissues and pulmonary mediastinal lymph nodes of mice were taken 24 hours after administration, and the FITC-positive DC cell content (i.e., OVA1-positive) was analyzed. The results are shown in Figure 6A. Only when OVA1 was covalently coupled to the virus, that is, in the P1-OVA1 group, FITC-positive DC cells could be detected in the lung tissues and pulmonary mediastinal lymph nodes, proving that armed influenza virus can deliver exogenous peptides to DC cells, and DC cells can migrate from the lungs to the lymph nodes to further produce an immune response.

[0295] (2) In another set of experiments, to demonstrate the effects of armed influenza virus on the proliferation and activation of immune cells in healthy mice, C57BL / 6 mice (6 to 8 weeks old, female) were nasally administered with P1-OVA1 (10 5 pfu / 25 μl per mouse), PBS control (25 μl per mouse), antigen peptide control (15 μg OVA1 + 3 μg CpG / 25 μl per mouse), or virus mixture control (10 5 pfu P1-1+15μg OVA1+3μg CpG / 25μl per mouse) (8 mice per group). 7 days after administration, lung tissues and spleens were harvested and ground into single cell suspensions, and then immune cell subtypes were determined by flow cytometry.

[0296] The results are shown in Figure 6B. Both the P1-OVA1-treated group and the virus-mixed control group significantly increased the levels of CD4 T, CD8 T, NK, and DC cells in the lung tissue. In the P1-OVA1-treated group, the above immune cells were further increased compared to the virus-mixed control group (Figure 6B), indicating that administration of replication-deficient influenza virus can significantly recruit immune cells in the lungs, and the armed P1-OVA1 further increased the proportion of immune cells, which is beneficial to the anti-tumor immune effect.

[0297] In addition, the results of OVA1-specific T cell detection showed that a large number of OVA1-specific CD8 T cells were produced in the P1-OVA1-treated group, both in the lungs and spleen. Moreover, CD8 T cells could secrete a large amount of IFNγ and TNFα after in vitro stimulation with OVA1 antigen peptides (Figure 6C). However, no such obvious changes were observed in the virus mixed control, indicating that only by covalently coupling exogenous antigen peptides to the virus can the presentation of exogenous antigens be promoted and the body be stimulated to produce a specific immune response against the antigen peptides. Simply mixing the virus with the antigen peptides and adjuvants would have a much worse effect.

[0298] (3) In another set of experiments, in order to demonstrate the effect of armed influenza virus on humoral immunity in healthy mice, OVA1 was replaced with OVA2 (B cell epitope of OVA protein) to obtain P1-OVA2. C57BL / 6 mice (6 to 8 weeks old, female) were nasally administered with P1-OVA2 (10 5 pfu / 25 μl per mouse), PBS control (25 μl per mouse), antigen peptide control (15 μg OVA2 + 3 μg CpG / 25 μl per mouse), or virus mixture control (10 5 pfu P1-1+15μg OVA2+3μg CpG / 25μl per mouse), serum was collected from mice 21 days later, and P1-OVA2 (10 5 pfu / 25 μl per mouse), PBS control (25 μl per mouse), antigen peptide control (15 μg OVA2 + 3 μg CpG / 25 μl per mouse), or virus mixture control (10 5 pfu P1-1+15μg OVA2+3μg CpG / 25μl per mouse) (8 mice per group), and the serum and lung lavage fluid of the mice were collected on day 42 to determine the content of different antibodies therein.

[0299] The results are shown in Figure 7A. After mice were immunized with P1-OVA2, IgG antibodies against OVA2 were significantly detected, and the antibody titer was further increased after the second immunization. At the same time, a large number of IgG1 and IgG2a type antibodies were detected after P1-OVA2 immunization (Figure 7A), indicating that the armed influenza virus can significantly stimulate the body to produce multiple types of antibodies against exogenous peptides and produce strong humoral immunity.

[0300] In addition, the results of antibody detection in lung lavage fluid showed that P1-OVA2 significantly stimulated the lung mucosa to produce IgA antibodies against OVA2, and the antibody level was comparable to the level of HA protein antibodies of influenza itself, indicating that armed influenza virus can significantly stimulate the body to produce mucosal immunity (Figure 7B).

[0301] The above data show that after the replication-deficient influenza virus is covalently coupled to the antigen peptide and modified membrane-inserted CpG adjuvant on the surface, nasal immunization has the effect of recruiting immune cells to the lungs and can stimulate the body to produce specific cellular immunity and humoral immunity against the coupled antigen peptide.

[0302] Effect Example 3: Experiment on preventing melanoma lung metastasis

[0303] These results demonstrate that armed influenza viruses carrying exogenous antigenic peptides have potent activation of DCs and antigen presentation, effectively activating lung immune cells and CD8 T cells specific for exogenous antigens. Consequently, this example investigates the effectiveness of armed influenza viruses in preventing lung metastasis.

[0304] C57BL / 6 mice (6 to 8 weeks old, female) were immunized with P1-OVA1 (10 5 pfu / 25 μl per mouse, administered once every 7 days for a total of two times), PBS control (25 μl per mouse, administered once every 7 days for a total of two times), antigen peptide control (15 μg OVA1 + 3 μg CpG / 25 μl per mouse, administered once every 7 days for a total of two times), or virus mixed control (10 5 pfu P1-1+15μg OVA1+3μg CpG / 25μl per mouse, administered once every 7 days, twice in total) (10 mice per group), 7 days after the second immunization, B16-F10-OVA melanoma cells (the cell line is a stable cell line that stably expresses OVA protein prepared by lentiviral transduction of B16-F10 cells (purchased from ATCC, CRL-6475)) were injected through the tail vein (3x10 5cells / 200 μl per mouse). Mice were killed 21 days after tumor inoculation, and the lungs of mice were harvested to count the melanoma lung metastasis. Tumor tissues were collected, minced, and digested in a buffer containing 2 mg / ml type II and type IV collagenase (GIBCO BRL) and 0.5 mg / ml DNase (Sigma Aldrich) at 37°C for 13 minutes to form a single-cell suspension. The content of OVA-specific CD8 T cells in the tumor microenvironment was then determined by flow cytometry.

[0305] The results are shown in FIG8A to FIG8C .

[0306] The results showed that the P1-OVA1 group demonstrated outstanding resistance to B16-F10-OVA lung metastasis and a significant reduction in tumor burden (Figures 8A and 8B). The virus-mixed control group also displayed some anti-tumor activity, further confirming that replication-defective influenza viruses can activate the lung immune system and demonstrate their superiority as tumor vaccines. Tumor-specific CD8 T cells in tumor tissue play an important role in tumor immunity. Analysis of T lymphocytes in mouse lung tumor nodules showed that administration of PBS or the antigen-peptide mixture failed to stimulate the immune system to produce CD8 T cells specific for the antigen peptide. Similarly, the virus-mixed control group generated only a small number of CD8 T cells specific for the antigen peptide, while the P1-OVA1 group induced a large number of CD8 T cells specific for the antigen peptide to enter the tumor tissue (Figure 8C).

[0307] Effect Example 4: Armed influenza virus regulates the tumor microenvironment

[0308] Influenza virus is a naturally immunogenic substance. Armed influenza virus combines the triple advantages of influenza virus, tumor antigen peptide, and immune adjuvant. This experiment explores the effect of armed influenza virus on the tumor microenvironment.

[0309] (1) C57BL / 6 mice (6 to 8 weeks old, female) were injected with B16-F10-OVA melanoma cells (3x10 5 cells / 200 μl per mouse), and 7 days after tumor inoculation, P1-OVA1 (10 5pfu / 25μl per mouse, administered once every 7 days for a total of two times), antigen peptide control (15μg OVA1 + 3μg CpG / 25μl per mouse, administered once every 7 days for a total of two times) (10 mice per group). Lung tumor nodules were harvested 7 days after the second administration, minced, and digested in a buffer containing 2mg / ml type II and type IV collagenase (GIBCO BRL) and 0.5mg / ml DNase (Sigma Aldrich) at 37°C for 13 minutes to form a single cell suspension. Flow cytometry was then used to determine immune cell subtypes in the tumor microenvironment, and frozen tumor sections were subjected to immunohistochemical analysis of T cell density. The dosing schedule is shown in Figure 9A.

[0310] The results are shown in FIG. 9B to FIG. 9D .

[0311] The results showed that, on the one hand, P1-OVA1 could significantly increase the content of IFNγ-positive CD8 T cells, CD4 T cells and NK cells in tumor tissues, significantly increase the content of OVA-specific CD8 T cells, and at the same time increase the content of DC-level type 1 macrophages (M1); on the other hand, P1-OVA1 could reduce the content of myeloid-derived suppressor cells (MDSCs), regulatory T cells (Treg) and type 2 macrophages (M2) in tumor tissues.

[0312] These results indicate that the immunosuppressive microenvironment of the tumor was reversed to an immunocompetent environment after P1-OVA1 treatment (Figure 9B). This result is consistent with immunohistochemical staining, which showed that P1-OVA1 treatment induced the greatest amount of T cell infiltration in tumor tissue compared with the control group (Figure 9C).

[0313] (2) Memory CD8 cells play an important role in tumor immunity. To study the status of memory CD8 T cells, C57BL / 6 mice (6 to 8 weeks old, female) were immunized with P1-OVA1 (10 5 pfu / 25 μl per mouse, administered once every 7 days for a total of two times), antigen peptide control (15 μg OVA1 + 3 μg CpG / 25 μl per mouse, administered once every 7 days for a total of two times), or virus mixed control (10 5 pfu P1-1+15μg OVA1+3μg CpG / 25μl per mouse, administered once every 7 days, twice in total) (8 mice per group), 40 days after the second immunization, T cell subset analysis in lung tissue showed that compared with the antigen peptide control and virus mixed control groups, OVA-specific tissue-resident T cells (T RM ) increased significantly (Figure 9D), while central memory CD8 T cells (T CM ) and effector memory CD8 T cells (TEM ) also increased significantly (Figure 9D), indicating that the armed influenza virus can significantly amplify memory T cells in vivo, especially antigen-specific memory CD8 T cells, which is beneficial to exert anti-tumor immune effects.

[0314] Effect Example 5: Experiment on delivering anti-PDL1 and CTLA4 nanobodies

[0315] Immune checkpoint inhibitors are currently the most important cancer immunotherapy drugs. As protein drugs, in situ release of immune checkpoint inhibitors at the tumor site can avoid drug degradation during circulation and the toxicity caused by on-target, off-tumor effects. Influenza viruses, as RNA viruses, can be modified to express and deliver exogenous proteins. This study investigated whether armed influenza viruses could serve as delivery vehicles for anti-PDL1 or anti-CTLA4 nanobodies.

[0316] A549 cells (ATCC, CRM-CCL-185) were infected with P1-OVA1, P15dxw-OVA1, or P15e03-OVA1 at an MOI of 1000. RNA was extracted 8 h after infection and reverse transcribed using the 12primer-2 primer in Table 9. The reverse transcription products were amplified by PCR using the PB2-FL-1-F and PB2-FL-1-R primers in Table 9. The PCR products were identified by agarose gel electrophoresis.

[0317] The results are shown in Figure 10A. The PCR bands of the P15dxw-OVA1 and P15e03-OVA1 groups are located at around 3 kb, which is about 1 kb longer than that of P1-1, and is exactly the length of the anti-pdl1 or 5e03 nanoantibody, proving that exogenous genes can be packaged into replication-defective influenza viruses, and that the surface-modified viruses can still infect cells and deliver viral RNA.

[0318] Table 9

[0319]

[0320] In another experiment, A549 cells were infected with P1-OVA1, P15dxw-OVA1, or P15e03-OVA1 at an MOI of 1000. The cell culture supernatant was collected 48 hours after infection and subjected to western blot analysis. The results are shown in Figure 10B. A target protein band was detected at around 15 kDa, demonstrating that P15dxw-OVA1 or P15e03-OVA1 can infect cells and express nanoantibodies that are secreted into the cell culture supernatant.

[0321] In another experiment, C57BL / 6 mice (6 to 8 weeks old, female) were intranasally administered with P1-OVA1 (10 5 pfu / 25 μl per mouse), P15dxw-OVA1 (10 5 pfu / 25 μl per mouse), P15e03-OVA1 (10 5 pfu / 25 μl per mouse), and 48 h later, lung tissues were collected from the mice, and antibody staining and imaging analysis were performed on the frozen lung tissue sections. The results are shown in Figure 10C. Compared with P1-OVA1, obvious fluorescence signals could be detected in P15dxw-OVA1 or P15e03-OVA1, demonstrating that P15dxw-OVA1 or P15e03-OVA1 can be expressed in mice to produce antibodies.

[0322] Effect Example 6: Anti-pulmonary metastasis tumor experiment using armed influenza virus delivered with anti-PDL1 nanoantibodies

[0323] The above results show that P15dxw-OVA1 can produce anti-pdl1 nanoantibodies in mice, especially in the lungs. This experiment explores the anti-tumor lung metastasis effect of this armed influenza virus that can produce nanoantibodies in situ in vivo, especially in the lung tumor site.

[0324] (1) Anti-melanoma lung metastasis experiment

[0325] In order to make the invention more widely applicable, this experiment used a mouse wild-type melanoma B16-F10-luci model and used a mixed tumor-associated antigen peptide to modify the surface of the replication-deficient influenza virus according to Preparation Example 4. The resulting virus was P15dxw-B16.

[0326] C57BL / 6 mice (6 to 8 weeks old, female) were injected with B16-F10-luci melanoma cells (ATCC, CRL-6475-LUC2) (3 × 10 5 cells / 200 μl per mouse), and 7 days after tumor inoculation, PBS control (25 μl per mouse, administered once every 7 days, twice in total), antigen peptide control (15 μg B16 antigen peptide mixture + 3 μg CpG / 25 μl per mouse, administered once every 7 days, twice in total), P1-B16 (10 5 pfu / 25 μl per mouse, administered once every 7 days, twice in total) or P15dxw-B16 (10 5 pfu / 25μl per mouse, administered once every 7 days, twice in total), and the PBS group, antigen peptide control group, and P1-B16 group were intraperitoneally injected with anti-pdl1 antibody (Ultra-LEAF TMPurified anti-mouse CD274 (B7-H1, PD-L1) Antibody (purchased from biolegend, cat. no. 124338) (100 μg per mouse) (10 mice per group). Lung tumor growth was recorded by fluorescence imaging every 3 days starting on day 10. Mice were sacrificed 28 days after tumor inoculation, and lung tissue, spleen, and peripheral blood were extracted to prepare single-cell suspensions. Flow cytometry was then used to determine the content of immune cells in different tissues, and immunohistochemical analysis of T cell density was performed on frozen lung tissue sections.

[0327] The results are shown in Figures 11A to 11E. Compared with the anti-pdl1 group alone or the antigen peptide combined with anti-pdl1 group, the tumors in the P1-B16 combined with intraperitoneal injection group were significantly alleviated, and the survival of the mice was significantly improved (Figures 11A, 11B, and 11C). Compared with the P1-B16 combined with intraperitoneal injection of anti-pdl1 treatment, the tumors in the P15dxw-B16 treatment group were further suppressed, and the survival of the mice was longer, indicating that in situ delivery of anti-pdl1 has a more effective anti-tumor effect than systemic delivery. Immunohistochemical staining results showed that compared with the anti-pdl1 group alone or the antigen peptide combined with anti-pdl1 group, the P1-B16 combined with intraperitoneal injection of anti-pdl1 group or the P15dxw-B16 group induced a large number of T cell infiltration in the lung tissue (Figure 11D).

[0328] Consistent with the immunohistochemistry results, flow cytometry analysis results (Figure 11E) show that P15dxw-B16 significantly increased the levels of IFNγ-positive CD8 and CD4 T cells in the lungs, spleen, and peripheral blood of mice. Consistent with the results for IFNγ-positive CD8 T cells, P15dxw-B16 also increased the level of granzyme B-positive CD8 T cells. PD-1, LAG-3, and TIM-3 are surface markers of T cell exhaustion. CD8 T cell detection in different tissues showed that P15dxw-B16 further reduced the expression of PD-1, TIM-3, and LAG-3, reducing the degree of T cell exhaustion. This suggests that in situ release of anti-PDL1 can effectively alleviate tumor cell suppression of T cells, facilitating anti-tumor effects.

[0329] (2) Anti-breast cancer lung metastasis experiment

[0330] In order to make the invention more widely applicable, this experiment used the mouse wild-type breast cancer 4T1-luci model and used the tumor neoantigen peptide to modify the surface of the replication-deficient influenza virus according to Preparation Example 4. The resulting virus was P15dxw-4T1.

[0331] BALB / C mice (6 to 8 weeks old, female) were injected with 4T1-luci breast cancer cells (5 × 10 5 cells / 200 μl per mouse), and 7 days after tumor inoculation, PBS control (25 μl per mouse, administered once every 7 days, twice in total), antigen peptide control (15 μg 4T1 neoantigen peptide + 3 μg CpG / 25 μl per mouse, administered once every 7 days, twice in total), P1-4T1 (10 5 pfu / 25 μl per mouse, administered once every 7 days, twice in total) or P15dxw-4T1 (10 5 pfu / 25 μl per mouse, administered once every 7 days, twice in total) (10 mice per group), the PBS group, antigen peptide control group and P1-4T1 group were injected intraperitoneally with anti-pdl1 antibody (Ultra-LEAF TM Purified anti-mouse CD274 (B7-H1, PD-L1) Antibody, purchased from biolegend, cat. no. 124338) (100 μg per mouse), and lung tumor growth was recorded by fluorescence imaging every 3 days starting from day 11. The results are shown in Figure 12A. Compared with the anti-pdl1 group alone and the antigen peptide combined with anti-pdl1 group, the P1-4T1 combined with anti-pdl1 group and the P15dxw-4T1 group both exerted significant anti-tumor effects, and the mice in the P15dxw-4T1 group had a longer survival period than the mice in the P1-4T1 combined with anti-pdl1 group.

[0332] (3) Anti-colon cancer lung metastasis experiment

[0333] In order to make the invention more widely applicable, this experiment used a mouse wild-type colon cancer CT26-luci model and used a tumor neoantigen peptide mixture to surface modify the replication-deficient influenza virus according to Preparation Example 4. The resulting virus was P15dxw-CT26.

[0334] BALB / C mice (6 to 8 weeks old, female) were injected with CT26-luci breast cancer cells (1x10 6 cells / 200 μl per mouse), and 7 days after tumor inoculation, PBS control (25 μl per mouse, administered once every 7 days, twice in total), antigen peptide control (15 μg CT26 neoantigen peptide mixture + 3 μg CpG / 25 μl per mouse, administered once every 7 days, twice in total), P1-CT26 (10 5 pfu / 25 μl per mouse, administered once every 7 days, twice in total) or P15dxw-CT26 (10 5pfu / 25 μl per mouse, administered once every 7 days, twice in total) (10 mice per group), and the PBS group, antigen peptide control group, and P1-CT26 group were intraperitoneally injected with anti-pdl1 antibody (Ultra-LEAF TM Purified anti-mouse CD274 (B7-H1, PD-L1) Antibody, purchased from biolegend, cat. no. 124338) (100 μg per mouse), and lung tumor growth was recorded by fluorescence imaging every 5 days starting from day 11. The results are shown in Figure 12B. Compared with the anti-PDL1 group alone and the antigen peptide combined with anti-PDL1 group, the P1-4T1 combined with anti-PDL1 group and the P15dxw-4T1 group both exerted significant anti-tumor effects. At the end of the experiment, no mice were found to die in the P1-4T1 combined with anti-PDL1 group or the P15dxw-4T1 group.

[0335] These results demonstrate that armed influenza viruses can produce synergistic anti-tumor effects with anti-PDL1 antibodies. Furthermore, delivery of anti-PDL1 nanobodies via armed influenza viruses can effectively treat multiple types of lung metastases, and that in situ delivery of immune checkpoint inhibitors is superior to systemic delivery of combination therapies.

[0336] Effect Example 7: Anti-PDL1 Nanobody-Delivered Armed Influenza Virus Against Lung Metastasis and Distal Tumors

[0337] According to the results in Effect Example 6, a significant increase in anti-tumor immune cells was detected in the spleen and peripheral blood of mice treated with P15dxw-B16. This shows that intranasal immunization with P15dxw-B16 or P1-B16 can produce a systemic immune-enhancing effect. Therefore, this experiment explored whether this systemic immune-enhancing effect would have a therapeutic effect on distal tumors other than lung tumors.

[0338] C57BL / 6 mice (6 to 8 weeks old, female) were injected with B16-F10-luci melanoma cells (3 × 10 5 cells / 200 μl per mouse), and 5 days after tumor inoculation, PBS control (25 μl per mouse, administered once every 7 days, twice in total), antigen peptide control (15 μg B16 antigen peptide mixture + 3 μg CpG / 25 μl per mouse, administered once every 7 days, twice in total) or P15dxw-B16 (10 5 pfu / 25 μl per mouse, administered once every 7 days, twice in total) (10 mice per group), and B16-F10-luci melanoma cells (5×105 cells per mouse), and on days 23 and 28, anti-pdl1 antibody (Ultra-LEAF TM Purified anti-mouse CD274 (B7-H1, PD-L1) Antibody, purchased from biolegend, product number 124338) (100 μg per mouse), tumor volume was measured every day after subcutaneous inoculation, mice were killed on the 38th day, mouse tumor tissue was extracted, the tumor was minced and digested in a buffer containing 2 mg / ml type II and type IV collagenase (GIBCO BRL) and 0.5 mg / ml DNase (Sigma Aldrich) at 37°C for 13 minutes to form a single cell suspension, and then the immune cell subtypes in the tumor microenvironment were determined by flow cytometry.

[0339] The results are shown in Figures 13A to 13F. The P15dxw-B16 combined with anti-pdl1 antibody treatment group significantly inhibited the growth of lung and distal tumors and prolonged the survival of mice (Figures 13B to 13E). The results of flow cytometry analysis of T cells in tumor tissue are shown in Figure 13F. A large number of Trp2 antigen-positive CD8 T cells were detected in the tumors of the P15dxw-B16 combined with anti-pdl1 antibody treatment group, indicating that P15dxw-B16 combined with anti-pdl1 antibody treatment can generate systemic CD8 T cells against exogenous antigen peptides in mice, thereby facilitating the treatment of systemic spread of tumors.

[0340] Effect Example 7: Experiment to prove the safety of armed influenza virus

[0341] HEK293-PYL cells were infected with wild-type WSN virus, P1-OVA1, or P15dxw-OVA1 at an MOI of 100, and experimental groups were set up with or without NAEK in the culture medium. The experimental results are shown in Figure 14A. Regardless of whether the culture medium contained NAEK, the wild-type WSN virus caused cell death, while the P1-OVA1 and P15dxw-OVA1 groups caused cell death only in the presence of NAEK and did not replicate in the absence of NAEK, indicating that the armed influenza virus is absolutely safe at the cellular level.

[0342] The LD50 of influenza virus WSN in mice is 10 4 BALB / C mice (6 to 8 weeks old, female) were inoculated with PBS (25 μl per mouse), WSN (2×10 4 / 25μl per mouse), P1-OVA1 (10 6 / 25μl per mouse) or P15dxw-OVA1 (10 6 / 25μl per mouse) (8 mice per group), body weight was measured every day after inoculation, mice were killed 14 days later, lung tissues were weighed, and frozen lung, liver, spleen, kidney, and heart sections were subjected to H&E staining analysis.

[0343] The results, as shown in Figures 14B to 14D, showed a significant decrease in body weight in the WSN virus-inoculated mice, with mice beginning to die eight days after inoculation. However, there was no significant change in body weight in the P1-OVA1 and P15dxw-OVA1-inoculated mice (Figure 14B). Consistent with the body weight results, the WSN virus-inoculated mice developed significant lung edema and weight gain due to WSN virus infection, while the P1-OVA1 and P15dxw-OVA1-inoculated mice showed no lung edema (Figure 14C). H&E staining of tissue sections revealed no lesions in any organ in the P1-OVA1 and P15dxw-OVA1-inoculated mice, confirming the safety of the armed influenza virus (Figure 14D).

[0344] Although specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and substitutions may be made to those details in light of all the teachings disclosed herein, and such modifications are within the scope of the present invention. The full scope of the present invention is given by the appended claims and any equivalents thereof.

Claims

1. A mutant influenza virus, wherein The nucleic acid encoding the HA protein and / or the nucleic acid encoding the NA protein of the influenza virus contains one or more (eg, 2-5) UAG codons.

2. The mutant influenza virus according to claim 1, wherein The coding nucleic acid codons of the HA protein are mutated to UAG codons at one or more of the following sites: C84, S86, S92, S126, E132, P135, G147, K170, K176, N179, S201, I256, S53, K57, K62, I64, A65, L67, K71, or P82.

3. The mutated influenza virus according to any one of claims 1 to 2, wherein The nucleic acid encoding the PB1 protein, PA protein and / or NP protein of the influenza virus contains one or more (eg, 2-5) UAG codons.

4. The mutated influenza virus according to claim 3, wherein the encoding nucleic acid codon at the following site is mutated to a UAG codon: R52 site of PB1 protein, R266 site of PA protein, and / or D101 site of NP protein.

5. The mutated influenza virus according to any one of claims 1 to 4, wherein the encoding nucleic acid codon at the following site is mutated to a UAG codon: The R52 site of the PB1 protein, the R266 site of the PA protein, the S53 site of the HA protein, and the D101 site of the NP protein; K33 site of PB2 protein, R266 site of PA protein, S53 site of HA protein and D101 site of NP protein; or The K33 site of PB2 protein, the R52 site of PB1 protein, the S53 site of HA protein and the D101 site of NP protein.

6. The mutant influenza virus according to any one of claims 1 to 5, wherein The influenza virus is a wild-type influenza virus before mutation; preferably, it is a wild-type influenza virus A / WSN / 1933.

7. The mutated influenza virus according to any one of claims 1 to 6, wherein: The amino acid sequence of the unmutated PB2 protein is identical to the amino acid sequence encoded by SEQ ID NO: 1; The amino acid sequence of the unmutated PB1 protein is identical to the amino acid sequence encoded by SEQ ID NO: 2; The amino acid sequence of the unmutated PA protein is identical to the amino acid sequence encoded by SEQ ID NO: 3; The amino acid sequence of the unmutated HA protein is identical to the amino acid sequence encoded by SEQ ID NO: 4; The amino acid sequence of the unmutated NP protein is identical to the amino acid sequence encoded by SEQ ID NO:5; The amino acid sequence of the unmutated NA protein is identical to the amino acid sequence encoded by SEQ ID NO: 6; The amino acid sequence of the unmutated M protein is identical to the amino acid sequence encoded by SEQ ID NO:7; and / or The amino acid sequence of the unmutated NS protein is identical to the amino acid sequence encoded by SEQ ID NO:

8.

8. The mutated influenza virus according to any one of claims 1 to 7, wherein The one or more UAG codons are located upstream of the stop codon.

9. The mutated influenza virus according to any one of claims 1 to 7, wherein The amino acids at the positions corresponding to the one or more UAG codons are the same or different non-natural amino acids such as NAEK.

10. A mutant influenza virus, wherein the following positions are mutated to unnatural amino acids, such as NAEK: The R52 site of the PB1 protein, the R266 site of the PA protein, the S53 site of the HA protein, and the D101 site of the NP protein; K33 site of PB2 protein, R266 site of PA protein, S53 site of HA protein and D101 site of NP protein; or The K33 site of PB2 protein, the R52 site of PB1 protein, the S53 site of HA protein and the D101 site of NP protein.

11. A recombinant influenza virus obtained by recombining the mutated influenza virus according to any one of claims 1 to 10 with an exogenous nucleic acid; Preferably, the exogenous nucleic acid is inserted into the nucleic acid of PB2, PB1 or PA; Preferably, the exogenous nucleic acid is a nucleic acid encoding an anti-tumor antibody; Preferably, the anti-tumor antibody is an anti-PD-1 antibody, an anti-PD-L1 antibody and / or an anti-CTLA-4 antibody; Preferably, the anti-tumor antibody is a nanobody, a single-chain antibody, a monoclonal antibody or a bispecific antibody; Preferably, the anti-tumor antibody is an anti-PD-1 nanobody or an anti-CTLA-4 nanobody; Preferably, the amino acid sequence of the anti-PD-1 nanobody is as shown in SEQ ID NO: 9; Preferably, the amino acid sequence of the anti-CTLA-4 nanobody is as shown in SEQ ID NO:

10.

12. A modified influenza virus, wherein One or more anti-tumor antigen peptides are linked to the surface of the mutant influenza virus according to any one of claims 1 to 10 or the recombinant influenza virus according to claim 11.

13. The modified influenza virus according to claim 12, wherein The antigenic peptide is linked to the HA protein or NA protein on the surface of the virus; preferably, it is linked to a non-natural amino acid such as NAEK in the HA protein or NA protein.

14. The modified influenza virus according to any one of claims 12 to 13, wherein The antigenic peptide is linked to the non-natural amino acid of the HA protein in the form of any compound selected from the compounds shown in Formula III-1 to Formula III-6:

15. The modified influenza virus according to any one of claims 12 to 14, wherein The amino acid sequence of the antigenic peptide is independently selected from any one of SEQ ID NOs: 49-55.

16. The modified influenza virus according to any one of claims 12 to 15, further comprising a CpG adjuvant attached to its surface; Preferably, the sequence of the CpG adjuvant is shown in SEQ ID NO: 20; Preferably, the CpG adjuvant is attached to the virus surface in the form of a compound represented by formula IV, 17. A pharmaceutical composition comprising the mutant influenza virus according to any one of claims 1 to 10, the recombinant influenza virus according to claim 11, and / or the modified influenza virus according to any one of claims 12 to 16; Optionally, the pharmaceutical composition further comprises one or more pharmaceutically acceptable excipients; Preferably, the pharmaceutical composition is a vaccine composition; Preferably, the vaccine composition is an anti-tumor vaccine composition; Preferably, the tumor is selected from primary lung tumors and lung metastatic tumors; Preferably, the tumor is selected from one or more of lung cancer (small cell lung cancer or non-small cell lung cancer), melanoma lung metastasis, breast cancer lung metastasis and colon cancer lung metastasis.

18. Use of the mutant influenza virus according to any one of claims 1 to 10, the recombinant influenza virus according to claim 11, and / or the modified influenza virus according to any one of claims 12 to 16 in the preparation of a medicament for treating or preventing tumors; Preferably, the tumor is selected from primary lung tumors and lung metastatic tumors; Preferably, the tumor is selected from one or more of lung cancer (small cell lung cancer or non-small cell lung cancer), melanoma lung metastasis, breast cancer lung metastasis and colon cancer lung metastasis.

19. A method for treating or preventing tumors, comprising administering to a subject in need thereof an effective amount of the mutant influenza virus according to any one of claims 1 to 10, the recombinant influenza virus according to claim 11, and / or the modified influenza virus according to any one of claims 12 to 16; Preferably, the tumor is selected from primary lung tumors and lung metastatic tumors; Preferably, the tumor is selected from one or more of lung cancer (small cell lung cancer or non-small cell lung cancer), melanoma lung metastasis, breast cancer lung metastasis and colon cancer lung metastasis.

20. The mutant influenza virus according to any one of claims 1 to 10, the recombinant influenza virus according to claim 11, and / or the modified influenza virus according to any one of claims 12 to 16, for use in treating or preventing tumors; Preferably, the tumor is selected from primary lung tumors and lung metastatic tumors; Preferably, the tumor is selected from one or more of lung cancer (small cell lung cancer or non-small cell lung cancer), melanoma lung metastasis, breast cancer lung metastasis and colon cancer lung metastasis.

21. A plasmid-based influenza virus reverse genetics system comprising: (1) 8 recombinant plasmids containing PB2 gene, PB1 gene, PA gene, HA gene, NP gene, NA gene, M gene and NS gene, respectively; and (2) Four other recombinant plasmids containing the PB2 gene, PB1 gene, PA gene, and NP gene, respectively; The vector used in the recombinant plasmid in (2) is different from the vector used in the recombinant plasmid in (1); and the PB2 gene, PB1 gene, PA gene and NP gene in (2) are wild type; The HA gene and / or NA gene contains one or more (eg, 2-5) TAG codons.

22. The plasmid-based influenza virus reverse genetics system according to claim 21, wherein The nucleic acid codons encoding one or more of the following sites of the HA gene are mutated to TAG codons: C84, S86, S92, S126, E132, P135, G147, K170, K176, N179, S201, I256, S53, K57, K62, I64, A65, L67, K71, or P82.

23. The plasmid-based influenza virus reverse genetics system according to any one of claims 21 to 22, wherein: The PB1 gene, PA gene and / or NP gene in (1) contain one or more (eg, 2-5) TAG codons.

24. The plasmid-based influenza virus reverse genetics system according to claim 23, wherein the nucleic acid codon encoding the following site is mutated to a TAG codon: R52 site of PB1 protein, R266 site of PA protein, and / or D101 site of NP protein.

25. The plasmid-based influenza virus reverse genetics system according to any one of claims 21 to 24, wherein the nucleic acid codon encoding the following site is mutated to a TAG codon: The R52 site of the PB1 protein, the R266 site of the PA protein, the S53 site of the HA protein, and the D101 site of the NP protein; K33 site of PB2 protein, R266 site of PA protein, S53 site of HA protein and D101 site of NP protein; or The K33 site of PB2 protein, the R52 site of PB1 protein, the S53 site of HA protein and the D101 site of NP protein.

26. The plasmid-based influenza virus reverse genetics system according to any one of claims 21 to 25, wherein: The influenza virus is a wild-type influenza virus before mutation; preferably, it is a wild-type influenza virus A / WSN / 1933.

27. The plasmid-based influenza virus reverse genetics system according to any one of claims 21 to 26, wherein: The nucleic acid sequence of the unmutated PB2 gene is shown in SEQ ID NO: 1; The nucleic acid sequence of the unmutated PB1 gene is shown in SEQ ID NO: 2; The nucleic acid sequence of the unmutated PA gene is shown in SEQ ID NO: 3; The nucleic acid sequence of the unmutated HA gene is shown in SEQ ID NO: 4; The nucleic acid sequence of the unmutated NP gene is shown in SEQ ID NO: 5; The nucleic acid sequence of the unmutated NA gene is shown in SEQ ID NO: 6; The nucleic acid sequence of the unmutated M gene is shown in SEQ ID NO: 7; and / or The nucleic acid sequence of the unmutated NS gene is shown in SEQ ID NO:

8.

28. The plasmid-based influenza virus reverse genetics system according to any one of claims 21 to 27, wherein: The one or more TAG codons are located upstream of the stop codon.

29. The plasmid-based influenza virus reverse genetics system according to any one of claims 21 to 27, wherein: The amino acids at the positions corresponding to the one or more TAG codons are the same or different non-natural amino acids such as NAEK.

30. An influenza virus rescued by the plasmid-based influenza virus reverse genetics system according to any one of claims 21 to 29.

Images